Restriction Map of ALP1/YNL270C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

ALP1/YNL270C on chromosome XIV from coordinates 137661 to 135940.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 BseGI | Tsp4CI* TspEI | | Hpy166II | MaeI | | |FokI Hin4II* | | AluI | | || TspDTI |StyI | | CviJI | | || | MslI |SecI* SetI | | TspDTI \ \ \\ \ \ \\ \ \ \ \ ATGGATGAAACTGTGAACATACAAATGTCCAAGGAAGGTCAGTATGAAATCAATTCTAGC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTACTTTGACACTTGTATGTTTACAGGTTCCTTCCAGTCATACTTTAGTTAAGATCG / / / / / / / / / / /// | | | | | MslI | | SetI | ||CviJI | | | | FokI | SecI* | ||AluI | | | TspDTI | StyI | |MaeI | | Hpy166II Hin4II* | TspDTI | Tsp4CI* | SetI BseGI TspEI M D E T V N I Q M S K E G Q Y E I N S S W M K L * T Y K C P R K V S M K S I L A G * N C E H T N V Q G R S V * N Q F * L ----:----|----:----|----:----|----:----|----:----|----:----| X S S V T F M C I D L S P * Y S I L E L X P H F Q S C V F T W P L D T H F * N * H I F S H V Y L H G L F T L I F D I R A TspDTI | AclI | MaeII | |MaeIII | |Hin4II* | || SetI MnlI BseRI | || TaiI SetI | MnlI | BseRI SspI | || | HphI \ \ \ \ \ \ \ \\ \ \ TCTATAATAAAAGAGGAGGAGTTTGTAGATGAACAATATTCTGGGGAGAACGTTACGAAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AGATATTATTTTCTCCTCCTCAAACATCTACTTGTTATAAGACCCCTCTTGCAATGCTTC / / / / / / // / / | MnlI | BseRI SspI TspDTI || | MaeIII MnlI BseRI || | HphI || MaeII || AclI |Hin4II* TaiI SetI S I I K E E E F V D E Q Y S G E N V T K L * * K R R S L * M N N I L G R T L R R Y N K R G G V C R * T I F W G E R Y E G ----:----|----:----|----:----|----:----|----:----|----:----| E I I F S S S N T S S C Y E P S F T V F S * L L L P P T Q L H V I N Q P S R * S R Y Y F L L L K Y I F L I R P L V N R L AluI BseGI CviJI |TseI Ecl136II ||BisI | SetI MnlI |||BlsI | SduI | BbvI |||| DdeI | SacI CviJI BccI | SfaNI |||| Bpu10I HphI | HgiAI* HaeIII | BcgI | | TaqI |||| | FokI BcgI | HgiJII* \ \ \ \ \ \ \\\\ \ \ \ \ \ GCCATCACCACAGAGAGAAAAGTCGAGGATGATGCTGCTAAGGAAACAGAGAGCTCACCA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTAGTGGTGTCTCTCTTTTCAGCTCCTACTACGACGATTCCTTTGTCTCTCGAGTGGT / / / / / /// / /// / / HaeIII BccI MnlI SfaNI | ||| | ||HphI | Ecl136II CviJI BcgI TaqI | ||| | |BcgI | CviJI BbvI | ||| | FokI | AluI | ||| Bpu10I HgiJII* | ||| DdeI HgiAI* | ||TseI SacI | |BisI SduI | BlsI SetI BseGI A I T T E R K V E D D A A K E T E S S P P S P Q R E K S R M M L L R K Q R A H H H H H R E K S R G * C C * G N R E L T T ----:----|----:----|----:----|----:----|----:----|----:----| A M V V S L F T S S S A A L S V S L E G P W * W L S F L R P H H Q * P F L S S V G D G C L S F D L I I S S L F C L A * W TseI |BisI ||BlsI |||AciI |||NspBII* ||||BisI |||||BlsI SetI |||||NmeAIII Ksp632I* | MboII HphI ||||||TauI | MnlI | |AciI |MseI ||||||Hin4I BbvI BseGI FokI \ \ \ \\ \\ \\\\\\\ \ \ \ CAAGAAAGAAGAGAGGTGAAGCGGAAGTTAAAGCAGCGGCATATAGGGATGATTGCTCTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTTCTTCTCTCCACTTCGCCTTCAATTTCGTCGCCGTATATCCCTACTAACGAGAG // / / / / / ///// / / || SetI | | | | ||||BisI | BseGI |Ksp632I* | | | | ||||AciI BbvI MnlI | | | | |||BlsI | | | | ||NspBII* | | | | ||NmeAIII | | | | ||TseI | | | | ||TauI | | | | |BisI | | | | Hin4I | | | | BlsI | | | MseI | | HphI | AciI MboII Q E R R E V K R K L K Q R H I G M I A L K K E E R * S G S * S S G I * G * L L S R K K R G E A E V K A A A Y R D D C S R ----:----|----:----|----:----|----:----|----:----|----:----| C S L L S T F R F N F C R C I P I I A R V L F F L P S