Restriction Map of LYP1/YNL268W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

LYP1/YNL268W on chromosome XIV from coordinates 138550 to 140385.


MaeII SetI | SetI PflMI | MaeIII | TaiI BsiYI* BslFI \ \ \ \ \ \ ATGGGCAGGTTTAGTAACATAATAACGTCCAATAAATGGGACGAGAAACAAAACAACATT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCGTCCAAATCATTGTATTATTGCAGGTTATTTACCCTGCTCTTTGTTTTGTTGTAA / / / / / / SetI | | | BsiYI* BslFI | | | PflMI | | MaeII | TaiI | SetI MaeIII M G R F S N I I T S N K W D E K Q N N I W A G L V T * * R P I N G T R N K T T L G Q V * * H N N V Q * M G R E T K Q H W ----:----|----:----|----:----|----:----|----:----|----:----| X P L N L L M I V D L L H S S F C F L M X P C T * Y C L L T W Y I P R S V F C C H A P K T V Y Y R G I F P V L F L V V N MwoI | FatI | |CviAII | ||Cac8I BbvII* | ||| SphI | MboII | ||| NspI | | BccI | ||| CviRI* | | FatI BinI* | ||| NlaIII | | |CviAII | MboI | ||| | TspEI | | || NlaIII | XhoII \ \\\ \ \ \ \ \\ \ \ \ GGCGAACAGAGCATGCAGGAATTACCAGAAGACCAGATAGAACATGAGATGGAAGCAATA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTTGTCTCGTACGTCCTTAATGGTCTTCTGGTCTATCTTGTACTCTACCTTCGTTAT / / /// / / // // / MwoI | ||CviRI* TspEI | || |FatI BinI* | ||FatI | || CviAII | |CviAII | |BccI | Cac8I | NlaIII NlaIII BbvII* NspI MboII SphI G E Q S M Q E L P E D Q I E H E M E A I A N R A C R N Y Q K T R * N M R W K Q * R T E H A G I T R R P D R T * D G S N R ----:----|----:----|----:----|----:----|----:----|----:----| P S C L M C S N G S S W I S C S I S A I Q R V S C A P I V L L G S L V H S P L L A F L A H L F * W F V L Y F M L H F C Y TatI Tsp4CI* DpnI |Csp6I |BstKTI ||RsaI \\ \\\ GATCCAAGTAATAAGACGACCCCATACTCTATTGATGAGAAACAGTACAACACAAAAAAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGGTTCATTATTCTGCTGGGGTATGAGATAACTACTCTTTGTCATGTTGTGTTTTTTC // / / /// || XhoII | ||TatI || MboI | |Csp6I |DpnI | RsaI BstKTI Tsp4CI* D P S N K T T P Y S I D E K Q Y N T K K I Q V I R R P H T L L M R N S T T Q K R S K * * D D P I L Y * * E T V Q H K K E ----:----|----:----|----:----|----:----|----:----|----:----| S G L L L V V G Y E I S S F C Y L V F F L D L Y Y S S G M S * Q H S V T C C L F I W T I L R G W V R N I L F L V V C F L FatI |CviAII || NlaIII || | BsrDI || | | CviRI* || | | | SetI || | | | | Hin6I || | | | | |GlaI MseI || | | | | ||HhaI ApoI |HpaI || | | | | |||MfeI TspEI |HindII || | | | | |||TspEI | TaqI TspEI |Hpy166II \\ \ \ \ \ \\\\ \ \ \ \\ AAGCATGGGTCATTGCAAGGTGGCGCAATTGCTGATGTAAATTCGATAACTAATTCGTTA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGTACCCAGTAACGTTCCACCGCGTTAACGACTACATTTAAGCTATTGATTAAGCAAT / /// / / /// / / / / // | ||BsrDI | SetI ||| TspEI | TaqI | |MseI | |FatI CviRI* ||| MfeI TspEI | Hpy166II | CviAII ||Hin6I ApoI | HindII NlaIII |GlaI | HpaI HhaI TspEI K H G S L Q G G A I A D V N S I T N S L S M G H C K V A Q L L M * I R * L I R * A W V I A R W R N C * C K F D N * F V N ----:----|----:----|----:----|----:----|----:----|----:----| F C P D N C P P A I A S T F E I V L E N S A H T M A L H R L Q Q H L N S L * N T L M P * Q L T A C N S I Y I R Y S I R * FatI BspHI FokI BsmAI CviJI |CviAII MnlI | MnlI |Hpy178III* | MseI | |MboII CviRI* || NlaIII | | TspDTI BseGI | ||TspDTI \ \\ \ \ \ \ \ \ \\\ ACAAGATTGCAAGTTGTCTCTCATGAAACAGATATTAACGAGGATGAAGAAGAAGCCCAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTCTAACGTTCAACAGAGAGTACTTTGTCTATAATTGCTCCTACTTCTTCTTCGGGTG / / // / // / /// // CviRI* | |BsmAI | |MseI BseGI ||| |BsiYI* | |BspHI | TspDTI ||| |MboII | |FatI MnlI ||| FokI | Hpy178III* ||TspDTI | CviAII ||MboII NlaIII |MnlI