Restriction Map of POL2/YNL262W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

POL2/YNL262W on chromosome XIV from coordinates 148212 to 154880.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.14647

MnlI | MboII | | MboI | | XhoII | | | DpnI | | | |BstKTI AluI | | | || BtsI CviJI | | | || |BinI* PvuII | | | || || TspGWI NspBII* | | | || || | CviRI* | SetI | | | || || | | TspRI | Cac8I \ \ \ \\ \\ \ \ \ \ \ ATGATGTTTGGCAAGAAAAAAAACAACGGAGGATCTTCCACTGCAAGATATTCAGCTGGC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTACAAACCGTTCTTTTTTTTGTTGCCTCCTAGAAGGTGACGTTCTATAAGTCGACCG / / // // // / / / / | MboII || || || CviRI* | | Cac8I MnlI || || |BinI* | NspBII* || || TspGWI | PvuII || |TspRI | CviJI || |BtsI | AluI || XhoII SetI || MboI |DpnI BstKTI M M F G K K K N N G G S S T A R Y S A G * C L A R K K T T E D L P L Q D I Q L A D V W Q E K K Q R R I F H C K I F S W Q ----:----|----:----|----:----|----:----|----:----|----:----| X I N P L F F F L P P D E V A L Y E A P X S T Q C S F F C R L I K W Q L I N L Q H H K A L F F V V S S R G S C S I * S A Hin6I |GlaI ||HhaI |||DdeI |||EspI* |||| MwoI |||| |BsePI |||| |Hin6I |||| ||GlaI |||| ||MwoI |||| |||HhaI |||| |||Hin6I |||| |||Cac8I AluI TatI |||| |||FnuDII* CviJI |Csp6I |||| ||||GlaI | SetI ||RsaI TspEI |||| |||||HhaI | | MseI MaeI \\\ \ \\\\ \\\\\\ \ \ \ \ AACAAGTACAACACACTCTCAAATAATTATGCGCTTAGCGCGCAACAGCTCTTAAATGCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTCATGTTGTGTGAGAGTTTATTAATACGCGAATCGCGCGTTGTCGAGAATTTACGA /// / //// /////// / / / ||TatI | |||| ||||||| | CviJI MseI |Csp6I | |||| ||||||| | AluI RsaI | |||| ||||||| SetI | |||| ||||||BsePI | |||| ||||||Hin6I | |||| |||||GlaI | |||| ||||FnuDII* | |||| ||||Hin6I | |||| ||||Cac8I | |||| ||||HhaI | |||| |||GlaI | |||| ||HhaI | |||| |EspI* | |||| |DdeI | |||| MwoI | |||MwoI | ||Hin6I | |GlaI | HhaI TspEI N K Y N T L S N N Y A L S A Q Q L L N A T S T T H S Q I I M R L A R N S S * M L Q V Q H T L K * L C A * R A T A L K C * ----:----|----:----|----:----|----:----|----:----|----:----| L L Y L V S E F L * A S L A C C S K F A C C T C C V R L Y N H A * R A V A R L H V L V V C E * I I I R K A R L L E * I S MaeII |BsaAI |SnaBI ||Csp6I |||RsaI |||SetI |||TaiI TaqI |||| AciI MboI ClaI |||| | AciI | DpnI | TfiI |||| | BisI | |TaqI | HinfI |||| | |BlsI | |ClaI | | BccI |||| | ||TauI | |BstKTI | | |TaqI |||| | ||| BspMI \ \\ \ \ \\ \\\\ \ \\\ \ AGTAAGATCGATGACATCGATTCGATGATGGGATTTGAAAGATACGTACCGCCGCAATAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTCTAGCTACTGTAGCTAAGCTACTACCCTAAACTTTCTATGCATGGCGGCGTTATG / // // / / / / //// //// / MaeI || |ClaI | | TaqI | |||| |||AciI BspMI || |TaqI | HinfI | |||| ||BisI || MboI | TfiI | |||| |BlsI |DpnI | BccI | |||| AciI BstKTI ClaI | |||| TauI TaqI | |||Csp6I | ||RsaI | |MaeII | SnaBI | BsaAI TaiI SetI S K I D D I D S M M G F E R Y V P P Q Y V R S M T S I R * W D L K D T Y R R N T * D R * H R F D D G I * K I R T A A I Q ----:----|----:----|----:----|----:----|----:----|----:----| L L I S S M S E I I P N S L Y T G G C Y * Y S R H C R N S S P I Q F I R V A A I T L D I V D I R H H S K F S V Y R R L V BsaBI |MboI || DpnI || |BstKTI || || Hpy188I || || |TfiI || || |HinfI || || || BssKI || || || EcoRII || || || | ScrFI || || || | BseBI || || || | | CviJI || || || | | HaeIII || || || | | |AciI || || || | | |BisI || || || | | ||BlsI SetI || || || | | |||TauI SfaNI | Hin4II* || || || | | |||FnuDII* CviJI \ \ \ \\ \\ \\ \ \ \\\\ \ AATGGCAGGTTTGATGCGAAGGATATAGATCAGATTCCAGGCCGCGTAGGGTGGCTGACG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCGTCCAAACTACGCTTCCTATATCTAGTCTAAGGTCCGGCGCATCCCACCGACTGC // / / // / / / //// / || Hin4II* | || | | | |||FnuDII* CviJI |SfaNI | || | | | |||AciI SetI | || | | | ||BisI | || | | | |BlsI | || | | | EcoRII | || | | | HaeIII | || | | | BssKI | || | | | CviJI | || | | | TauI | || | | BseBI | || | | ScrFI | || | HinfI | || | TfiI | || Hpy188I | || MboI | |DpnI | BstKTI BsaBI N G R F D A K D I D Q I P G R V G W L T M A G L M R R I * I R F Q A A * G G * R W Q V * C E G Y R S D S R P R R V A D E ----:----|----:----|----:----|----:----|----:----|----:----| L P L N S A F S I S * I G P R T P H S V C H C T Q H S P Y L D S E L G R L T A S I A P K I R L I Y I L N W A A Y P P Q R AciI DdeI |BisI FatI |BsmAI ||BlsI |CviAII |Eco31I |||AciI || NspI ||Hpy178III* |||TauI || CviRI* ||| SetI ||||BisI || NlaIII ||| | BspCNI |||||BlsI || | Cac8I ||| | |BseMII ||||||TauI || | | MwoI ||| | ||BsrI TspRI |||||||TspEI \\ \ \ \ \\\ \ \\\ \ \\\\\\\\ AACATGCACGCAACGCTGGTCTCTCAGGAAACCTTATCCAGTGGTAGTAATGGCGGCGGC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTACGTGCGTTGCGACCAGAGAGTCCTTTGGAATAGGTCACCATCATTACCGCCGCCG / // // /// / /// ////// | || |MwoI ||| | ||TspRI |||||BisI | || Cac8I ||| | ||BsrI |||||AciI | |CviRI* ||| | |BseMII ||||BlsI | |FatI ||| | BspCNI |||TauI | CviAII ||| SetI ||BisI NlaIII ||Eco31I ||AciI NspI ||BsmAI |BlsI |Hpy178III* TauI DdeI N M H A T L V S Q E T L S S G S N G G G T C T Q R W S L R K P Y P V V V M A A A H A R N A G L S G N L I Q W * * W R R Q ----:----|----:----|----:----|----:----|----:----|----:----| F M C A V S T E * S V K D L P L L P P P S C A R L A P R E P F R I W H Y Y H R R V H V C R Q D R L F G * G T T T I A A A StyI SecI* | BsaXI | | SetI MaeII | | | BetI* AflIII | | | BspMII* | SetI | | | |HpaII TaqI | TaiI | | | |Hpy178III* AsuII | MaeIII | | | || HindII |BsaXI | | TspGWI | | | || Hpy166II \\ \ \ \ \ \ \ \\ \ AATTCGAATGACGGAGAACGTGTAACGACCAACCAAGGTATTTCCGGAGTTGACTTCTAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGCTTACTGCCTCTTGCACATTGCTGGTTGGTTCCATAAAGGCCTCAACTGAAGATG / / / / / / / / / / / // / | | AsuII | | | | | | | SecI* || Hpy166II | | TaqI | | | | | | | StyI || HindII | TspEI | | | | | | SetI |BspMII* BsaXI | | | | | BsaXI |BetI* | | | | MaeIII Hpy178III* | | | TspGWI HpaII | | AflIII | MaeII TaiI SetI N S N D G E R V T T N Q G I S G V D F Y I R M T E N V * R P T K V F P E L T S T F E * R R T C N D Q P R Y F R S * L L L ----:----|----:----|----:----|----:----|----:----|----:----| L E F S P S R T V V L W P I E P T S K * C N S H R L V H L S W G L Y K R L Q S R I R I V S F T Y R G V L T N G S N V E V SalI |TaqI MboII |AccI |AluI ||HindII |CviJI ||Hpy166II Ksp632I* |TspDTI ||| Tsp4CI* |MnlI || SetI ||| |PshAI \\ \\ \ \\\ \\ TTTTTAGATGAAGAGGGTGGGAGCTTCAAGTCGACAGTTGTCTATGACCCATACTTCTTT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAATCTACTTCTCCCACCCTCGAAGTTCAGCTGTCAACAGATACTGGGTATGAAGAAA / / / / //// / | Ksp632I* | CviJI |||| PshAI MnlI | AluI |||Tsp4CI* TspDTI ||SalI MboII |AccI SetI |TaqI Hpy166II HindII F L D E E G G S F K S T V V Y D P Y F F F * M K R V G A S S R Q L S M T H T S L F R * R G W E L Q V D S C L * P I L L Y ----:----|----:----|----:----|----:----|----:----|----:----| K K S S S P P L K L D V T T * S G Y K K S K L H L P H S S * T S L Q R H G M S R K * I F L T P A E L R C N D I V W V E K TfiI HinfI | Hpy178III* | | TspDTI SpeI MaeIII | | |MnlI |MaeI Hpy178III* \ \ \ \\ \\ \ ATTGCGTGTAACGATGAATCAAGAGTAAATGATGTGGAGGAACTAGTGAAAAAATATCTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGCACATTGCTACTTAGTTCTCATTTACTACACCTCCTTGATCACTTTTTTATAGAC / / / / / // / MaeIII | | | MnlI |SpeI Hpy178III* | | TspDTI MaeI | Hpy178III* HinfI TfiI I A C N D E S R V N D V E E L V K K Y L L R V T M N Q E * M M W R N * * K N I W C V * R * I K S K * C G G T S E K I S G ----:----|----:----|----:----|----:----|----:----|----:----| I A H L S S D L T F S T S S S T F F Y R * Q T Y R H I L L L H H P P V L S F I D N R T V I F * S Y I I H L F * H F F I Q MboI BglII XhoII | DpnI | |BstKTI | || FatI | || NcoI | || StyI | || SecI* | || DsaI* BsmAI | || |CviAII | HindIII | || ||HphI | | AluI | || ||MboII TfiI | | CviJI | || ||| NlaIII HinfI | | | SetI | || ||| | BbvI \ \ \ \ \ \ \\ \\\ \ \ GAATCTTGTCTCAAAAGCTTACAAATCATTAGAAAGGAAGATCTTACCATGGACAATCAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGAACAGAGTTTTCGAATGTTTAGTAATCTTTCCTTCTAGAATGGTACCTGTTAGTG / / / / // / // // / / HinfI | | HindIII || | || |DsaI* | BbvI TfiI | BsmAI || | || |SecI* SetI | CviJI || | || |StyI | AluI || | || |NcoI SetI || | || |FatI || | || CviAII || | |MboII || | |HphI || | NlaIII || XhoII || BglII || MboI |DpnI BstKTI E S C L K S L Q I I R K E D L T M D N H N L V S K A Y K S L E R K I L P W T I T I L S Q K L T N H * K G R S Y H G Q S P ----:----|----:----|----:----|----:----|----:----|----:----| S D Q R L L K C I M L F S S R V M S L * P I K D * F S V F * * F P L D * W P C D F R T E F A * L D N S L F I K G H V I V TseI CviJI |BisI |SfeI* ||BlsI BbvII* AjuI |||CviRI* | MseI | ApoI SetI |||| PstI | |MboII | TspEI MnlI TaqI \ \\\\ \ \ \\ \ \ \ \ CTTTTAGGGCTGCAGAAGACACTTATTAAGTTATCATTTGTAAATTCCAATCAGTTATTC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAATCCCGACGTCTTCTGTGAATAATTCAATAGTAAACATTTAAGGTTAGTCAATAAG //// / / / / / / |||| SfeI* | MseI AjuI TspEI MnlI |||CviRI* BbvII* ApoI |||TseI MboII ||BisI |BlsI |PstI CviJI L L G L Q K T L I K L S F V N S N Q L F F * G C R R H L L S Y H L * I P I S Y S F R A A E D T Y * V I I C K F Q S V I R ----:----|----:----|----:----|----:----|----:----|----:----| R K P S C F V S I L N D N T F E L * N N G K L A A S S V * * T I M Q L N W D T I K * P Q L L C K N L * * K Y I G I L * E BssKI CviJI EcoRII HaeIII | ScrFI | BseBI | |BseMII | ||BspCNI | ||| MnlI | ||| |AjuI | ||| || Hpy178III* | ||| || |DdeI | ||| || |SauI* | ||| || || AlfI | ||| || || AlfI | ||| || || | CviJI | ||| || || | HaeIII AlfI | ||| || || | | MwoI AlfI | ||| || || | | | CviRI* |CviRI* \ \\\ \\ \\ \ \ \ \ \\ GAGGCCAGGAAACTCCTGAGGCCAATCTTGCAGGATAATGCCAATAATAATGTGCAAAGA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCGGTCCTTTGAGGACTCCGGTTAGAACGTCCTATTACGGTTATTATTACACGTTTCT / //// // / / / / / / / | |||| |MnlI | | | MwoI CviRI* | CviRI* | |||| EcoRII | | HaeIII AlfI | |||| BssKI | | CviJI AlfI | |||BseBI | SauI* | |||ScrFI | DdeI | |||AjuI Hpy178III* | ||BspCNI AlfI | |BseMII AlfI | HaeIII | CviJI TaqI E A R K L L R P I L Q D N A N N N V Q R R P G N S * G Q S C R I M P I I M C K E G Q E T P E A N L A G * C Q * * C A K K ----:----|----:----|----:----|----:----|----:----|----:----| S A L F S R L G I K C S L A L L L T C L R P W S V G S A L R A P Y H W Y Y H A F L G P F E Q P W D Q L I I G I I I H L S BcgI | AclI | MaeII | | SetI HgaI | | TaiI | MboI | | | TseI HindII | Hpy188I | | | |BisI Hpy166II | | DpnI | | | ||BlsI CviJI | AcyI | | |TaqI BbvI | | | |||CviRI* | Hpy188I | |BcgI | | |BstKTI \ \ \ \ \\\\ \ \ \ \\ \ \ \\ AATATATATAACGTTGCTGCAAATGGCTCGGAAAAAGTTGACGCCAAACATCTGATCGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTATATATATTGCAACGACGTTTACCGAGCCTTTTTCAACTGCGGTTTGTAGACTAGCTT // / / /// / / // / / // // || | | ||CviRI* | Hpy188I || AcyI | || |TaqI || | | ||TseI CviJI |BcgI | || MboI || | | |BisI Hpy166II | |DpnI || | | BlsI HindII | BstKTI || | MaeII | HgaI || | AclI Hpy188I || TaiI || SetI |BbvI BcgI N I Y N V A A N G S E K V D A K H L I E I Y I T L L Q M A R K K L T P N I * S K Y I * R C C K W L G K S * R Q T S D R R ----:----|----:----|----:----|----:----|----:----|----:----| F I Y L T A A F P E S F