A S T L A A A Y L S S Q E L F S S L H L P L * L L P M Y P H N S E MroNI AsuI* Cfr10I AciI |BmgT120I |HpaII |BisI ||CviJI ||NaeI ||BlsI ||HaeIII ||Cac8I ||HgiCI* ||| TspEI AsuI* |||AsuI* |||TauI ||| |BslFI AvaII ||||CviJI ||||NlaIV ||| || EciI |BmgT120I ||||HaeIII ||||| Hin4I ||| || | MnlI || AciI ||||BmgT120I \\\\\ \ \\\ \\ \ \ \\ \ \\\\\ GGCGGCACCATTGGGACGGGCCTCATAATTGGTATTGGTCCGCCATTGGCACACGCCGGC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCCGTGGTAACCCTGCCCGGAGTATTAACCATAACCAGGCGGTAACCGTGTGCGGCCG /// / / // / // // / //// ||| | HgiCI* |AsuI* | |BslFI || AciI |||BmgT120I ||| Hin4I | | TspEI |AvaII ||Cfr10I ||| NlaIV | | MnlI |AsuI* ||HaeIII ||FokI | EciI BmgT120I ||MroNI ||BisI BmgT120I ||CviJI ||AciI HaeIII |HpaII |BlsI CviJI Cac8I TauI NaeI G G T I G T G L I I G I G P P L A H A G A A P L G R A S * L V L V R H W H T P A R H H W D G P H N W Y W S A I G T R R P ----:----|----:----|----:----|----:----|----:----|----:----| P P V M P V P R M I P I P G G N A C A P R R C W Q S P G * L Q Y Q D A M P V R R A A G N P R A E Y N T N T R W Q C V G A TspGWI Tsp4CI* | TspRI HgiCI* | | BslFI Hin4I | NlaIV EcoRV | | | MaeIII BsaXI \ \ \ \ \ \ \ \ CCTGTTGGTGCCTTGATATCGTATTTATTTATGGGGACAGTGATTTACTCCGTTACACAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGACAACCACGGAACTATAGCATAAATAAATACCCCTGTCACTAAATGAGGCAATGTGTT / / / / / // / / / AsuI* | | EcoRV | |Tsp4CI* | | MaeIII | HgiCI* | TspGWI | | BsaXI NlaIV TspRI | Hin4I BslFI P V G A L I S Y L F M G T V I Y S V T Q L L V P * Y R I Y L W G Q * F T P L H N C W C L D I V F I Y G D S D L L R Y T I ----:----|----:----|----:----|----:----|----:----|----:----| G T P A K I D Y K N I P V T I * E T V C G Q Q H R S I T N I * P S L S K S R * V R N T G Q Y R I * K H P C H N V G N C L BssKI | HpaII | ScrFI | CauII* | |MboII | |BsaXI | |TspDTI MaeIII | ||MaeIII MboII BccI Tsp45I | |||Hin4I BbvII* \ \ \ \\\\ \ TCGTTAGGAGAGATGGTCACTTTTATCCCGGTTACATCTTCATTTTCTGTCTTCGCCCAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGCAATCCTCTCTACCAGTGAAAATAGGGCCAATGTAGAAGTAAAAGACAGAAGCGGGTT / / ////// / / / BccI | |||||| | | BbvII* | |||||| | MboII | |||||| MaeIII | |||||BssKI | ||||HpaII | |||CauII* | |||ScrFI | ||MboII | |TspDTI | BsaXI | Hin4I Tsp45I MaeIII S L G E M V T F I P V T S S F S V F A Q R * E R W S L L S R L H L H F L S S P K V R R D G H F Y P G Y I F I F C L R P K ----:----|----:----|----:----|----:----|----:----|----:----| D N P S I T V K I G T V D E N E T K A W I T L L S P * K * G P * M K M K Q R R G R * S L H D S K D R N C R * K R D E G L Cac8I | Hin6I | |GlaI | |Eco47III | ||HhaI TatI | ||BseYI |Csp6I | |||HaeII ||RsaI | |||BsiYI* ||| TspGWI | |||| GsaI ||| |CviJI | |||| MwoI ||| ||BsrI HphI \ \\\\ \ \\\ \\\ \ AGATTTCTGTCGCCAGCGCTGGGAGCGACTAACGGATATATGTACTGGCTGTCGTGGTGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAAAGACAGCGGTCGCGACCCTCGCTGATTGCCTATATACATGACCGACAGCACCACA ////// / /// // / |||||| BseYI ||| || HphI |||||MwoI ||| |CviJI ||||Hin6I ||| BsrI ||||GsaI ||TspGWI |||Eco47III ||TatI |||GlaI |Csp6I ||BsiYI* RsaI ||HhaI |HaeII Cac8I R F L S P A L G A T N G Y M Y W L S W C D F C R Q R W E R L T D I C T G C R G V I S V A S A G S D * R I Y V L A V V V F ----:----|----:----|----:----|----:----|----:----|----:----| L N R D G A S P A V L P Y I Y Q S D H H F I E T A L A P L S * R I Y T S A T T T S K Q R W R Q S R S V S I H V P Q R P T TspGWI TatI | Hin4II* |Csp6I | | BsrI ||RsaI SetI | | TspRI BsiYI* ||ScaI BsrI \ \ \ \ \ \\\ \ TTCACCTTCGCACTGGAACTATCCGTTTTGGGGAAAGTTATTCAGTACTGGACAGAAGCA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTGGAAGCGTGACCTTGATAGGCAAAACCCCTTTCAATAAGTCATGACCTGTCTTCGT / / / // / /// / / SetI | | |BsrI BsiYI* ||| BsrI TspRI | | Hin4II* ||TatI | TspGWI |Csp6I TspRI ScaI RsaI F T F A L E L S V L G K V I Q Y W T E A S P S H W N Y P F W G K L F S T G Q K Q H L R T G T I R F G E S Y S V L D R S S ----:----|----:----|----:----|----:----|----:----|----:----| K V K A S S S D T K P F T I * Y Q V S A N * R R V P V I R K P S L * E T S S L L E G E C Q F * G N Q P F N N L V P C F C BtsI TspRI | MaeI | | AciI | | |BisI | | ||BlsI | | |||TauI | | |||CviJI | | ||||MnlI | | ||||| MboI | | ||||| | DpnI | | ||||| | |BstKTI | | ||||| | ||Hpy178III* | | ||||| | |||BsaBI | | ||||| | ||||MboI FatI | | ||||| | ||||| DpnI AflIII | | ||||| | ||||| BinI* MseI BspLU11I* | | ||||| | ||||| |BstKTI |HpaI |CviAII | | ||||| | ||||| || HgiCI* |HindII || NspI | | ||||| | ||||| || | NlaIV |Hpy166II || NlaIII \ \ \\\\\ \ \\\\\ \\ \ \ \\ \\ \ GTGCCTCTAGCGGCTTGGATCGTGATCTTTTGGTGCCTGTTAACTTCAATGAACATGTTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CACGGAGATCGCCGAACCTAGCACTAGAAAACCACGGACAATTGAAGTTACTTGTACAAA / ///// // /////// / / // / // BtsI ||||| || ||||||MboI | | |MseI | |BspLU11I* ||||| || |||||BinI* | | Hpy166II | |AflIII ||||| || ||||DpnI | | HindII | |FatI ||||| || |||BstKTI | | HpaI | CviAII ||||| || ||Hpy178III* | HgiCI* NlaIII ||||| || |BsaBI NlaIV NspI ||||| || MboI ||||| |DpnI ||||| BstKTI ||||CviJI ||||MnlI |||BisI |||AciI ||BlsI |TauI MaeI V P L A A W I V I F W C L L T S M N M F C L * R L G S * S F G A C * L Q * T C F A S S G L D R D L L V P V N F N E H V S ----:----|----:----|----:----|----:----|----:----|----:----| T G R A A Q I T I K Q H R N V E I F M N L A E L P K S R S R K T G T L K L S C T H R * R S P D H D K P A Q * S * H V H K ApoI MnlI TspDTI TspEI TspGWI BtgZI | SetI FnuDII* \ \ \ \ \ \ \ CCCGTAAAGTATTACGGAGAATTTGAGTTTTGTATTGCCTCCATAAAGGTCATCGCGTTG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GGGCATTTCATAATGCCTCTTAAACTCAAAACATAACGGAGGTATTTCCAGTAGCGCAAC / / / / // / TspDTI | TspGWI BtgZI |MnlI FnuDII* TspEI SetI ApoI P V K Y Y G E F E F C I A S I K V I A L P * S I T E N L S F V L P P * R S S R C R K V L R R I * V L Y C L H K G H R V A ----:----|----:----|----:----|----:----|----:----|----:----| G T F Y * P S N S N Q I A E M F T M A N E R L T N R L I Q T K Y Q R W L P * R T G Y L I V S F K L K T N G G Y L D D R Q Hpy188I | AsuI* | AvaII | |BslFI | |BmgT120I FauI AciI BccI | ||NlaIV \ \ \ \ \\\ CTCGGTTTTATCATTTTCTCATTCTGTGTTGTGTGTGGTGCGGGACAATCTGATGGACCC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GAGCCAAAATAGTAAAAGAGTAAGACACAACACACACCACGCCCTGTTAGACTACCTGGG / / / / // / FauI AciI | | || BslFI | | |AvaII | | |AsuI* | | BmgT120I | | NlaIV | Hpy188I BccI L G F I I F S F C V V C G A G Q S D G P S V L S F S H S V L C V V R D N L M D P R F Y H F L I L C C V W C G T I * W T H ----:----|----:----|----:----|----:----|----:----|----:----| S P K I M K E N Q T T H P A P C D S P G A R N * * K R M R H Q T H H P V I Q H V E T K D N E * E T N H T T R S L R I S G PfoI BssKI EcoRII | ScrFI | BseBI | | NlaIV | | |BssKI | | |CviJI | | |EcoRII | | ||SecI* | | ||BstXI | | |||ScrFI | | |||BseBI | | |||| GsuI | | |||| Eco57MI | | |||| |AsuI* | | |||| |DraII | | |||| ||NlaIV | | |||| ||BmgT120I | | |||| |||BssKI Csp6I | | |||| |||CviJI |RsaI | | |||| |||EcoRII BsrI |SetI | | |||| |||HaeIII | BceAI ||AlwNI | | |||| |||| ScrFI | | MnlI BccI ||| BsrI | | |||| |||| BseBI | | TspRI \ \\\ \ \ \ \\\\ \\\\ \ \ \ \ ATCGGTTTCAGGTACTGGAGAAATCCAGGAGCCTGGGGGCCTGGCATTATCTCCAGTGAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCCAAAGTCCATGACCTCTTTAGGTCCTCGGACCCCCGGACCGTAATAGAGGTCACTA // / // / ///// / / /// / / / // || | || BsrI ||||| | | ||| | EcoRII TspRI |MnlI || | |Csp6I ||||| | | ||| | BssKI BsrI BceAI || | RsaI ||||| | | ||| BseBI || AlwNI ||||| | | ||| ScrFI |SetI ||||| | | ||DraII BccI ||||| | | ||AsuI* ||||| | | |BmgT120I ||||| | | |HaeIII ||||| | | |CviJI ||||| | | NlaIV ||||| | EcoRII ||||| | BssKI ||||| | SecI* ||||| Eco57MI ||||| BseBI ||||| ScrFI ||||| GsuI ||||CviJI |||NlaIV ||EcoRII ||BssKI ||PfoI |BstXI BseBI ScrFI I G F R Y W R N P G A W G P G I I S S D S V S G T G E I Q E P G G L A L S P V I R F Q V L E K S R S L G A W H Y L Q * * ----:----|----:----|----:----|----:----|----:----|----:----| M P K L Y Q L F G P A Q P G P M I E L S W R N * T S S F D L L R P A Q C * R W H D T E P V P S I W S G P P R A N D G T I MseI VspI |MnlI || TseI || |BisI || ||BlsI || |||CviRI* || |||| MaeII || |||| |BsaAI || |||| |SnaBI || |||| ||Csp6I AsuI* || |||| |||RsaI |BmgT120I Hpy188I || |||| |||SetI ||CviJI | BseGI || |||| |||TaiI ||HaeIII | | BbvI || |||| |||| StyI ||| BccI | | | FokI || |||| |||| SecI* \\\ \ \ \ \ \ \\ \\\\ \\\\ \ AAAAATGAGGGCCGTTTTCTCGGATGGGTTTCCTCTTTGATTAATGCTGCATTTACGTAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTACTCCCGGCAAAAGAGCCTACCCAAAGGAGAAACTAATTACGACGTAAATGCATG // / / / / / / / /// / //// |AsuI* | | BseGI | | | | ||| | |||Csp6I | | Hpy188I | | | | ||| | ||RsaI | BccI | | | | ||| | |MaeII BmgT120I | | | | ||| | SnaBI HaeIII | | | | ||| | BsaAI CviJI | | | | ||| TaiI | | | | ||| SetI | | | | ||CviRI* | | | | ||TseI | | | | |BisI | | | | BlsI | | | VspI | | | MseI | | MnlI | FokI BbvI K N E G R F L G W V S S L I N A A F T Y K M R A V F S D G F P L * L M L H L R T K * G P F S R M G F L F D * C C I Y V P ----:----|----:----|----:----|----:----|----:----|----:----| L F S P R K R P H T E E K I L A A N V Y Y F H P G N E R I P K R K S * H Q M * T F I L A T K E S P N G R Q N I S C K R V AciI | NspBII* | | MwoI | | | AciI AluI | | | |BisI CviJI | | | ||BlsI |MnlI Csp6I | | | |||TauI ||SetI |RsaI | | | |||CviJI ||| AvaI |SetI BsrI | | | |||| HphI ||| Hpy178III* \\ \ \ \ \ \\\\ \ \\\ \ CAAGGTACTGAACTGGTTGGGATAACCGCTGGTGAAGCGGCTAACCCAAGAAAAGCTCTC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCATGACTTGACCAACCCTATTGGCGACCACTTCGCCGATTGGGTTCTTTTCGAGAG / / // / / / //// / / / | | |Csp6I BsrI | MwoI |||| HphI | CviJI | | RsaI NspBII* |||CviJI | AluI | SecI* AciI ||BisI | MnlI | StyI ||AciI SetI SetI |BlsI TauI Q G T E L V G I T A G E A A N P R K A L K V L N W L G * P L V K R L T Q E K L S R Y * T G W D N R W * S G * P K K S S P ----:----|----:----|----:----|----:----|----:----|----:----| W P V S S T P I V A P S A A L G L F A R G L Y Q V P Q S L R Q H L P * G L F L E L T S F Q N P Y G S T F R S V W S F S E TfiI SecI* HinfI BmeT110I MnlI | MaeI TspDTI \ \ \ \ \ CCGAGGGCAATAAAGAAAGTTGTAGTGAGGATTCTAGTCTTTTACATTCTTTCACTATTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GGCTCCCGTTATTTCTTTCAACATCACTCCTAAGATCAGAAAATGTAAGAAAGTGATAAA //// / / / / |||SecI* MnlI | MaeI TspDTI ||AvaI HinfI |BmeT110I TfiI Hpy178III* P R A I K K V V V R I L V F Y I L S L F R G Q * R K L * * G F * S F T F F H Y F E G N K E S C S E D S S L L H S F T I F ----:----|----:----|----:----|----:----|----:----|----:----| G L A I F F T T T L I R T K * M R E S N G S P L L S L Q L S S E L R K C E K