CviJI T R L Q V V S H E T D I N E D E E E A H Q D C K L S L M K Q I L T R M K K K P T K I A S C L S * N R Y * R G * R R S P L ----:----|----:----|----:----|----:----|----:----|----:----| V L N C T T E * S V S I L S S S S S A W L L I A L Q R E H F L Y * R P H L L L G C S Q L N D R M F C I N V L I F F F G V FalI FalI | AflIII | |Ksp632I* | ||MaeII | |||PmaCI | |||BsaAI FalI MboII | |||| SetI CviJI FalI CviRI* | BsiYI* | |||| TaiI | MboII | MslI | MaeI \ \ \ \\\\ \ \ \ \ \ \ \ TATGAGGATAAACACGTGAAGAGAGCCTTGAAGCAAAGACACATTGGTATGATTGCACTA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTCCTATTTGTGCACTTCTCTCGGAACTTCGTTTCTGTGTAACCATACTAACGTGAT / / // / / / / / /// FalI | |Ksp632I* | MboII FalI MslI | ||MaeI FalI | |AflIII CviJI FalI | |SetI | |MaeII | DraIII | BsaAI CviRI* | PmaCI TaiI SetI Y E D K H V K R A L K Q R H I G M I A L M R I N T * R E P * S K D T L V * L H * * G * T R E E S L E A K T H W Y D C T R ----:----|----:----|----:----|----:----|----:----|----:----| * S S L C T F L A K F C L C M P I I A S S H P Y V R S S L R S A F V C Q Y S Q V I L I F V H L S G Q L L S V N T H N C * BslFI | Cac8I DraIII | |AsuI* | SetI | ||CviJI | | Csp6I Csp6I | ||HaeIII | | |RsaI |RsaI BsrI SmlI | ||BmgT120I \ \ \\ \\ \ \ \ \\\ GGTGGTACAATCGGTACTGGTCTTTTCGTTGGTATCTCCACTCCCTTGAGTAATGCTGGC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCATGTTAGCCATGACCAGAAAAGCAACCATAGAGGTGAGGGAACTCATTACGACCG // // / / //// |Csp6I || BsrI SmlI |||BmgT120I RsaI |Csp6I ||HaeIII RsaI ||CviJI |BslFI Cac8I G G T I G T G L F V G I S T P L S N A G V V Q S V L V F S L V S P L P * V M L A W Y N R Y W S F R W Y L H S L E * C W P ----:----|----:----|----:----|----:----|----:----|----:----| P P V I P V P R K T P I E V G K L L A P L H Y L R Y Q D K R Q Y R W E R S Y H Q T T C D T S T K E N T D G S G Q T I S A Bce83I* | AsuI* MslI | AvaII |FatI AccI | DraII ||CviAII |Hpy166II | PpuMI ||| NlaIII || BfiI | SanDI ||| |HgiCI* || MaeIII | |NlaIV ||| || NlaIV || | BsrI | |BmgT120I ||| || |SduI || | | MaeIII | ||NlaIV TspDTI ||| || |BseSI || | | Tsp45I \ \\\ \ \\\ \\ \\ \\ \ \ \ CCTGTGGGGTCCCTGATTGCTTACATTTTCATGGGCACCATTGTCTACTTCGTTACCCAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GGACACCCCAGGGACTAACGAATGTAAAAGTACCCGTGGTAACAGATGAAGCAATGGGTC / / /// / // // / / // / // / | | ||| TspDTI || || | HgiCI* || BfiI || BstXI | | ||SanDI || || NlaIV |AccI |MaeIII | | ||PpuMI || |BseSI Hpy166II BsrI | | ||DraII || |FatI | | ||AvaII || |SduI | | ||AsuI* || CviAII | | |BmgT120I |NlaIII | | |NlaIV MslI | | NlaIV | Bce83I* AsuI* P V G S L I A Y I F M G T I V Y F V T Q L W G P * L L T F S W A P L S T S L P S C G V P D C L H F H G H H C L L R Y P V ----:----|----:----|----:----|----:----|----:----|----:----| G T P D R I A * M K M P V M T * K T V W G Q P T G S Q K C K * P C W Q R S R * G R H P G Q N S V N E H A G N D V E N G L Tsp4CI* |FalI |FalI CviJI || TspRI TsoI | HphI || |Ksp632I* BstXI | MaeII || ||MnlI | BccI | | SetI MaeIII || ||| TaqI | |DraIII | | TaiI Tsp45I || ||| AsuII \ \\ \ \ \ \ \\ \\\ \ TCACTTGGTGAGATGGCTACGTTTATCCCCGTGACATCATCTATCACTGTCTTTTCGAAG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGAACCACTCTACCGATGCAAATAGGGGCACTGTAGTAGATAGTGACAGAAAAGCTTC / / / / / / / / / / / / / / | | BccI | | MaeII Tsp45I | | | | | | SetI | Tsp45I | HphI MaeIII | | | | | AsuII | MaeIII | TaiI | | | | | TaqI | DraIII | SetI | | | | Ksp632I* TsoI CviJI | | | MnlI | | Tsp4CI* | FalI | FalI TspRI S L G E M A T F I P V T S S I T V F S K H L V R W L R L S P * H H L S L S F R R T W * D G Y V Y P R D I I Y H C L F E E ----:----|----:----|----:----|----:----|----:----|----:----| D S P S I A V N I G T V D D I V T K E F T V Q H S P * T * G R S M M * * Q R K S * K T L H S R K D G H C * R D S D K R L CviJI | FatI | AflIII | BspLU11I* | |CviAII SetI | || TatI |BsmI | || |NspI |CviRI* | || |Csp6I || BsiYI* | || |NlaIII || | AarI | || || BceAI XmnI || | FalI | || || |BsrI |HphI || | FalI | || || || MfeI || SetI MboII || | BspMI | || ||RsaI || TspEI CviJI \\ \ \ \\ \ \ \ \\ \\\ \\ \ \ AGGTTCTTATCACCTGCATTCGGTGTTTCTAACGGCTACATGTACTGGTTCAATTGGGCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TCCAAGAATAGTGGACGTAAGCCACAAAGATTGCCGATGTACATGACCAAGTTAACCCGA / / / / / / / / ///// / / / / XmnI | | | BsiYI* BspMI | | ||||| | | | CviJI HphI | | | CviRI* AarI | | ||||| | | TspEI | | | FalI | | ||||| | | MfeI | | | FalI | | ||||| | BceAI | | BsmI | | ||||| BsrI | SetI | | ||||TatI MboII | | |||Csp6I | | ||RsaI | | |BspLU11I* | | |AflIII | | |FatI | | CviAII | NlaIII | NspI CviJI R F L S P A F G V S N G Y M Y W F N W A G S Y H L H S V F L T A T C T G S I G L V L I T C I R C F * R L H V L V Q L G Y ----:----|----:----|----:----|----:----|----:----|----:----| L N K D G A N P T E L P * M Y Q N L Q A S T R I V Q M R H K * R S C T S T * N P P E * * R C E T N R V A V H V P E I P S CfrI | BalI | CviJI MnlI SetI | HaeIII BsrI \ \ \ \ \ ATTACTTATGCTGTGGAGGTTTCTGTCATTGGCCAAGTTATTGAATACTGGACAGATAAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGAATACGACACCTCCAAAGACAGTAACCGGTTCAATAACTTATGACCTGTCTATTT / / / / / MnlI SetI | CfrI BsrI HaeIII CviJI BalI I T Y A V E V S V I G Q V I E Y W T D K L L M L W R F L S L A K L L N T G Q I K Y L C C G G F C H W P S Y * I L D R * S ----:----|----:----|----:----|----:----|----:----|----:----| I V * A T S T E T M P W T I S Y Q V S L * * K H Q P P K Q * Q G L * Q I S S L Y N S I S H L N R D N A L N N F V P C I F AciI |BisI |XcmI ||BlsI |||TauI |||BssKI |||CviJI |||EcoRII |||HaeIII |||| ScrFI ApoI |||| BseBI TspEI |||| | MwoI TspEI | XmnI \\\\ \ \ \ \ \ GTTCCATTAGCGGCCTGGATTGCGATATTCTGGGTAATTATTACTTTGATGAATTTTTTC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGGTAATCGCCGGACCTAACGCTATAAGACCCATTAATAATGAAACTACTTAAAAAAG //// / / / / |||| | EcoRII TspEI TspEI |||| | BssKI XmnI |||| BseBI ApoI |||| ScrFI |||| MwoI |||HaeIII |||CviJI ||BisI ||AciI |BlsI XcmI TauI V P L A A W I A I F W V I I T L M N F F F H * R P G L R Y S G * L L L * * I F S S I S G L D C D I L G N Y Y F D E F F P ----:----|----:----|----:----|----:----|----:----|----:----| T G N A A Q I A I N Q T I I V K I F K K L E M L P R S Q S I R P L * * K S S N K N W * R G P N R Y E P Y N N S Q H I K E ApoI TspEI CviJI MseI TspDTI | TaqII HphI HaeIII | MnlI CviJI \ \ \ \ \ \ \ \ CCTGTCAAAGTTTATGGTGAATTTGAGTTCTGGGTGGCCTCTGTTAAAGTTTTAGCCATT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GGACAGTTTCAAATACCACTTAAACTCAAGACCCACCGGAGACAATTTCAAAATCGGTAA / / / / / // / TspDTI | | HphI HaeIII |MnlI CviJI | TspEI CviJI MseI | ApoI TaqII P V K V Y G E F E F W V A S V K V L A I L S K F M V N L S S G W P L L K F * P L C Q S L W * I * V L G G L C * S F S H Y ----:----|----:----|----:----|----:----|----:----|----:----| G T L T * P S N S N Q T A E T L T K A M G Q * L K H H I Q T R P P R Q * L K L W R D F N I T F K L E P H G R N F N * G N AciI BinI* | MboI | BamHI | XhoII | | DpnI | | NlaIV | | |BstKTI | | || BssKI | | || EcoRII | | || |SecI* | | || |BinI* | | || ||ScrFI | | || ||BseBI | | || ||| AsuI* | | || ||| DraII | | || ||| Bsp120I | | || ||| |AsuI* | | || ||| |DraII | | || ||| |BmgT120I | | || ||| ||CviJI | | || ||| ||NlaIV | | || ||| ||HaeIII | | || ||| ||BmgT120I | | || ||| ||| ApaI | | || ||| ||| SduI MaeIII | | || ||| ||| BseSI | TsoI | | || ||| ||| HgiJII* \ \ \ \ \\ \\\ \\\ \ ATGGGTTACTTGATATATGCTTTGATTATTGTCTGCGGTGGATCCCACCAGGGCCCTATC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCAATGAACTATATACGAAACTAATAACAGACGCCACCTAGGGTGGTCCCGGGATAG / / // // / /////// | MaeIII || || | ||||||Bsp120I TsoI || || | ||||||DraII || || | ||||||AsuI* || || | |||||BmgT120I || || | |||||DraII || || | |||||AsuI* || || | ||||BmgT120I || || | ||||HaeIII || || | ||||NlaIV || || | ||||CviJI || || | |||EcoRII || || | |||BssKI || || | |||SecI* || || | ||HgiJII* || || | ||BseSI || || | ||SduI || || | ||ApaI || || | |BseBI || || | |ScrFI || || | BinI* || || XhoII || || BamHI || || MboI || |NlaIV || |DpnI || BstKTI |AciI BinI* M G Y L I Y A L I I V C G G S H Q G P I W V T * Y M L * L L S A V D P T R A L S G L L D I C F D Y C L R W I P P G P Y R ----:----|----:----|----:----|----:----|----:----|----:----| I P * K I Y A K I I T Q P P D W W P G I * P N S S I H K S * Q R R H I G G P G * H T V Q Y I S Q N N D A T S G V L A R D PfoI BssKI EcoRII | ScrFI | BseBI | | NlaIV | | |BssKI | | |CviJI | | |EcoRII | | ||SecI* | | ||BstXI | | |||ScrFI | | |||BseBI | | |||| GsuI | | |||| Eco57MI | | |||| |AsuI* | | |||| ||NlaIV | | |||| ||BmgT120I | | |||| |||BssKI Csp6I | | |||| |||CviJI BsrI |RsaI | | |||| |||EcoRII SfaNI |SetI | | |||| |||HaeIII | BceAI ||AlwNI | | |||| |||| ScrFI | | TspRI ||| BsrI | | |||| |||| BseBI | | |Hin4II* \\\ \ \ \ \\\\ \\\\ \ \ \ \\ GGTTTCAGGTACTGGAGAAATCCAGGAGCCTGGGGGCCAGGCATCATCTCCAGTGATAAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAAGTCCATGACCTCTTTAGGTCCTCGGACCCCCGGTCCGTAGTAGAGGTCACTATTT / / // / ///// / / /// / / / // / | | || BsrI ||||| | | ||| | EcoRII TspRI || Hin4II* | | |Csp6I ||||| | | ||| | BssKI BsrI |BceAI | | RsaI ||||| | | ||| BseBI SfaNI | AlwNI ||||| | | ||| ScrFI SetI ||||| | | ||AsuI* ||||| | | |BmgT120I ||||| | | |HaeIII ||||| | | |CviJI ||||| | | NlaIV ||||| | EcoRII ||||| | BssKI ||||| | SecI* ||||| Eco57MI ||||| BseBI ||||| ScrFI ||||| GsuI ||||CviJI |||NlaIV ||EcoRII ||BssKI ||PfoI |BstXI BseBI ScrFI G F R Y W R N P G A W G P G I I S S D K V S G T G E I Q E P G G Q A S S P V I K F Q V L E K S R S L G A R H H L Q * * K ----:----|----:----|----:----|----:----|----:----|----:----| P K L Y Q L F G P A Q P G P M M E L S L R N * T S S F D L L R P A L C * R W H Y T E P V P S I W S G P P W A D D G T I F MseI VspI |MnlI || TseI || |BisI || ||BlsI CviJI || |||CviRI* HaeIII || |||| MaeII | BccI || |||| |BsaAI | | BseRI || |||| |SnaBI | | |Hpy188I || |||| ||Csp6I | | || BseGI || |||| |||RsaI | | || | BbvI || |||| |||SetI | | || | BsmAI || |||| |||TaiI | | || | Eco31I || |||| |||| StyI | | || | | FokI || |||| |||| SecI* \ \ \\ \ \ \ \\ \\\\ \\\\ \ AGTGAAGGCCGTTTTCTCGGATGGGTCTCCTCCTTGATTAATGCTGCATTTACGTACCAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTTCCGGCAAAAGAGCCTACCCAGAGGAGGAACTAATTACGACGTAAATGCATGGTT / // / / / / / / /// / //// / HaeIII || | BseGI | | | | ||| | |||| SetI CviJI || Hpy188I | | | | ||| | |||Csp6I |BseRI | | | | ||| | ||RsaI BccI | | | | ||| | |MaeII | | | | ||| | SnaBI | | | | ||| | BsaAI | | | | ||| TaiI | | | | ||| SetI | | | | ||CviRI* | | | | ||TseI | | | | |BisI | | | | BlsI | | | VspI | | | MseI | | MnlI | FokI Eco31I BsmAI BbvI S E G R F L G W V S S L I N A A F T Y Q V K A V F S D G S P P * L M L H L R T K * R P F S R M G L L L D * C C I Y V P R ----:----|----:----|----:----|----:----|----:----|----:----| L S P R K R P H T E E K I L A A N V Y W F H L