Restriction Map of BSC4/YNL269W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

BSC4/YNL269W on chromosome XIV from coordinates 137699 to 138094.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.18335

MboII CviRI* Ksp632I* MaeIII TspGWI | MwoI \ \ \ \ \ ATGTCTATTGTGCTACGGAAGAGTAACAAAAAAAACAAAAACTGCATAACAAGCAAGTTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGATAACACGATGCCTTCTCATTGTTTTTTTTGTTTTTGACGTATTGTTCGTTCAAA / /// / / Ksp632I* ||MboII | MwoI |TspGWI CviRI* MaeIII M S I V L R K S N K K N K N C I T S K F C L L C Y G R V T K K T K T A * Q A S F V Y C A T E E * Q K K Q K L H N K Q V L ----:----|----:----|----:----|----:----|----:----|----:----| X D I T S R F L L L F F L F Q M V L L N X T * Q A V S S Y C F F C F S C L L C T H R N H * P L T V F F V F V A Y C A L K Hpy188I | AluI | CviJI | Ecl136II | | SetI | | SduI | | SacI | | HgiAI* PsiI | | HgiJII* | ApoI BetI* | | | BsrDI | TspEI |HpaII | | | | MwoI \ \ \\ \ \ \ \ \ TATACAATACACATTATAAAAATTTCTACTCCGGTGTTCCGAGCTCCCATTGCCATTGGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ATATGTTATGTGTAATATTTTTAAAGATGAGGCCACAAGGCTCGAGGGTAACGGTAACCT / / // / / / // PsiI TspEI || | | | |MwoI ApoI || | | | BsrDI || | | Ecl136II || | | CviJI || | | AluI || | HgiJII* || | HgiAI* || | SacI || | SduI || | SetI || Hpy188I |BetI* HpaII Y T I H I I K I S T P V F R A P I A I G I Q Y T L * K F L L R C S E L P L P L E Y N T H Y K N F Y S G V P S S H C H W R ----:----|----:----|----:----|----:----|----:----|----:----| * V I C M I F I E V G T N R A G M A M P K Y L V C * L F K * E P T G L E W Q W Q I C Y V N Y F N R S R H E S S G N G N S TseI AluI CviJI Hpy178III* |BisI | FatI CviJI ||BlsI | |CviAII | BbvI ||SetI | || MaeIII | | BsiYI* ||| SfeI* SetI |TsoI || NlaIII \ \ \ \\\ \ \ \\ \\ \ GAAAGCCCTTATGTGGAGTGGAGCTGCCTACAGGTTGTTTTCAGGAAAGACATGGTTACA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCGGGAATACACCTCACCTCGACGGATGTCCAACAAAAGTCCTTTCTGTACCAATGT / / / / //// // / / / // / | | BbvI | |||TseI |SfeI* | | | |FatI MaeIII | BsiYI* | ||BisI SetI | | | CviAII CviJI | |BlsI | | NlaIII | CviJI | Hpy178III* | AluI TsoI SetI E S P Y V E W S C L Q V V F R K D M V T K A L M W S G A A Y R L F S G K T W L Q K P L C G V E L P T G C F Q E R H G Y K ----:----|----:----|----:----|----:----|----:----|----:----| S L G * T S H L Q R C T T K L F S M T V L F G K H P T S S G V P Q K * S L C P * F A R I H L P A A * L N N E P F V H N C CviJI | MseI \ \ AAAAAGACGACATTCGCCCAACTTATCACTCGCTTGAACCACTTTTTATGCCAAGCCCTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTCTGCTGTAAGCGGGTTGAATAGTGAGCGAACTTGGTGAAAAATACGGTTCGGGAA / CviJI K K T T F A Q L I T R L N H F L C Q A L K R R H S P N L S L A * T T F Y A K P L K D D I R P T Y H S L E P L F M P S P * ----:----|----:----|----:----|----:----|----:----|----:----| F F V V N A W S I V R K F W K K H W A R L F S S M R G V * * E S S G S K I G L G F L R C E G L K D S A Q V V K * A L G K MlyI PleI | AciI | BisI Tsp4CI* Hin6I | |BlsI | AciI |GlaI | ||TauI | BisI ||HhaI | ||FnuDII* | |BlsI |||HaeII | ||| HinfI | ||TauI |||BceAI \ \\\ \ \ \\\ \\\\ AAACGCCGCGACTCAAAAACATACATACTGTGCCGCACGGCAGTTTTTGGCGCTATGACA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGCGGCGCTGAGTTTTTGTATGTATGACACGGCGTGCCGTCAAAAACCGCGATACTGT / ///// / / //// //// / | ||||| HinfI | |||AciI |||| BceAI | ||||FnuDII* | ||BisI |||Hin6I | ||||AciI | |BlsI ||GlaI | |||BisI | TauI |HhaI | ||BlsI Tsp4CI* HaeII | |TauI | |PleI | MlyI MseI K R R D S K T Y I L C R T A V F G A M T N A A T Q K H T Y C A A R Q F L A L * H T P R L K N I H T V P H G S F W R Y D T ----:----|----:----|----:----|----:----|----:----|----:----| L R R S E F V Y M S H R V A T K P A I V * V G R S L F M C V T G C P L K Q R * S F A A V * F C V Y Q A A R C N K A S H C FatI |CviAII || CviRI* || NlaIII || | BssKI || | SecI* || | EcoRII || | | ScrFI MseI TspEI || | | BseBI \ \ \\ \ \ \ CCCTTTTCCCCAAGAAAATCGCATATTAACAACAAATTACCCATGCAACCCAGGAAAAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGGAAAAGGGGTTCTTTTAGCGTATAATTGTTGTTTAATGGGTACGTTGGGTCCTTTTTT / / / // /// MseI | | |CviRI* ||EcoRII | | |FatI ||BssKI | | CviAII |SecI* | NlaIII BseBI TspEI ScrFI P F S P R K S H I N N K L P M Q P R K K P F P Q E N R I L T T N Y P C N P G K K L F P K K I A Y * Q Q I T H A T Q E K K ----:----|----:----|----:----|----:----|----:----|----:----| G K E G L F D C I L L L N G M C G L F F V R K G L F I A Y * C C I V W A V W S F G K G W S F R M N V V F * G H L G P F F MaeII |BsaAI |SnaBI ||TspDTI |||SetI |||TaiI |||| Hin6I |||| |GlaI |||| ||HhaI \\\\ \\\ AAAATAGTCATTATATACGTAGTGCGCTTTCATTGA 370 380 390 ----:----|----:----|----:----|----:- TTTTATCAGTAATATATGCATCACGCGAAAGTAACT //// /// |||| ||Hin6I |||| |GlaI |||| HhaI |||MaeII ||SnaBI ||BsaAI |TspDTI TaiI SetI K I V I I Y V V R F H * K * S L Y T * C A F I X N S H Y I R S A L S L X ----:----|----:----|----:----|----:- F I T M I Y T T R K * Q F F L * * I R L A S E N F Y D N Y V Y H A K M S # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AluI 2 AluBI ApoI 1 AcsI,XapI BbvI 1 BseXI,BstV1I,Lsp1109I BceAI 1 BetI* 1 BsaWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BsaAI 1 BstBAI,Ppu21I BseBI 1 Bst2UI,BstNI,BstOI,MvaI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsrDI 1 BseMI,Bse3DI BssKI 1 BstSCI,StyD4I CviAII 2 CviJI 4 CviKI-1 CviRI* 2 HpyCH4V Ecl136II 1 EcoICRI EcoRII 1 AjnI,Psp6I,PspGI FatI 2 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII GlaI 2 HaeII 1 BstH2I HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin6I 2 HinP1I,HspAI HinfI 1 HpaII 1 HapII,BsiSI,MspI Hpy178III* 1 Hpy188III Hpy188I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeII 1 HpyCH4IV MaeIII 2 MboII 1 MlyI 1 SchI MseI 2 Tru1I,Tru9I MwoI 2 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI PleI 1 PpsI PsiI 1 AanI SacI 1 Psp124BI,SstI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 4 SfeI* 1 BstSFI,SfcI,BfmI SnaBI 1 Eco105I,BstSNI TaiI 1 TauI 2 TseI 1 ApeKI TsoI 1 Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 2 TasI,Tsp509I,Sse9I TspGWI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI Bce83I* BcgI BciVI BclI BdaI BfiI BglI BglII BinI* BmeT110I BmgT120I BmtI BplI Bpu10I BsaBI BsaXI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrI BssNAI Bst1107I BstAPI BstEII BstF5I BstKTI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviQI DdeI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Eco31I Eco47III Eco57I Eco57MI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FokI FseI FspAI GsaI GsuI HaeIII HgaI HgiCI* Hin4I Hin4II* HindII HindIII HpaI HphI Hpy166II Hpy8I Hpy99I KasI KpnI MaeI MauBI MboI McrI* MfeI MluI MmeI MnlI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacII SalI SanDI SapI SauI* ScaI SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqI TaqII TatI TfiI Tsp45I TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769