T S A L C R I S F Y I Y R Q Q L H S P F L Q R W V D S R I Y I V N S C I A R F F N V G F M Q D F FatI |CviAII EcoRV || NlaIII | BceAI || | Hpy188I DrdI | | MboII || | | SfeI* |HinfI \ \ \ \\ \ \ \ \\ GATATCAGGGAATATGATGTGCCGTATCATGTCCGAGTATCTATAGACAAGGACATTAGA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAGTCCCTTATACTACACGGCATAGTACAGGCTCATAGATATCTGTTCCTGTAATCT / // / // / / / | |MboII | || Hpy188I SfeI* DrdI | BceAI | |FatI EcoRV | CviAII NlaIII D I R E Y D V P Y H V R V S I D K D I R I S G N M M C R I M S E Y L * T R T L E Y Q G I * C A V S C P S I Y R Q G H * S ----:----|----:----|----:----|----:----|----:----|----:----| S I L S Y S T G Y * T R T D I S L S M L L Y * P I H H A T D H G L I * L C P C * I D P F I I H R I M D S Y R Y V L V N S MaeIII MboII PleI | SetI TfiI |TspEI |MlyI | | TspDTI HinfI MaeI || CviRI* \\ \ \ \ \ \ \\ \ GTCGGTAAATGGTATAAGGTAACTCAACAGGGATTCATTGAAGATACTAGGAAAATTGCA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCCATTTACCATATTCCATTGAGTTGTCCCTAAGTAACTTCTATGATCCTTTTAACGT / / / // / / / // HinfI PleI SetI |MaeIII HinfI | MboII |CviRI* MlyI TspDTI TfiI MaeI TspEI V G K W Y K V T Q Q G F I E D T R K I A S V N G I R * L N R D S L K I L G K L H R * M V * G N S T G I H * R Y * E N C I ----:----|----:----|----:----|----:----|----:----|----:----| T P L H Y L T V * C P N M S S V L F I A L R Y I T Y P L E V P I * Q L Y * S F Q D T F P I L Y S L L S E N F I S P F N C CviJI |AciI |BisI ||BlsI |||TauI |||| MseI |||| |AhaIII* |||| || ApoI |||| || BceAI |||| || TspEI |||| || | EciI |||| || | | PfoI |||| || | | BssKI \\\\ \\ \ \ \ TTTGCCGACCCTGTGGTAATGGCATTTGATATAGAAACCACGAAGCCGCCTTTAAAATTC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGGCTGGGACACCATTACCGTAAACTATATCTTTGGTGCTTCGGCGGAAATTTTAAG //// /// / / |||AciI ||| | TspEI ||BisI ||| | ApoI |BlsI ||| BceAI CviJI ||EciI TauI |MseI AhaIII* F A D P V V M A F D I E T T K P P L K F L P T L W * W H L I * K P R S R L * N S C R P C G N G I * Y R N H E A A F K I P ----:----|----:----|----:----|----:----|----:----|----:----| N A S G T T I A N S I S V V F G G K F N M Q R G Q P L P M Q Y L F W S A A K L I K G V R H Y H C K I Y F G R L R R * F E BccI HpaII |MboI ScrFI || DpnI CauII* || |TaqI | TfiI MboI || |ClaI | HinfI | DpnI || |BstKTI | | AciI | |BstKTI || || Hin4II* SetI \ \ \ \ \\ \\ \\ \ \ CCGGATTCCGCCGTAGATCAAATAATGATGATTTCGTATATGATCGATGGGGAAGGTTTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCTAAGGCGGCATCTAGTTTATTACTACTAAAGCATATACTAGCTACCCCTTCCAAAA /// / / // / /// // / ||| | AciI || MboI ||| |ClaI SetI ||| HinfI |DpnI ||| |TaqI ||| TfiI BstKTI ||| Hin4II* ||BssKI ||| MboI ||PfoI ||DpnI |HpaII |BstKTI CauII* BccI ScrFI P D S A V D Q I M M I S Y M I D G E G F R I P P * I K * * * F R I * S M G K V F G F R R R S N N D D F V Y D R W G R F F ----:----|----:----|----:----|----:----|----:----|----:----| G S E A T S * I I I I E Y I I S P S P K G P N R R L D F L S S K T Y S R H P L N R I G G Y I L Y H H N R I H D I P F T K BbvII* | BaeI | AccI BseMII | MboII BplI |BspCNI DdeI BplI | |BssNAI BplI || MnlI |Hpy188I BplI | |Hpy166II BetI* \ \\ \ \\ \ \ \\ \ TTGATAACAAATAGGGAGATAATCTCTGAGGATATTGAAGACTTTGAGTATACACCGAAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AACTATTGTTTATCCCTCTATTAGAGACTCCTATAACTTCTGAAACTCATATGTGGCTTT / // / / / / / / // BplI || MnlI | DdeI BplI | | |AccI BplI |BspCNI Hpy188I BplI | | Hpy166II BseMII | | BssNAI | BbvII* | MboII BaeI L I T N R E I I S E D I E D F E Y T P K * * Q I G R * S L R I L K T L S I H R N D N K * G D N L * G Y * R L * V Y T E T ----:----|----:----|----:----|----:----|----:----|----:----| K I V F L S I I E S S I S S K S Y V G F K S L L Y P S L R Q P Y Q L S Q T Y V S Q Y C I P L Y D R L I N F V K L I C R F BssKI Hin6I EcoRII |GlaI | ScrFI ||HhaI | BseBI BciVI FalI |||HaeII HpaII | |HphI | BaeI MseI FalI |||| TspDTI \ \ \\ \ \ \ \ \\\\ \ CCGGAGTATCCTGGTTTTTTCACCATATTTAACGAAAACGATGAAGTGGCGCTTCTACAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCTCATAGGACCAAAAAAGTGGTATAAATTGCTTTTGCTACTTCACCGCGAAGATGTT // // / // // //// / / |BetI* || | |BaeI |MseI |||| | SetI HpaII || | BciVI FalI |||| TspDTI || EcoRII FalI |||Hin6I || BssKI ||GlaI |BseBI |HhaI |ScrFI HaeII HphI P E Y P G F F T I F N E N D E V A L L Q R S I L V F S P Y L T K T M K W R F Y K G V S W F F H H I * R K R * S G A S T K ----:----|----:----|----:----|----:----|----:----|----:----| G S Y G P K K V M N L S F S S T A S R C V P T D Q N K * W I * R F R H L P A E V R L I R T K E G Y K V F V I F H R K * L SetI MaeIII | FalI Csp6I Tsp4CI* Tsp45I | FalI |RsaI | TspRI SetI | Hin4II* \ \ \\ \ \ \ \ \ AGGTTTTTTGAACATATAAGAGATGTACGACCCACTGTTATATCCACCTTCAATGGTGAC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TCCAAAAAACTTGTATATTCTCTACATGCTGGGTGACAATATAGGTGGAAGTTACCACTG / // / / / / / FalI || | Tsp4CI* SetI | Tsp45I FalI || TspRI | MaeIII |Csp6I Hin4II* RsaI R F F E H I R D V R P T V I S T F N G D G F L N I * E M Y D P L L Y P P S M V T V F * T Y K R C T T H C Y I H L Q W * L ----:----|----:----|----:----|----:----|----:----|----:----| L N K S C I L S T R G V T I D V K L P S F T K Q V Y L L H V V W Q * I W R * H H P K K F M Y S I Y S G S N Y G G E I T V FatI AflIII BspLU11I* |CviAII || NspI || NlaIII || | TaqI || | |BceAI TaqI CviJI TfiI || | || GsuI | HphI HaeIII HinfI CviJI || | || Eco57MI \ \ \ \ \ \\ \ \\ \ TTTTTCGATTGGCCTTTTATACATAACAGAAGTAAGATTCACGGCTTGGACATGTTCGAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAAGCTAACCGGAAAATATGTATTGTCTTCATTCTAAGTGCCGAACCTGTACAAGCTA // / / / / // /// |TaqI HaeIII | CviJI | || ||BceAI HphI CviJI HinfI | || |TaqI TfiI | || Eco57MI | || GsuI | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI F F D W P F I H N R S K I H G L D M F D F S I G L L Y I T E V R F T A W T C S M F R L A F Y T * Q K * D S R L G H V R * ----:----|----:----|----:----|----:----|----:----|----:----| K K S Q G K I C L L L L I * P K S M N S S K R N A K * V Y C F Y S E R S P C T R K E I P R K Y M V S T L N V A Q V H E I HphI | Eco57I SfaNI | Eco57MI | TspDTI | | MnlI | | Hpy178III* | | | Hin4I | | | MwoI SetI | | | | FatI | | | Hin4II* | TatI | | | | |CviAII | | | | Hin4I | |Csp6I | | | | ||TspGWI TspEI | | | | AlwNI | ||RsaI | | | | ||| NlaIII \ \ \ \ \ \ \ \\\ \ \ \ \ \\\ \ GAAATTGGTTTCGCTCCAGATGCTGAAGGTGAGTACAAGTCCTCATACTGCTCTCACATG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAACCAAAGCGAGGTCTACGACTTCCACTCATGTTCAGGAGTATGACGAGAGTGTAC / // //// / /// / / // / // TspEI || |||AlwNI SetI ||| | | |MnlI | |FatI || ||Hpy178III* ||| | | Hin4I | CviAII || ||Hin4II* ||| | Eco57MI NlaIII || |Hin4I ||| | Eco57I TspGWI || MwoI ||| HphI |SfaNI ||TatI TspDTI |Csp6I RsaI E I G F A P D A E G E Y K S S Y C S H M K L V S L Q M L K V S T S P H T A L T W N W F R S R C * R * V Q V L I L L S H G ----:----|----:----|----:----|----:----|----:----|----:----| S I P K A G S A S P S Y L D E Y Q E * M H F Q N R E L H Q L H T C T R M S S E C F N T E S W I S F T L V L G * V A R V H SetI NlaIV | BssKI | SecI* | EcoRII | |PasI TfiI | |SecI* HinfI | ||ScrFI MseI TaqII | HphI | ||BseBI |AhaIII* \ \ \ \ \\\ \\ GATTGTTTCCGTTGGGTGAAGCGTGATTCTTATTTACCACAAGGTTCCCAGGGTTTAAAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTAACAAAGGCAACCCACTTCGCACTAAGAATAAATGGTGTTCCAAGGGTCCCAAATTTT / / / / / /// // / TaqII | HinfI | | ||| || SetI | TfiI | | ||| |MseI HphI | | ||| AhaIII* | | ||EcoRII | | ||BssKI | | ||SecI* | | |SecI* | | |PasI | | BseBI | | ScrFI | NlaIV SetI D C F R W V K R D S Y L P Q G S Q G L K I V S V G * S V I L I Y H K V P R V * K L F P L G E A * F L F T T R F P G F K S ----:----|----:----|----:----|----:----|----:----|----:----| S Q K R Q T F R S E * K G C P E W P K F P N N G N P S A H N K N V V L N G P N L I T E T P H L T I R I * W L T G L T * F MfeI TspEI | BinI* | | MboI | | BamHI | | XhoII | | | DpnI | | | BsrI | | | NlaIV DdeI | | | |BceAI | AluI | | | |BstKTI | CviJI | | | ||Hpy178III* AluI | |MaeI | | | ||| TspEI CviJI | ||SetI | | | ||| |BinI* | SetI | ||| SetI | | | ||| || MseI | MaeIII | ||| | PsiI | | | ||| || VspI AcyI \ \ \ \\\ \ \ \ \ \ \\\ \\ \ \ GCTGTTACTCAATCTAAGCTAGGTTATAACCCAATTGAACTGGATCCCGAATTAATGACG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CGACAATGAGTTAGATTCGATCCAATATTGGGTTAACTTGACCTAGGGCTTAATTACTGC / / /// // / / / /// /// / // / CviJI MaeIII ||| |MaeI PsiI | | ||| ||| | |VspI AcyI AluI ||| SetI | | ||| ||| | |MseI ||CviJI | | ||| ||| | TspEI ||AluI | | ||| ||| BinI* |DdeI | | ||| ||Hpy178III* SetI | | ||| |BceAI | | ||| XhoII | | ||| BamHI | | ||| MboI | | ||NlaIV | | ||DpnI | | |BstKTI | | BsrI | BinI* TspEI MfeI A V T Q S K L G Y N P I E L D P E L M T L L L N L S * V I T Q L N W I P N * * R C Y S I * A R L * P N * T G S R I N D A ----:----|----:----|----:----|----:----|----:----|----:----| A T V * D L S P * L G I S S S G S N I V L Q * E I * A L N Y G L Q V P D R I L S S N S L R L * T I V W N F Q I G F * H R SetI HgaI | Hpy188I |CviRI* | | SspI Hpy188I || EcoT22I CviJI | | | SfaNI | CviRI* \\ \ \ \ \ \ \ \ \ CCGTATGCATTTGAAAAGCCACAGCACCTTTCCGAATATTCTGTTTCCGATGCAGTCGCT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GGCATACGTAAACTTTTCGGTGTCGTGGAAAGGCTTATAAGACAAAGGCTACGTCAGCGA / / / / / / / / / / / | | HgaI CviJI SetI | SspI | | CviRI* TaiI | CviRI* Hpy188I | Hpy188I SetI EcoT22I SfaNI P Y A F E K P Q H L S E Y S V S D A V A R M H L K S H S T F P N I L F P M Q S L V C I * K A T A P F R I F C F R C S R Y ----:----|----:----|----:----|----:----|----:----|----:----| G Y A N S F G C C R E S Y E T E S A T A A T H M Q F A V A G K R I N Q K R H L R R I C K F L W L V K G F I R N G I C D S SetI MaeII | FokI |BsaAI | FatI |SnaBI | |CviAII TatI || SetI | ||TspDTI BseGI |Csp6I || TaiI | ||| NlaIII | TspDTI ||RsaI \\ \ \ \\\ \ \ \ \\\ ACGTATTACCTTTACATGAAATATGTTCATCCTTTTATCTTTTCCCTTTGTACTATTATT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TGCATAATGGAAATGTACTTTATACAAGTAGGAAAATAGAAAAGGGAAACATGATAATAA // / / // / / /// || SetI | |FatI | TspDTI ||TatI |MaeII | |FokI BseGI |Csp6I SnaBI | CviAII RsaI BsaAI NlaIII TspDTI T Y Y L Y M K Y V H P F I F S L C T I I R I T F T * N M F I L L S F P F V L L F V L P L H E I C S S F Y L F P L Y Y Y S ----:----|----:----|----:----|----:----|----:----|----:----| V Y * R * M F Y T * G K I K E R Q V I I * T N G K C S I H E D K * R K G K Y * * R I V K V H F I N M R K D K G K T S N N FokI | TspDTI | | Acc65I | | HgiCI* | | |Csp6I | | ||RsaI | | ||NlaIV | | |||AgeI | | |||BetI* | | |||Cfr10I BssKI | | ||||KpnI | HpaII | | ||||HpaII | ScrFI | | ||||| Csp6I | CauII* BseGI | | ||||| |RsaI BccI \ \ \ \ \ \\\\\ \\ \ CCTTTGAACCCGGATGAAACATTGAGAAAGGGTACCGGTACTTTGTGTGAAATGTTGTTG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAACTTGGGCCTACTTTGTAACTCTTTCCCATGGCCATGAAACACACTTTACAACAAC /// / / / / /// //// / ||| BseGI | | | ||| |||Csp6I BccI ||BssKI | | | ||| ||RsaI |HpaII | | | ||| |Cfr10I CauII* | | | ||| |BetI* ScrFI | | | ||| |AgeI | | | ||| HpaII | | | ||HgiCI* | | | ||Acc65I | | | |Csp6I | | | NlaIV | | | RsaI | | KpnI | FokI TspDTI P L N P D E T L R K G T G T L C E M L L L * T R M K H * E R V P V L C V K C C * F E P G * N I E K G Y R Y F V * N V V D ----:----|----:----|----:----|----:----|----:----|----:----| G K F G S S V N L F P V P V K H S I N N E K S G P H F M S F P Y R Y K T H F T T R Q V R I F C Q S L T G T S Q T F H Q Q BinI* | MboI HindIII | XhoII | AluI | | DpnI | CviJI MboII | | |BstKTI | | SetI | SspI | | || MnlI BsiYI* \ \ \ \ \ \ \ \\ \ \ ATGGTTCAAGCTTATCAACATAATATTCTTCTACCAAATAAGCATACAGATCCCATTGAG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAAGTTCGAATAGTTGTATTATAAGAAGATGGTTTATTCGTATGTCTAGGGTAACTC / / / / / / // / / / | | | MboII SspI | || | | SetI | | HindIII | || | BsiYI* | CviJI | || XhoII | AluI | || MboI SetI | || MnlI | |DpnI | BstKTI BinI* M V Q A Y Q H N I L L P N K H T D P I E W F K L I N I I F F Y Q I S I Q I P L R G S S L S T * Y S S T K * A Y R S H * E ----:----|----:----|----:----|----:----|----:----|----:----| I T * A * * C L I R R G F L C V S G M S S P E L K D V Y Y E E V L Y A Y L D W Q H N L S I L M I N K * W I L M C I G N L XbaI Hpy166II |MaeI | FatI |Hpy178III* | AflIII || TfiI | BspLU11I* || BsmAI MaeII | |CviAII || HinfI |BsaAI | || NspI BccI MboII || | Hpy188I || SetI | || NlaIII SetI | BsaBI || | |TaqII || TaiI | || | HinfI \ \ \ \\ \ \\ \\ \ \ \\ \ \ AGGTTCTATGATGGACATCTTCTAGAATCCGAGACTTACGTGGGTGGACATGTGGAGTCA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TCCAAGATACTACCTGTAGAAGATCTTAGGCTCTGAATGCACCCACCTGTACACCTCAGT / / / // // / // / / // / | | BsaBI || |Hpy188I | |MaeII | | || HinfI | MboII || |BsmAI | BsaAI | | |BspLU11I* BccI || |TaqII TaiI | | |AflIII || HinfI SetI | | |FatI || TfiI | | CviAII |XbaI | NlaIII Hpy178III* | NspI MaeI Hpy166II R F Y D G H L L E S E T Y V G G H V E S G S M M D I F * N P R L T W V D M W S H V L * W T S S R I R D L R G W T C G V I ----:----|----:----|----:----|----:----|----:----|----:----| L N * S P C R R S D S V * T P P C T S D S T R H H V D E L I R S K R P H V H P T P E I I S M K * F G L S V H T S M H L * ApoI XmnI TspEI EcoRI | MboII | Hpy178III* | |BinI* PleI | || MboI |MlyI | || XhoII || AluI | || | DpnI || CviJI | || | TspDTI || | SetI | || | |BstKTI \\ \ \ \ \\ \ \\ TTAGAAGCTGGTGTTTTTAGGAGTGATTTGAAGAATGAATTCAAGATAGATCCTTCTGCC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTTCGACCACAAAAATCCTCACTAAACTTCTTACTTAAGTTCTATCTAGGAAGACGG // / / / / /// / || CviJI | | | ||| XhoII || AluI | | | ||| MboI |SetI | | | ||DpnI PleI | | | |BstKTI MlyI | | | TspDTI | | Hpy178III* | | BinI* | MboII | EcoRI | TspEI | ApoI XmnI L E A G V F R S D L K N E F K I D P S A * K L V F L G V I * R M N S R * I L L P R S W C F * E * F E E * I Q D R S F C H ----:----|----:----|----:----|----:----|----:----|----:----| N S A P T K L L S K F F S N L I S G E A M L L Q H K * S H N S S H I * S L D K Q * F S T N K P T I Q L I F E L Y I R R G HindIII | AluI | CviJI | | SetI Hin4II* TspEI | | | ApoI | TspEI |TspDTI | | | TspEI \ \ \\ \ \ \ \ ATTGATGAATTATTACAAGAATTACCAGAAGCTTTGAAATTTAGTGTGGAAGTTGAAAAT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTACTTAATAATGTTCTTAATGGTCTTCGAAACTTTAAATCACACCTTCAACTTTTA / / / / / / / / Hin4II* TspEI | TspEI | | HindIII TspEI TspDTI | CviJI ApoI | AluI SetI I D E L L Q E L P E A L K F S V E V E N L M N Y Y K N Y Q K L * N L V W K L K I * * I I T R I T R S F E I * C G S * K * ----:----|----:----|----:----|----:----|----:----|----:----| M S S N N C S N G S A K F N L T S T S F W Q H I I V L I V L L K S I * H P L Q F N I F * * L F * W F S Q F K T H F N F I MaeIII | MnlI | ApoI BsrI TspRI | TspEI TspEI \ \ \ \ \ AAGTCCAGTGTAGATAAAGTAACGAATTTTGAGGAAATAAAAAACCAGATAACGCAGAAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGGTCACATCTATTTCATTGCTTAAAACTCCTTTATTTTTTGGTCTATTGCGTCTTT / / / TspRI | TspEI BsrI | ApoI MaeIII MnlI K S S V D K V T N F E E I K N Q I T Q K S P V * I K * R I L R K * K T R * R R N V Q C R * S N E F * G N K K P D N A E I ----:----|----:----|----:----|----:----|----:----|----:----| L D L T S L T V F K S S I F F W I V C F Y T W H L Y L L S N Q P F L F G S L A S L G T Y I F Y R I K L F Y F V L Y R L F SetI | MboI | | DpnI | | |BstKTI | | || Hin4I | | || | FatI | | || | |CviAII | | || | || NlaIII Hin4II* | | || | || |MslI \ \ \ \\ \ \\ \\ TTATTAGAGTTGAAGGAAAACAATATAAGAAACGAACTACCTTTGATCTATCATGTAGAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AATAATCTCAACTTCCTTTTGTTATATTCTTTGCTTGATGGAAACTAGATAGTACATCTA / / / /// / / /// | Hin4II* SetI ||| | | ||MslI TspEI ||| | | |FatI ||| | | CviAII ||| | NlaIII ||| MboI ||DpnI |BstKTI Hin4I L L E L K E N N I R N E L P L I Y H V D Y * S * R K T I * E T N Y L * S I M * M I R V E G K Q Y K K R T T F D L S C R C ----:----|----:----|----:----|----:----|----:----|----:----| N N S N F S F L I L F S S G K I * * T S I I L T S P F C Y L F R V V K S R D H L * * L Q L F V I Y S V F * R Q D I M Y I Hin4I | FatI | BspHI Csp6I | |CviAII |RsaI | |Hpy178III* || MnlI | || NlaIII \\ \ \ \\ \ GTCGCCTCTATGTACCCAAACATCATGACTACAAATAGACTACAACCAGATAGTATCAAA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCGGAGATACATGGGTTTGTAGTACTGATGTTTATCTGATGTTGGTCTATCATAGTTT // / / // || Hin4I | |BspHI |Csp6I | |FatI |MnlI | Hpy178III* RsaI | CviAII NlaIII V A S M Y P N I M T T N R L Q P D S I K S P L C T Q T S * L Q I D Y N Q I V S K R L Y V P K H H D Y K * T T T R * Y Q S ----:----|----:----|----:----|----:----|----:----|----:----| T A E I Y G F M M V V F L S C G S L I L H R R * T G L C * S * L Y V V V L Y Y * D G R H V W V D H S C I S * L W I T D F Hin6I BssKI |GlaI | HpaII ||HhaI | ScrFI SetI ||FnuDII* MaeI MseI | CauII* | CviRI* \\\ \ \ \ \ \ \ GCAGAGCGCGATTGTGCTAGTTGCGATTTTAATAGACCCGGAAAAACCTGTGCAAGAAAG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTCGCGCTAACACGATCAACGCTAAAATTATCTGGGCCTTTTTGGACACGTTCTTTC /// / / /// / / ||FnuDII* MaeI MseI ||| SetI CviRI* ||Hin6I ||BssKI |GlaI |HpaII HhaI CauII* ScrFI A E R D C A S C D F N R P G K T C A R K Q S A I V L V A I L I D P E K P V Q E S R A R L C * L R F * * T R K N L C K K V ----:----|----:----|----:----|----:----|----:----|----:----| A S R S Q A L Q S K L L G P F V Q A L F L L A R N H * N R N * Y V R F F R H L F C L A I T S T A I K I S G S F G T C S L BseGI | FatI | |CviAII | ||FokI ApoI | |||MboI TspEI | |||BclI EcoRI BsrI | ||||NlaIII MnlI | BfiI BseRI | |||||DpnI MseI CviJI | XmnI |BccI BstXI | ||||||BstKTI \ \ \ \ \\ \ \ \\\\\\\ TTAAAATGGGCTTGGAGAGGAGAATTCTTTCCCAGTAAGATGGATGAGTATAACATGATC 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTTACCCGAACCTCTCCTCTTAAGAAAGGGTCATTCTACCTACTCATATTGTACTAG / // // / // / / ///// MseI |CviJI || | |BstXI BseGI | ||||BclI MnlI || | BccI | ||||MboI || BseRI | |||FokI || BsrI | ||DpnI |EcoRI | |BstKTI |TspEI | |FatI |XmnI | CviAII |ApoI NlaIII BfiI L K W A W R G E F F P S K M D E Y N M I * N G L G E E N S F P V R W M S I T * S K M G L E R R I L S Q * D G * V * H D Q ----:----|----:----|----:----|----:----|----:----|----:----| N F H A Q L P S N K G L L I S S Y L M I T L I P K S L L I R E W Y S P H T Y C S * F P S P S S F E K G T L H I L I V H D Cac8I | CviRI* | | BsmAI \ \ \ AAGCGTGCATTACAAAATGAGACTTTTCCCAACAAAAACAAGTTTTCTAAAAAGAAAGTT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGCACGTAATGTTTTACTCTGAAAAGGGTTGTTTTTGTTCAAAAGATTTTTCTTTCAA / / / | CviRI* BsmAI Cac8I K R A L Q N E T F P N K N K F S K K K V S V H Y K M R L F P T K T S F L K R K F A C I T K * D F S Q Q K Q V F * K E S F ----:----|----:----|----:----|----:----|----:----|----:----| L R A N C F S V K G L L F L N E L F F T * A H M V F H S K E W C F C T K * F S L L T C * L I L S K G V F V L K R F L F N AclI MaeII | SetI DdeI | TaiI | MaeIII TspDTI | |MseI \ \ \ \ \\ TTGACATTTGATGAACTAAGTTACGCAGACCAAGTTATCCACATAAAAAAACGTTTAACT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGTAAACTACTTGATTCAATGCGTCTGGTTCAATAGGTGTATTTTTTTGCAAATTGA / / / / / DdeI TspDTI | | MseI MaeIII | MaeII | AclI TaiI SetI L T F D E L S Y A D Q V I H I K K R L T * H L M N * V T Q T K L S T * K N V * L D I * * T K L R R P S Y P H K K T F N * ----:----|----:----|----:----|----:----|----:----|----:----| K V N S S S L * A S W T I W M F F R K V K S M Q H V L N R L G L * G C L F V N L Q C K I F * T V C V L N D V Y F F T * S Hpy188I SspI MseI | TspEI TaqI CviJI \ \ \ \ \ \ GAATATTCAAGGAAAGTTTATCATAGGGTTAAAGTATCAGAAATTGTCGAACGAGAAGCC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATAAGTTCCTTTCAAATAGTATCCCAATTTCATAGTCTTTAACAGCTTGCTCTTCGG / / / / / / SspI MseI | | TaqI CviJI | TspEI Hpy188I E Y S R K V Y H R V K V S E I V E R E A N I Q G K F I I G L K Y Q K L S N E K P I F K E S L S * G * S I R N C R T R S H ----:----|----:----|----:----|----:----|----:----|----:----| S Y E L F T * * L T L T D S I T S R S A Q I N L S L K D Y P * L I L F Q R V L L F I * P F N I M P N F Y * F N D F S F G MaeII | TaqI | SetI | TaiI | | Hpy99I | | | Tsp4CI* Hpy178III* \ \ \ \ \ ATTGTCTGCCAAAGAGAAAATCCATTCTACGTCGATACCGTGAAATCCTTTCGTGATAGG 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TAACAGACGGTTTCTCTTTTAGGTAAGATGCAGCTATGGCACTTTAGGAAAGCACTATCC // / / / / || | | Tsp4CI* Hpy178III* || | TaqI || MaeII |Hpy99I TaiI SetI I V C Q R E N P F Y V D T V K S F R D R L S A K E K I H S T S I P * N P F V I G C L P K R K S I L R R Y R E I L S * * A ----:----|----:----|----:----|----:----|----:----|----:----| M T Q W L S F G N * T S V T F D K R S L W Q R G F L F D M R R R Y R S I R E H Y N D A L S F I W E V D I G H F G K T I P SetI MaeIII | CviJI | ApoI | | Hin4II* | TspEI | | | PflMI | EcoRI | | | BsiYI* TsoI TspEI \ \ \ \ \ \ \ \ CGTTACGAATTCAAAGGTTTAGCCAAGACTTGGAAGGGAAATCTGTCCAAAATTGACCCA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| GCAATGCTTAAGTTTCCAAATCGGTTCTGAACCTTCCCTTTAGACAGGTTTTAACTGGGT / / / / / / / | | SetI | Hin4II* TsoI TspEI | EcoRI | BsiYI* | TspEI | PflMI | ApoI CviJI MaeIII R Y E F K G L A K T W K G N L S K I D P V T N S K V * P R L G R E I C P K L T H L R I Q R F S Q D L E G K S V Q N * P I ----:----|----:----|----:----|----:----|----:----|----:----| R * S N L P K A L V Q F P F R D L I S G A N R I * L N L W S K S P F D T W F Q G T V F E F T * G L S P L S I Q G F N V W Hpy188I | BccI | | FatI | | |CviAII | | ||Esp3I | | ||BsmAI | | ||Cac8I | | ||| SphI | | ||| NspI | | ||| NlaIII CviJI MlyI | | ||| | MnlI HaeIII PleI HinfI TspEI \ \ \\\ \ \ \ \ \ \ TCTGATAAGCATGCGAGAGACGAGGCCAAAAAGATGATTGTGCTTTATGACTCATTACAA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTATTCGTACGCTCTCTGCTCCGGTTTTTCTACTAACACGAAATACTGAGTAATGTT / / / ///// / // / | | | ||||BsmAI HaeIII |PleI HinfI | | | ||||Esp3I CviJI MlyI | | | |||MnlI | | | ||FatI | | | |CviAII | | | Cac8I | | NlaIII | | NspI | | SphI | BccI Hpy188I S D K H A R D E A K K M I V L Y D S L Q L I S M R E T R P K R * L C F M T H Y N * * A C E R R G Q K D D C A L * L I T I ----:----|----:----|----:----|----:----|----:----|----:----| D S L C A L S S A L F I I T S * S E N C M Q Y A H S L R P W F S S Q A K H S M V R I L M R S V L G F L H N H K I V * * L AluI ApoI CviJI TspEI | SetI EcoRI MnlI CviJI \ \ \ \ \ TTAGCTCACAAAGTTATTTTGAATTCGTTTTATGGGTATGTTATGAGGAAAGGCTCTCGT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| AATCGAGTGTTTCAATAAAACTTAAGCAAAATACCCATACAATACTCCTTTCCGAGAGCA / / / / / | CviJI EcoRI MnlI CviJI | AluI TspEI TspEI ApoI SetI L A H K V I L