G N E R I P R R R S * H Q M * T G T F A T K E S P D G G Q N I S C K R V L HphI | BsrI | | MboI | | | DpnI | | | |BstKTI | | | || AciI | | | || | BinI* | | | || | NspBII* | | | || | | MwoI | | | || | | | AciI | | | || | | | |BisI | | | || | | | ||BlsI Csp6I | | | || | | | |||TauI |RsaI | | | || | | | |||CviJI |SetI | | | || | | | |||| HphI Tsp4CI* \\ \ \ \ \\ \ \ \ \\\\ \ \ GGTACTGAACTGGTTGGGATCACCGCTGGTGAAGCGGCTAACCCAAGAAAGACCGTTCCA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGACTTGACCAACCCTAGTGGCGACCACTTCGCCGATTGGGTTCTTTCTGGCAAGGT / // // // / // / //// / / | |Csp6I |BsrI || | || MwoI |||| HphI Tsp4CI* | RsaI HphI || | |BinI* |||CviJI SecI* || | NspBII* ||BisI StyI || | AciI ||AciI || MboI |BlsI |DpnI TauI BstKTI G T E L V G I T A G E A A N P R K T V P V L N W L G S P L V K R L T Q E R P F Q Y * T G W D H R W * S G * P K K D R S K ----:----|----:----|----:----|----:----|----:----|----:----| P V S S T P I V A P S A A L G L F V T G L Y Q V P Q S * R Q H L P * G L F S R E T S F Q N P D G S T F R S V W S L G N W TfiI AluI HinfI CviJI | Csp6I | SetI | |RsaI \ \ \ \\ AGAGCTATCAATAAAGTCGTCTTTAGAATCGTACTATTCTATATTATGTCTTTGTTCTTT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCGATAGTTATTTCAGCAGAAATCTTAGCATGATAAGATATAATACAGAAACAAGAAA / / / // | CviJI | |Csp6I | AluI | RsaI SetI HinfI TfiI R A I N K V V F R I V L F Y I M S L F F E L S I K S S L E S Y Y S I L C L C S L S Y Q * S R L * N R T I L Y Y V F V L Y ----:----|----:----|----:----|----:----|----:----|----:----| L A I L L T T K L I T S N * I I D K N K L L * * Y L R R * F R V I R Y * T K T R S S D I F D D K S D Y * E I N H R Q E K AccI |Hpy166II || BsrI || NlaIV || | EcoP15I MwoI || | | TfiI |HphI || | | HinfI MaeI MwoI || CviRI* \\ \ \ \ \ \ \\ \ ATTGGTCTACTGGTTCCATACAACGATTCCCGTTTATCTGCTAGTTCTGCTGTTATTGCA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TAACCAGATGACCAAGGTATGTTGCTAAGGGCAAATAGACGATCAAGACGACAATAACGT // / / / / / / / / || | NlaIV | HinfI MwoI | | CviRI* || BsrI | TfiI MaeI | HphI |AccI EcoP15I MwoI Hpy166II I G L L V P Y N D S R L S A S S A V I A L V Y W F H T T I P V Y L L V L L L L H W S T G S I Q R F P F I C * F C C Y C I ----:----|----:----|----:----|----:----|----:----|----:----| I P R S T G Y L S E R K D A L E A T I A * Q D V P E M C R N G N I Q * N Q Q * Q N T * Q N W V V I G T * R S T R S N N C BceAI Csp6I Hpy178III* |RsaI |SapI SfaNI Hin4II* ||MboII |Ksp632I* \ \ \\\ \\ TCATCACCCTTCGTTATTTCCATTCAAAACGCTGGTACTTATGCTCTTCCAGATATTTTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGTGGGAAGCAATAAAGGTAAGTTTTGCGACCATGAATACGAGAAGGTCTATAAAAG / / // / / SfaNI Hin4II* |Csp6I | Ksp632I* MboII | SapI RsaI Hpy178III* BceAI S S P F V I S I Q N A G T Y A L P D I F H H P S L F P F K T L V L M L F Q I F S I T L R Y F H S K R W Y L C S S R Y F Q ----:----|----:----|----:----|----:----|----:----|----:----| D D G K T I E M * F A P V * A R G S I K M M V R R * K W E F R Q Y K H E E L Y K * * G E N N G N L V S T S I S K W I N E AciI BisI |BlsI ||TauI Hpy166II ||| TspEI | MaeII SecI* ||| | TaqI | | SetI DsaI* ||| | AsuII | | TaiI | BaeI Tsp4CI* ||| | |BaeI | | | NlaIV \ \ \ \\\ \ \\ \ \ \ \ AACGCCGTGGTGTTGATTACTGTTGTATCTGCCGCTAATTCGAATGTTTACGTTGGTTCC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCGGCACCACAACTAATGACAACATAGACGGCGATTAAGCTTACAAATGCAACCAAGG / / / //// / / / // / / BaeI DsaI* Tsp4CI* |||| | | AsuII || | NlaIV SecI* |||| | | TaqI || MaeII |||| | TspEI |TaiI |||| BaeI |SetI |||AciI Hpy166II ||BisI |BlsI TauI N A V V L I T V V S A A N S N V Y V G S T P W C * L L L Y L P L I R M F T L V P