V I R P C Y L F N Y H P N * D K V N K * * K MaeIII AsuI* Tsp45I AvaII | Tsp4CI* |BmgT120I | |BtgZI CviJI ||MmeI | || MboII BslFI HaeIII ||NlaIV BsiYI* | || TspDTI \ \ \\\ \ \ \\ \ TTCATTGGCCTTTTGGTCCCATATAATGACCCAAAGTTGGATAGTGACGGTATATTTGTC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAACCGGAAAACCAGGGTATATTACTGGGTTTCAACCTATCACTGCCATATAAACAG / / / // / / // / | HaeIII | |AvaII BsiYI* | || BtgZI | CviJI | |AsuI* | |MboII BslFI | BmgT120I | TspDTI | NlaIV Tsp4CI* MmeI Tsp45I MaeIII F I G L L V P Y N D P K L D S D G I F V S L A F W S H I M T Q S W I V T V Y L S H W P F G P I * * P K V G * * R Y I C L ----:----|----:----|----:----|----:----|----:----|----:----| K M P R K T G Y L S G F N S L S P I N T K * Q G K P G M Y H G L T P Y H R Y I Q E N A K Q D W I I V W L Q I T V T Y K D ApoI BsmAI TspEI | Ksp632I* EcoRI \ \ \ TCTTCATCGCCCTTTATGATAAGCATTGAGAATTCAGGCACAAAAGTTCTCCCAGATATA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGTAGCGGGAAATACTATTCGTAACTCTTAAGTCCGTGTTTTCAAGAGGGTCTATAT / / / | Ksp632I* EcoRI BsmAI TspEI ApoI S S S P F M I S I E N S G T K V L P D I L H R P L * * A L R I Q A Q K F S Q I Y F I A L Y D K H * E F R H K S S P R Y I ----:----|----:----|----:----|----:----|----:----|----:----| E E D G K I I L M S F E P V F T R G S I R K M A R * S L C Q S N L C L L E G L Y R * R G K H Y A N L I * A C F N E W I Y Bce83I* | TatI | Bsp1407I AciI | |Csp6I FnuDII* | |Hpy166II | McrI* MaeIII | || CviJI MseI | |HphI BspMI AciI | SetI | ||RsaI |SmlI \ \ \\ \ \ \ \ \ \\\ \\ TTTAACGCGGTCGTGCTAATCACCATTCTTTCCGCAGGTAACTCTAATGTGTACATTGGC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTGCGCCAGCACGATTAGTGGTAAGAAAGGCGTCCATTGAGATTACACATGTAACCG / / / / / // // //// / | | | HphI | |SetI |Bce83I* |||| CviJI | | McrI* | AciI MaeIII |||Bsp1407I | | AciI BspMI |||TatI | FnuDII* ||Csp6I MseI |RsaI Hpy166II F N A V V L I T I L S A G N S N V Y I G L T R S C * S P F F P Q V T L M C T L A * R G R A N H H S F R R * L * C V H W L ----:----|----:----|----:----|----:----|----:----|----:----| N L A T T S I V M R E A P L E L T Y M P I * R P R A L * W E K R L Y S * H T C Q K V R D H * D G N K G C T V R I H V N A AluI CviJI | SetI | | KasI | | HgiCI* | | |AcyI | | |NarI | | |Hin6I | | ||GlaI PpiI Hpy178III* | | ||DinI MaeII | TatI | | ||NlaIV |MaeIII | |Csp6I | | |||HhaI |Tsp45I | ||RsaI | | ||||StyI ||MnlI | ||ScaI | | ||||SecI* |||SetI | ||| Tsp4CI* | | ||||HaeII SetI |||TaiI \ \\\ \ \ \ \\\\\ \ \\\\ TCAAGAGTACTGTATAGTCTGTCTAAAAATAGCTTGGCGCCAAGGTTCTTGTCTAACGTG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTCTCATGACATATCAGACAGATTTTTATCGAACCGCGGTTCCAAGAACAGATTGCAC / /// / / ///// / / / / // | ||Tsp4CI* | | ||||| | SecI* | | |MaeII | ||TatI | | ||||| | StyI | | MnlI | |Csp6I | | ||||| SetI | TaiI | ScaI | | ||||HgiCI* | SetI | RsaI | | ||||KasI PpiI Hpy178III* | | |||Hin6I SmlI | | |||NarI | | |||AcyI | | ||NlaIV | | ||DinI | | ||GlaI | | |HhaI | | HaeII | CviJI | AluI SetI S R V L Y S L S K N S L A P R F L S N V Q E Y C I V C L K I A W R Q G S C L T * K S T V * S V * K * L G A K V L V * R D ----:----|----:----|----:----|----:----|----:----|----:----| E L T S Y L R D L F L K A G L N K D L T S L L V T Y D T * F Y S P A L T R T * R * S Y Q I T Q R F I A Q R W P E Q R V H FokI | PpiI CviJI SetI | | TspGWI BseGI Hpy188I | MnlI \ \ \ \ \ \ \ \ ACCAGAGGTGGTGTTCCATACTTTTCTGTTCTATCTACATCCGTGTTCGGATTTTTGGCT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTCTCCACCACAAGGTATGAAAAGACAAGATAGATGTAGGCACAAGCCTAAAAACCGA / / / / / / // | SetI