R R G V D Y C C I C R * F E C L R W F P ----:----|----:----|----:----|----:----|----:----|----:----| L A T T N I V T T D A A L E F T * T P E * R R P T S * Q Q I Q R * N S H K R Q N V G H H Q N S N Y R G S I R I N V N T G MaeII AluI |MaeIII CviJI BciVI |Tsp45I |MaeI MaeIII TspEI || SetI ||SetI | BsrI | HphI || TaiI \\\ \ \ \ \ \\ \ CGTGTTCTTTACTCTTTAGCTAGGACTGGTAACGCACCAAAGCAATTTGGATACGTCACC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GCACAAGAAATGAGAAATCGATCCTGACCATTGCGTGGTTTCGTTAAACCTATGCAGTGG / / / / / / / / / / | | MaeI BsrI MaeIII | | | | Tsp45I | CviJI | | | | MaeIII | AluI | | | MaeII SetI | | TaiI | | SetI | TspEI | HphI BciVI R V L Y S L A R T G N A P K Q F G Y V T V F F T L * L G L V T H Q S N L D T S P C S L L F S * D W * R T K A I W I R H Q ----:----|----:----|----:----|----:----|----:----|----:----| R T R * E K A L V P L A G F C N P Y T V G H E K S K L * S Q Y R V L A I Q I R * T N K V R * S P S T V C W L L K S V D G BtsI CviRI* | TseI | |BisI | ||BlsI BsmI BsiYI* | ||TspRI | BssKI EcoP15I | BbvI | |||CviRI* | EcoRII \ \ \ \ \\\\ \ \ AGACAGGGTGTTCCATATCTCGGTGTTGTTTGCACTGCTGCATTGGGTCTTTTGGCATTC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTCCCACAAGGTATAGAGCCACAACAAACGTGACGACGTAACCCAGAAAACCGTAAG / / / / / /// / | BsiYI* | | | ||CviRI* BsmI EcoP15I | | | ||TseI | | | |BisI | | | BlsI | | CviRI* | TspRI | BtsI BbvI R Q G V P Y L G V V C T A A L G L L A F D R V F H I S V L F A L L H W V F W H S T G C S I S R C C L H C C I G S F G I P ----:----|----:----|----:----|----:----|----:----|----:----| L C P T G Y R P T T Q V A A N P R K A N W V P H E M D R H Q K C Q Q M P D K P M S L T N W I E T N N A S S C Q T K Q C E CviRI* | BtsI | | MwoI BsrI | | BstAPI |MboI | | | CviRI* |BclI ScrFI | | | | TspRI || DpnI BseBI | | | | | MseI || |BstKTI \ \ \ \ \ \ \ \\ \\ CTGGTTGTCAATAACAATGCAAACACTGCATTTAACTGGTTGATCAACATTTCCACTTTG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GACCAACAGTTATTGTTACGTTTGTGACGTAAATTGACCAACTAGTTGTAAAGGTGAAAC / / / // / / / // / | EcoRII | || | | | || BclI | BssKI | || | | | || MboI BseBI | || | | | |DpnI ScrFI | || | | | BstKTI | || | | BsrI | || | MseI | || CviRI* | |BstAPI | |MwoI | TspRI | BtsI CviRI* L V V N N N A N T A F N W L I N I S T L W L S I T M Q T L H L T G * S T F P L W G C Q * Q C K H C I * L V D Q H F H F G ----:----|----:----|----:----|----:----|----:----|----:----| R T T L L L A F V A N L Q N I L M E V K G P Q * Y C H L C Q M * S T S * C K W K Q N D I V I C V S C K V P Q D V N G S Q SetI |FatI ||CviAII ||| CviRI* Hin6I ||| NlaIII |GlaI ||| | Cac8I |TspDTI ||| | HindIII ||HhaI ||| | | AluI BseYI ||BssKI ||| | | CviJI CviJI ||EcoRII ||| | | | SetI | GsaI ||| ScrFI ||| | | | |MseI | |TsoI ||| BseBI TspDTI ||| | | | ||AhaIII* \ \\ \\\ \ \ \\\ \ \ \ \\\ GCTGGGTTATGCGCCTGGTTATTCATCTCTTTGGCACATATTAGGTTCATGCAAGCTTTA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CGACCCAATACGCGGACCAATAAGTAGAGAAACCGTGTATAATCCAAGTACGTTCGAAAT / // //// / / / / / // / / / // | || |||| | EcoRII TspDTI SetI | || | | | |MseI | || |||| | BssKI | || | | | AhaIII* | || |||| BseBI | || | | HindIII | || |||| ScrFI | || | CviJI | || |||Hin6I | || | AluI | || ||GlaI | || Cac8I | || |HhaI | || SetI | || TspDTI | |CviRI* | |BseYI | |FatI | TsoI | CviAII CviJI NlaIII GsaI A G L C A W L F I S L A H I R F M Q A L L G Y A P G Y S S L W H I L G S C K L * W V M R L V I H L F G T Y * V H A S F K ----:----|----:----|----:----|----:----|----:----|----:----| A P N H A Q N N M E K A C I L N M C A K P Q T I R R T I * R K P V Y * T * A L K S P * A G P * E D R Q C M N P E H L S * BsiI* SfaNI | Hpy178III* | CviJI SecI* | | MboI | HaeIII DsaI* | | | DpnI | | Hin4II* HgiCI* |Tsp4CI* | | | |BstKTI | | |TspEI | NlaIV \\ \ \ \ \\ \ \ \\ \ \ AAGCACCGTGGTATTTCTCGTGATGATCTGCCCTTCAAGGCCAAATTGATGCCTTATGGT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGTGGCACCATAAAGAGCACTACTAGACGGGAAGTTCCGGTTTAACTACGGAATACCA / / / // / /// / / | DsaI* | || MboI ||| TspEI NlaIV | SecI* | |DpnI ||SfaNI Tsp4CI* | BstKTI |Hin4II* Hpy178III* HaeIII BsiI* CviJI K H R G I S R D D L P F K A K L M P Y G S T V V F L V M I C P S R P N * C L M V A P W Y F S * * S A L Q G Q I D A L W C ----:----|----:----|----:----|----:----|----:----|----:----| F C R P I E R S S R G K L A L N I G * P L A G H Y K E H H D A R * P W I S A K H L V T T N R T I I Q G E L G F Q H R I T MwoI MaeIII | TseI Tsp45I | |BisI |BbvI | ||BlsI || FokI BseGI | |||CviJI || | TspDTI | StyI NlaIV | |||| HphI || | Tsp4CI* | SecI* | TspGWI \ \\\\ \ \\ \ \ \ \ \ \ GCCTACTACGCAGCCTTTTTTGTCACCGTCATCATATTCATCCAAGGGTTCCAAGCGTTC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CGGATGATGCGTCGGAAAAAACAGTGGCAGTAGTATAAGTAGGTTCCCAAGGTTCGCAAG / / //// // / / / / / | MwoI |||HphI || FokI BseGI | | TspGWI HgiCI* ||CviJI |Tsp4CI* | NlaIV ||TseI |Tsp45I SecI* |BisI |MaeIII StyI BlsI |BbvI TspDTI A Y Y A A F F V T V I I F I Q G F Q A F P T T Q P F L S P S S Y S S K G S K R S L L R S L F C H R H H I H P R V P S V L ----:----|----:----|----:----|----:----|----:----|----:----| A * * A A K K T V T M M N M W P N W A N H R S R L R K Q * R * * I * G L T G L T G V V C G K K D G D D Y E D L P E L R E BceAI BseMII DdeI | TfiI TspDTI |BspCNI |Hpy188I | HinfI |CviJI \\ \\ \ \ \\ TGTCCGTTCAAAGTTTCTGAGTTTTTCACATCTTACATCTCCTTGATTCTTTTAGCCGTT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| ACAGGCAAGTTTCAAAGACTCAAAAAGTGTAGAATGTAGAGGAACTAAGAAAATCGGCAA // / / / / / / |BspCNI | DdeI BceAI | | CviJI BseMII Hpy188I | TspDTI HinfI TfiI C P F K V S E F F T S Y I S L I L L A V V R S K F L S F S H L T S P * F F * P L S V Q S F * V F H I L H L L D S F S R C ----:----|----:----|----:----|----:----|----:----|----:----| Q G N L T E S N K V D * M E K I R K A T R D T * L K Q T K * M K C R R S E K L R T R E F N R L K E C R V D G Q N K * G N AluI CviJI |MaeI CviRI* ||SetI \ \\\ GTGTTCATTGGTTGCCAGATATACTACAAATGCAGATTTATTTGGAAGCTAGAAGATATT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CACAAGTAACCAACGGTCTATATGATGTTTACGTCTAAATAAACCTTCGATCTTCTATAA / / / / CviRI* | | MaeI | CviJI | AluI SetI V F I G C Q I Y Y K C R F I W K L E D I C S L V A R Y T T N A D L F G S * K I L V H W L P D I L Q M Q I Y L E A R R Y * ----:----|----:----|----:----|----:----|----:----|----:----| T N M P Q W I Y * L H L N I Q F S S S I Q T * Q N G S I S C I C I * K S A L L Y H E N T A L Y V V F A S K N P L * F I N BbvII* MboII | Hpy99I |TaqI | | CviJI |ClaI | | |MboII || TfiI TaqI | | |EcoP15I || HinfI | MboII | | ||DdeI || | Hpy188I | | TspEI | | ||| ApoI || | Ksp632I* | | | MmeI | | ||| TspEI \\ \ \ \ \ \ \ \ \ \\\ \ GACATCGATTCCGACAGAAGAGAAATCGAAGCAATTATTTGGGAAGACGACGAGCCTAAG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTAGCTAAGGCTGTCTTCTCTTTAGCTTCGTTAATAAACCCTTCTGCTGCTCGGATTC / / // / / / / / / / / | | || Ksp632I* | | TspEI Hpy99I | | DdeI | | |Hpy188I | MmeI | EcoP15I | | HinfI MboII BbvII* | | TfiI TaqI MboII | ClaI CviJI | TaqI MboII D I D S D R R E I E A I I W E D D E P K T S I P T E E K S K Q L F G K T T S L R H R F R Q K R N R S N Y L G R R R A * E ----:----|----:----|----:----|----:----|----:----|----:----| S M S E S L L S I S A I I Q S S S S G