PpiI TspGWI BseGI Hpy188I |MnlI Tsp45I FokI CviJI MaeIII T R G G V P Y F S V L S T S V F G F L A P E V V F H T F L F Y L H P C S D F W L Q R W C S I L F C S I Y I R V R I F G F ----:----|----:----|----:----|----:----|----:----|----:----| V L P P T G Y K E T R D V D T N P N K A S W L H H E M S K Q E I * M R T R I K P G S T T N W V K R N * R C G H E S K Q S SetI | SfeI* | | CviRI* | | | PstI | | | Cac8I | | | | TseI | | | | |BisI | | | | ||BlsI | | | | |||AciI | | | | |||NspBII* | | | | ||||BisI | | | | |||||BlsI | | | | ||||||TauI | | | | ||||||| TsoI | | | | ||||||| |StuI | | | | ||||||| |CviJI | | | | ||||||| |HaeIII | | | | ||||||| ||BbvI | | | | ||||||| ||| MseI | | | | ||||||| ||| | BsiYI* DdeI | | | | ||||||| ||| | | BsrI BsrI \ \ \ \ \ \\\\\\\ \\\ \ \ \ \ TTCTTAGAGGTTTCTGCAGGCAGCGGCAAGGCCTTTAACTGGTTATTGAACATAACTGGT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AAGAATCTCCAAAGACGTCCGTCGCCGTTCCGGAAATTGACCAATAACTTGTATTGACCA // / / / ///// / / /// / / |SetI | | | ||||| | | ||| BsrI BsrI DdeI | | | ||||| | | ||MseI | | | ||||| | | |BbvI | | | ||||| | | BsiYI* | | | ||||| | HaeIII | | | ||||| | CviJI | | | ||||| | StuI | | | ||||| TsoI | | | ||||BisI | | | ||||AciI | | | |||BlsI | | | ||NspBII* | | | ||TseI | | | ||TauI | | | |BisI | | | BlsI | | SfeI* | | Cac8I | CviRI* PstI F L E V S A G S G K A F N W L L N I T G S * R F L Q A A A R P L T G Y * T * L V L R G F C R Q R Q G L * L V I E H N W C ----:----|----:----|----:----|----:----|----:----|----:----| K K S T E A P L P L A K L Q N N F M V P K R L P K Q L C R C P R * S T I S C L Q E * L N R C A A A L G K V P * Q V Y S T BssKI FatI CfrI EcoRII |CviAII | CviJI | ScrFI || CviRI* | Cfr10I | BseBI || NlaIII | HaeIII | | TspDTI TspGWI || | Cac8I | |HpaII | | |CviJI | TspDTI || | | CviJI \ \\ \ \ \\ \ \ \\ \ \ \ GTGGCCGGTTTCTTTGCCTGGCTTTTGATTTCATTTTCTCATATCCGTTTCATGCAAGCC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CACCGGCCAAAGAAACGGACCGAAAACTAAAGTAAAAGAGTATAGGCAAAGTACGTTCGG / /// // / / / / // / / | ||Cfr10I || EcoRII | TspDTI | || | CviJI | |HpaII || BssKI TspGWI | || Cac8I | CfrI || CviJI | |CviRI* HaeIII |BseBI | |FatI CviJI |ScrFI | CviAII TspDTI NlaIII V A G F F A W L L I S F S H I R F M Q A W P V S L P G F * F H F L I S V S C K P G R F L C L A F D F I F S Y P F H A S H ----:----|----:----|----:----|----:----|----:----|----:----| T A P K K A Q S K I E N E * I R K M C A H P R N R Q R A K S K M K E Y G N * A L H G T E K G P K Q N * K R M D T E H L G SetI |FokI ||PsiI MaeII ||| SfaNI | SetI ||| | AluI | TaiI ||| | CviJI | | MnlI TaqI BseGI ||| | | SetI \ \ \ \ \ \\\ \ \ \ ATAAGGAAACGTGGTATATCGAGGGATGACTTACCTTATAAAGCTCAAATGATGCCTTTT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TATTCCTTTGCACCATATAGCTCCCTACTGAATGGAATATTTCGAGTTTACTACGGAAAA / / / / / / / / / / | | MnlI TaqI | SetI | | | SfaNI | MaeII BseGI | | CviJI TaiI | | AluI SetI | FokI | SetI PsiI I R K R G I S R D D L P Y K A Q M M P F * G N V V Y R G M T Y L I K L K * C L F K E T W Y I E G * L T L * S S N D A F F ----:----|----:----|----:----|----:----|----:----|----:----| M L F R P I D L S S K G * L A * I I G K W L S V H Y I S P H S V K Y L E F S A K Y P F T T Y R P I V * R I F S L H H R K TspEI | BinI* | | MboI | | Hpy188I | | | DpnI | | | |BssKI BtgZI | | | |EcoRII |MwoI | | | |BstKTI |BstAPI | | | ||HphI || TspDTI | | | ||SecI* || |CviRI* | | | |||ScrFI || || EcoT22I | | | |||BseBI || || | SfaNI | | | |||| CviJI AciI \\ \\ \ \ \ \ \ \\\\ \ \ TTGGCATATTATGCATCTTTTTTCATCGCTCTAATTGTTCTGATCCAGGGCTTCACCGCT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGTATAATACGTAGAAAAAAGTAGCGAGATTAACAAGACTAGGTCCCGAAGTGGCGA / // / / // / //// / // / | || CviRI* SfaNI || | |||| | |CviJI AciI | || BtgZI || | |||| | EcoRII | |EcoT22I || | |||| | BssKI | TspDTI || | |||| | SecI* BstAPI || | |||| BseBI MwoI || | |||| ScrFI || | |||MboI || | ||HphI || | |DpnI || | BstKTI || Hpy188I |BinI* TspEI L A Y Y A S F F I A L I V L I Q G F T A W H I M H L F S S L * L F * S R A S P L G I L C I F F H R S N C S D P G L H R F ----:----|----:----|----:----|----:----|----:----|----:----| K A Y * A D K K M A R I T R I W P K V A K P M N H M K K * R E L Q E S G P S * R Q C I I C R K E D S * N N Q D L A E G S Tth111I | TseI CviJI | |BisI | SfeI* | ||BlsI TsoI SetI | |BbvI | |||CviRI* SspI BsiYI* \ \ \\ \ \\\\ \ \ TTCGCACCTACTTTTCAGCCTATAGACTTTGTCGCTGCATATATATCAATATTCCTATTT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCGTGGATGAAAAGTCGGATATCTGAAACAGCGACGTATATATAGTTATAAGGATAAA / / // / /// / // SetI CviJI || | ||CviRI* SspI |TsoI || | ||TseI BsiYI* || | |BisI || | BlsI || Tth111I |BbvI SfeI* F A P T F Q P I D F V A A Y I S I F L F S H L L F S L * T L S L H I Y Q Y S Y F R T Y F S A Y R L C R C I Y I N I P I F ----:----|----:----|----:----|----:----|----:----|----:----| K A G V K * G I S K T A A Y I D I N R N K R V * K E A * L S Q R Q M Y I L I G I E C R S K L R Y V K D S C I Y * Y E * K Hpy178III* | TseI | AluI | CviJI | |BisI | |SfeI* | ||BlsI CfrI AciI | ||SetI | BalI BisI | |||FalI | CviJI |BlsI | |||FalI | HaeIII FalI ||BbvI | |||CviRI* | | NdeI FalI MseI ||TauI | |||| PstI \ \ \ \ \ \\\ \ \\\\ \ TTGGCCATATGGTTATCATTCCAAGTTTGGTTTAAGTGCCGCTTACTCTGGAAGCTGCAG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGGTATACCAATAGTAAGGTTCAAACCAAATTCACGGCGAATGAGACCTTCGACGTC / / / / / //// / / / //// / | | NdeI FalI | |||| BbvI | | |||| SfeI* | CfrI FalI | |||AciI | | |||CviRI* HaeIII | ||BisI | | |||TseI CviJI | |BlsI | | ||BisI BalI | TauI | | |BlsI MseI | | |PstI | | CviJI | | AluI | FalI | FalI | SetI Hpy178III* L A I W L S F Q V W F K C R L L W K L Q W P Y G Y H S K F G L S A A Y S G S C R G H M V I I P S L V * V P L T L E A A G ----:----|----:----|----:----|----:----|----:----|----:----| K A M H N D N W T Q N L H R K S Q F S C K P W I T I M G L K T * T G S V R S A A Q G Y P * * E L N P K L A A * E P L Q L EcoRV | TaqI | ClaI | | EcoRV | | | TaqI | | | ClaI | | | | TfiI | | | | HinfI | | | | | Hpy188I | | | | | | AciI | | | | | | | MroNI | | | | | | | Cfr10I | | | | | | | |HpaII | | | | | | | ||NaeI | | | | | | | ||Cac8I BseRI | | | | | | | ||| MnlI | CviJI \ \ \ \ \ \ \ \\\ \ \ \ GATATCGATATCGATTCTGACCGCCGGCAAATAGAGGAGTTGGTATGGATAGAGCCAGAA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAGCTATAGCTAAGACTGGCGGCCGTTTATCTCCTCAACCATACCTATCTCGGTCTT / / / / // / /// / / | | | | || | ||Cfr10I BseRI CviJI | | | | || | ||MroNI | | | | || | |HpaII | | | | || | |MnlI | | | | || | Cac8I | | | | || | NaeI | | | | || AciI | | | | |Hpy188I | | | | HinfI | | | | TfiI | | | ClaI | | | TaqI | | EcoRV | ClaI | TaqI EcoRV D I D I D S D R R Q I E E L V W I E P E I S I S I L T A G K * R S W Y G * S Q N Y R Y R F * P P A N R G V G M D R A R M ----:----|----:----|----:----|----:----|----:----|----:----| S I S I S E S R R C I S S N T H I S G S P Y R Y R N Q G G A F L P T P I S L A L I D I D I R V A P L Y L L Q Y P Y L W F SetI TspDTI BseGI \ \ \ TGTAAAACAAGGTGGCAACGAGTTTGGGATGTCCTTTCATAA 1690 1700 1710 1720 ----:----|----:----|----:----|----:----|-- ACATTTTGTTCCACCGTTGCTCAAACCCTACAGGAAAGTATT / / / SetI TspDTI BseGI C K T R W Q R V W D V L S * V K Q G G N E F G M S F H X * N K V A T S L G C P F I X ----:----|----:----|----:----|----:----|-- H L V L H C R T Q S T R E Y I Y F L T A V L K P H G K M T F C P P L S N P I D K * L # Enzymes that cut Frequency Isoschizomers AciI 14 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AluI 6 AluBI AlwNI 1 CaiI ApoI 2 AcsI,XapI AsuI* 7 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 6 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 5 Bce83I* 1 BpuEI BceAI 1 BcgI 1 BinI* 2 AlwI,BspPI,AclWI BisI 12 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 12 BmeT110I 1 BmgT120I 7 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 5 Bst2UI,BstNI,BstOI,MvaI BseGI 7 BstF5I,BtsCI BseRI 3 BseYI 1 BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 4 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrI 8 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BstAPI 1 BstKTI 3 BstXI 1 BtgZI 3 BtsI 1 Cac8I 5 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 3 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 7 CviQI,RsaNI CviAII 2 CviJI 26 CviKI-1 CviRI* 6 HpyCH4V DdeI 2 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 3 MalI DraII 1 EcoO109I EciI 1 Ecl136II 1 EcoICRI Eco47III 1 Aor51HI,AfeI Eco57MI 1 EcoRI 1 EcoRII 5 AjnI,Psp6I,PspGI EcoRV 3 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 2 FatI 2 FauI 1 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GlaI 2 GsaI 1 GsuI 1 BpmI HaeII 2 BstH2I HaeIII 9 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 4 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 3 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HinfI 2 HpaI 1 KspAI HpaII 4 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 5 KasI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 7 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 McrI* 1 BsiEI,BstMCI,Bsh1285I MmeI 1 MnlI 15 MroNI 2 NgoMIV MseI 6 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NaeI 2 PdiI NarI 1 Mly113I NdeI 1 FauNDI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 8 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 3 MspA1I NspI 1 BstNSI,XceI PfoI 1 PpiI 1 PsiI 1 AanI PstI 2 RsaI 7 AfaI SacI 1 Psp124BI,SstI ScaI 2 BmcAI,AssI,ZrmI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 6 BseDI,BssECI,BsaJI SetI 23 SfaNI 3 LweI SfeI* 3 BstSFI,SfcI,BfmI SmlI 1 SmoI SnaBI 1 Eco105I,BstSNI SspI 2 StuI 1 Eco147I,PceI,SseBI,AatI StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 4 TatI 4 TauI 6 TfiI 2 PfeI TseI 6 ApeKI TsoI 2 Tsp45I 3 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 11 TspEI 5 TasI,Tsp509I,Sse9I TspGWI 6 TspRI 4 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AflII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvrII BaeI BamHI BarI BbvCI BciVI BclI BdaI BetI* BfiI BglI BglII BmtI BplI BseMII BsePI BseSI BsgI BsiI* BsmI Bsp120I BspCNI BspHI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstEII BstZ17I BtrI Cfr9I CspCI DraIII DrdI DsaI* Eam1105I Eco31I Eco57I EcoNI EcoP15I Esp3I EspI* FseI FspAI HgaI HindIII Hpy99I KpnI MauBI MfeI MluI MlyI MstI* NcoI NheI NotI NruI OliI PacI PasI PflMI PleI PmaCI PmeI PpuMI PshAI PspOMI PspXI PsrI PvuI PvuII RsrII SacII SalI SanDI SapI SauI* SchI SexAI SfiI SgfI SgrAI SgrDI SmaI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TaqII TspMI TstI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769