L Q C R N R C F L F R L L * K P L R R A * V D I G V S S F D F C N N P F V V L R L TseI CviJI |BisI BbvI ||BlsI | ApoI ||| MwoI | TspEI ||| | CviRI* \ \ \\\ \ \ AATTTATGGGAGAAATTCTGGGCTGCTGTTGCATAG 1810 1820 1830 ----:----|----:----|----:----|----:- TTAAATACCCTCTTTAAGACCCGACGACAACGTATC / / / //// / TspEI | | |||MwoI CviRI* ApoI | | |||TseI | | ||BisI | | |BlsI | | CviJI | TspEI | ApoI BbvI N L W E K F W A A V A * I Y G R N S G L L L H X F M G E I L G C C C I X ----:----|----:----|----:----|----:- F K H S F N Q A A T A Y S N I P S I R P Q Q Q M I * P L F E P S S N C L # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 2 FblI,XmiI AciI 5 BspACI,SsiI AflIII 2 AhaIII* 1 DraI AluI 4 AluBI AlwNI 1 CaiI ApaI 1 ApoI 5 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 1 BpuEI BceAI 4 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BfiI 1 BmrI,BmuI BinI* 4 AlwI,BspPI,AclWI BisI 7 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 7 BmgT120I 5 BsaAI 2 BstBAI,Ppu21I BseBI 7 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 1 BseRI 1 BseSI 2 BaeGI,BstSLI BseYI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp120I 1 PspOMI BspCNI 1 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 10 BseNI,Bse1I,BsrSI BssKI 7 BstSCI,StyD4I BstAPI 1 BstKTI 5 BstXI 2 BtsI 2 Cac8I 3 BstC8I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 9 CviQI,RsaNI CviAII 7 CviJI 25 CviKI-1 CviRI* 14 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 5 MalI DraII 3 EcoO109I DraIII 2 AdeI DsaI* 2 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57MI 1 EcoP15I 3 EcoRII 7 AjnI,Psp6I,PspGI FalI 4 FatI 7 FokI 3 GlaI 2 GsaI 1 GsuI 1 BpmI HaeIII 8 BsnI,BsuRI,BshFI,PhoI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4II* 3 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 4 HpaI 1 KspAI HphI 8 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 3 Hpy99I 1 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 8 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 9 MfeI 2 MunI MmeI 1 MnlI 6 MseI 6 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 8 HpyF10VI,BstMWI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 11 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 2 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PpuMI 1 Psp5II,PspPPI RsaI 9 AfaI SanDI 1 SapI 1 LguI,PciSI,BspQI ScrFI 7 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 6 BseDI,BssECI,BsaJI SetI 19 SfaNI 3 LweI SmlI 1 SmoI SnaBI 1 Eco105I,BstSNI SphI 1 PaeI,BbuI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 6 TaqI 5 TaqII 1 TatI 2 TauI 3 TfiI 4 PfeI TseI 4 ApeKI TsoI 3 Tsp45I 4 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 8 TspEI 14 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 4 TscAI VspI 1 PshBI,AseI XcmI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AclI AcyI AflII AgeI AjuI AlfI AloI ApaLI AscI Asp718I AvaI AvrII BarI BbvCI BcgI BdaI BetI* BglI BglII BmeT110I BmtI BplI Bpu10I BsaBI BsaXI BsePI BsgI Bsp1407I BspMII* BspOI BsrBI BssNAI Bst1107I BstEII BstZ17I BtgZI BtrI CauII* Cfr10I Cfr9I CspCI DinI DrdI Eam1105I EciI Ecl136II Eco47III Eco57I EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FauI FnuDII* FseI FspAI HaeII HgaI HgiAI* Hin4I HpaII KasI KpnI MauBI McrI* MluI MlyI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PleI PmeI PpiI PshAI PsiI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SauI* ScaI SchI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TspMI TstI Tth111I XbaI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769