N S F Y G Y V M R K G S R * L T K L F * I R F M G M L * G K A L V S S Q S Y F E F V L W V C Y E E R L S L ----:----|----:----|----:----|----:----|----:----|----:----| N A * L T I K F E N * P Y T I L F P E R I L E C L * K S N T K H T H * S S L S E * S V F N N Q I R K I P I N H P F A R T FatI NcoI StyI SecI* DsaI* HgiCI* |CviAII MaeII | SetI || FauI AflIII | NlaIV || NlaIII |BsaAI | | MboI || |MslI || SetI | | | DpnI || || BstXI || TaiI | | | |BstKTI || || | AciI || | MseI | | | || MslI \\ \\ \ \ \\ \ \ \ \ \ \\ \ TGGTATTCCATGGAAATGGCGGGGATTACGTGTTTAACAGGTGCCACGATCATTCAAATG 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| ACCATAAGGTACCTTTACCGCCCCTAATGCACAAATTGTCCACGGTGCTAGTAAGTTTAC / //// / / // / / / / / // / / | |||FauI AciI | || | | | | | || | MslI | ||MslI | || | | | | | || MboI | |DsaI* | || | | | | | |DpnI | |SecI* | || | | | | | BstKTI | |StyI | || | | | | HgiCI* | |NcoI | || | | | NlaIV | |FatI | || | | SetI | CviAII | || | MseI | BstXI | || AflIII NlaIII | |MaeII | BsaAI TaiI SetI W Y S M E M A G I T C L T G A T I I Q M G I P W K W R G L R V * Q V P R S F K W V F H G N G G D Y V F N R C H D H S N G ----:----|----:----|----:----|----:----|----:----|----:----| Q Y E M S I A P I V H K V P A V I M * I N T N W P F P P S * T N L L H W S * E F P I G H F H R P N R T * C T G R D N L H BbvII* AluI | TspEI CviJI | |MboII | SetI | || BccI \ \ \ \\ \ GCGAGAGCTTTAGTAGAAAGGGTAGGAAGACCATTAGAATTAGATACTGATGGTATTTGG 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| CGCTCTCGAAATCATCTTTCCCATCCTTCTGGTAATCTTAATCTATGACTACCATAAACC / / / / / | CviJI | | BccI | AluI | TspEI SetI BbvII* MboII A R A L V E R V G R P L E L D T D G I W R E L * * K G * E D H * N * I L M V F G E S F S R K G R K T I R I R Y * W Y L V ----:----|----:----|----:----|----:----|----:----|----:----| A L A K T S L T P L G N S N S V S P I Q P S L K L L F P L F V M L I L Y Q H Y K R S S * Y F P Y S S W * F * I S I T N P HindIII | AluI | CviJI \ \ TGTATCTTACCAAAATCTTTCCCTGAAACTTACTTTTTTACATTAGAAAATGGTAAAAAG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| ACATAGAATGGTTTTAGAAAGGGACTTTGAATGAAAAAATGTAATCTTTTACCATTTTTC / / | CviJI | AluI SetI C I L P K S F P E T Y F F T L E N G K K V S Y Q N L S L K L T F L H * K M V K S Y L T K I F P * N L L F Y I R K W * K A ----:----|----:----|----:----|----:----|----:----|----:----| H I K G F D K G S V * K K V N S F P L F T Y R V L I K G Q F K S K * M L F H Y F T D * W F R E R F S V K K C * F I T F L FatI |CviAII || NlaIII || | FatI || | |CviAII HphI || | || NlaIII |Hpy166II || | || | TspEI || TfiI SetI || | || | | HphI Hpy166II || HinfI \ \\ \ \\ \ \ \ \ \\ \ CTTTATCTCTCCTACCCATGTTCCATGCTGAATTACAGAGTTCACCAAAAGTTTACGAAT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| GAAATAGAGAGGATGGGTACAAGGTACGACTTAATGTCTCAAGTGGTTTTCAAATGCTTA / / // / // // / / / / HindIII | || | |FatI |TspEI Hpy166II | | HinfI | || | CviAII HphI | | TfiI | || NlaIII | Hpy166II | |FatI HphI | CviAII NlaIII L Y L S Y P C S M L N Y R V H Q K F T N F I S P T H V P C * I T E F T K S L R I L S L L P M F H A E L Q S S P K V Y E S ----:----|----:----|----:----|----:----|----:----|----:----| S * R E * G H E M S F * L T * W F N V F A K D R R G M N W A S N C L E G F T * S K I E G V W T G H Q I V S N V L L K R I Tsp4CI* TspEI Esp3I | HgaI | MseI BsmAI | | TspRI \ \ \ \ \ \ CACCAATACCAAGAATTAAAAGACCCATTGAACTATATATATGAGACGCACAGTGAAAAC 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGTTATGGTTCTTAATTTTCTGGGTAACTTGATATATATACTCTGCGTGTCACTTTTG // / / / / |MseI BsmAI | Tsp4CI* HgaI TspEI Esp3I TspRI H Q Y Q E L K D P L N Y I Y E T H S E N T N T K N * K T H * T I Y M R R T V K T P I P R I K R P I E L Y I * D A Q * K H ----:----|----:----|----:----|----:----|----:----|----:----| * W Y W S N F S G N F * I Y S V C L S F D G I G L I L L G M S S Y I H S A C H F V L V L F * F V W Q V I Y I L R V T F V CviJI HindII HaeIII Hpy166II |FatI | AsuI* |TspGWI StyI TaqI | AvaII ||CviAII SecI* AsuII | |BmgT120I ||| NlaIII MaeI | Hin4II* \ \ \\ \\\ \ \ \ \ ACGATTTTTTTCGAAGTTGACGGACCATATAAGGCCATGATTTTGCCTAGTTCCAAGGAA 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTAAAAAAAGCTTCAACTGCCTGGTATATTCCGGTACTAAAACGGATCAAGGTTCCTT / / // /// // / / / | | |AvaII ||| |FatI MaeI | SecI* | | |AsuI* ||| CviAII | StyI | | BmgT120I ||NlaIII Hin4II* | Hpy166II |HaeIII | HindII |CviJI AsuII TspGWI TaqI T I F F E V D G P Y K A M I L P S S K E R F F S K L T D H I R P * F C L V P R K D F F R S * R T I * G H D F A * F Q G R ----:----|----:----|----:----|----:----|----:----|----:----| V I K K S T S P G Y L A M I K G L E L S C S K K R L Q R V M Y P W S K A * N W P R N K E F N V S W I L G H N Q R T G L F Hin4I Hin4I MboII |CviJI | SetI |BbvII* | | Hin4I MboII || MboII | | Hin4I BbvII* || |TspDTI BceAI \ \ \ \ \\ \\ \ GAAGGAAAAGGTATAAAGAAAAGATATGCTGTCTTCAATGAAGACGGCTCACTTGCTGAA 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCCTTTTCCATATTTCTTTTCTATACGACAGAAGTTACTTCTGCCGAGTGAACGACTT // / / / / / |MboII | BbvII* Hin4I | TspDTI |Hin4I MboII Hin4I | BbvII* |Hin4I | MboII SetI CviJI E G K G I K K R Y A V F N E D G S L A E K E K V * R K D M L S S M K T A H L L N R K R Y K E K I C C L Q * R R L T C * T ----:----|----:----|----:----|----:----|----:----|----:----| S P F P I F F L Y A T K L S S P E S A S L L F L Y L S F I H Q R * H L R S V Q Q F S F T Y L F S I S D E I F V A * K S F SetI | TspEI | Ksp632I* MboII ApoI | |MnlI |TspEI HphI TspEI \ \\ \\ \ \ CTGAAAGGTTTTGAATTGAAGAGGCGTGGTGAATTACAACTAATAAAAAATTTTCAAAGT 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| GACTTTCCAAAACTTAACTTCTCCGCACCACTTAATGTTGATTATTTTTTAAAAGTTTCA / / / // / / / / | SetI | |TspEI MboII | HphI TspEI BceAI | Ksp632I* TspEI ApoI MnlI L K G F E L K R R G E L Q L I K N F Q S * K V L N * R G V V N Y N * * K I F K V E R F * I E E A W * I T T N K K F S K * ----:----|----:----|----:----|----:----|----:----|----:----| S F P K S N F L R P S N C S I F F K * L V S L N Q I S S A H H I V V L L F N E F Q F T K F Q L P T T F * L * Y F I K L T MaeIII | BseGI | | Tsp4CI* SetI | | | FokI SetI | Hin4II* | | | SfeI* | Hin4II* | | HphI | | | |TspRI Cac8I \ \ \ \ \ \ \ \ \\ \ GATATTTTCAAGGTCTTTTTGGAAGGTGATACATTAGAAGGATGTTACAGTGCTGTAGCA 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAAAAGTTCCAGAAAAACCTTCCACTATGTAATCTTCCTACAATGTCACGACATCGT / / / / / // / / / SetI Hin4II* SetI | HphI || Tsp4CI* | Cac8I Hin4II* || MaeIII SfeI* |TspRI FokI BseGI D I F K V F L E G D T L E G C Y S A V A I F S R S F W K V I H * K D V T V L * Q Y F Q G L F G R * Y I R R M L Q C C S K ----:----|----:----|----:----|----:----|----:----|----:----| S I K L T K K S P S V N S P H * L A T A H Y K * P R K P L H Y M L L I N C H Q L I N E L D K Q F T I C * F S T V T S Y C Hpy178III* | TfiI | HinfI TsoI | | FatI |MaeIII | | |CviAII || Tsp4CI* | | || NlaIII \\ \ \ \ \\ \ AGCGTATGTAACCGTTGGTTAGATGTTCTTGATTCACATGGTCTTATGTTAGAAGATGAA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCATACATTGGCAACCAATCTACAAGAACTAAGTGTACCAGAATACAATCTTCTACTT / / / / / // TsoI Tsp4CI* | | | |FatI MaeIII | | | CviAII | | NlaIII | HinfI | TfiI Hpy178III* S V C N R W L D V L D S H G L M L E D E A Y V T V G * M F L I H M V L C * K M K R M * P L V R C S * F T W S Y V R R * R ----:----|----:----|----:----|----:----|----:----|----:----| L T H L R Q N S T R S E C P R I N S S S L R I Y G N T L H E Q N V H D * T L L H A Y T V T P * I N K I * M T K H * F I F MboII Tth111I |BbvII* MseI || MboII |AhaIII* || |TspDTI || Hin4II* \\ \\ \\ \ GACTTGGTCAGTTTGATTTGTGAAAATAGAAGTATGTCAAAAACTTTAAAGGAATATGAA 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAACCAGTCAAACTAAACACTTTTATCTTCATACAGTTTTTGAAATTTCCTTATACTT / / / // / | | TspDTI || Hin4II* | | BbvII* |MseI | | MboII AhaIII* | Tth111I MboII D L V S L I C E N R S M S K T L K E Y E T W S V * F V K I E V C Q K L * R N M K L G Q F D L * K * K Y V K N F K G I * R ----:----|----:----|----:----|----:----|----:----|----:----| S K T L K I Q S F L L I D F V K F S Y S L S P * N S K H F Y F Y T L F K L P I H V Q D T Q N T F I S T H * F S * L F I F TaqII TspDTI Hpy99I |BceAI \ \ \\ GGGCAAAAATCTACTTCTATTACGACGGCAAGGAGATTGGGGGATTTTTTGGGTGAAGAT 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CCCGTTTTTAGATGAAGATAATGCTGCCGTTCCTCTAACCCCCTAAAAAACCCACTTCTA / / / / TspDTI Hpy99I | BceAI TaqII G Q K S T S I T T A R R L G D F L G E D G K N L L L L R R Q G D W G I F W V K I A K I Y F Y Y D G K E I G G F F G * R Y ----:----|----:----|----:----|----:----|----:----|----:----| P C F D V E I V V A L L N P S K K P S S L A F I * K * * S P L S I P P N K P H L P L F R S R N R R C P S Q P I K Q T F I AccI HphI SetI | MboII |Hpy166II SetI CviRI* \ \ \\ \ \ ATGGTAAAAGATAAAGGTCTACAATGTAAATATATTATTAGTTCAAAACCTTTCAATGCA 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| TACCATTTTCTATTTCCAGATGTTACATTTATATAATAATCAAGTTTTGGAAAGTTACGT / / / // / // | MboII SetI |AccI SetI |SetI HphI Hpy166II CviRI* M V K D K G L Q C K Y I I S S K P F N A W * K I K V Y N V N I L L V Q N L S M H G K R * R S T M * I Y Y * F K T F Q C T ----:----|----:----|----:----|----:----|----:----|----:----| I T F S L P R C H L Y I I L E F G K L A Y P L L Y L D V I Y I Y * * N L V K * H H Y F I F T * L T F I N N T * F R E I C BsiYI* | BccI SetI AciI | BseMII MaeIII CviJI BsrI SspI NspBII* | |BspCNI \ \ \ \ \ \ \\ CCTGTTACTGAACGAGCCATTCCAGTCGCAATATTTTCAGCGGACATTCCCATCAAAAGG 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| GGACAATGACTTGCTCGGTAAGGTCAGCGTTATAAAAGTCGCCTGTAAGGGTAGTTTTCC / / / / / / / // / MaeIII | BsrI SspI | AciI | || BccI CviJI NspBII* | |BspCNI | |SetI | BseMII BsiYI* P V T E R A I P V A I F S A D I P I K R L L L N E P F Q S Q Y F Q R T F P S K G C Y * T S H S S R N I F S G H S H Q K V ----:----|----:----|----:----|----:----|----:----|----:----| G T V S R A M G T A I N E A S M G M L L V Q * Q V L W E L R L I K L P C E W * F R N S F S G N W D C Y K * R V N G D F P BccI | MboI | BglII | XhoII | | DpnI | | Hin4I BinI* | | Hin4I DdeI | MboI | | |BstKTI |BccI | XhoII | | ||Hpy178III* |Hpy188I | | DpnI | | ||| EcoRV SetI ||Hin4I | | |BtgZI | | ||| |MboII |MnlI ||Hin4I | | |BstKTI | | ||| || Hpy188I \\ \\\ \ \ \\ \ \ \\\ \\ \ TCTTTTCTGAGGCGATGGACATTAGATCCATCTTTGGAAGATCTGGATATCAGAACCATA 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAAAGACTCCGCTACCTGTAATCTAGGTAGAAACCTTCTAGACCTATAGTCTTGGTAT / / / // / // / / // // / / / / | | | |DdeI | || | | || || | | | Hpy188I | | | BccI | || | | || || | | MboII | | Hpy188I | || | | || || | | EcoRV | Hin4I | || | | || || | Hpy178III* | Hin4I | || | | || || XhoII MnlI | || | | || || BglII | || | | || || MboI | || | | || |DpnI | || | | || BstKTI | || | | |BccI | || | | Hin4I | || | | Hin4I | || | BtgZI | || XhoII | || MboI | |DpnI | BstKTI BinI* S F L R R W T L D P S L E D L D I R T I L F * G D G H * I H L W K I W I S E P * F S E A M D I R S I F G R S G Y Q N H N ----:----|----:----|----:----|----:----|----:----|----:----| D K R L R H V N S G D K S S R S I L V M T K E S A I S M L D M K P L D P Y * F W R K Q P S P C * I W R Q F I Q I D S G Y MboI XhoII | DpnI TaqI | |BstKTI ClaI | || BinI* TspEI \ \ \\ \ \ ATCGATTGGGGTTATTATAGAGAAAGACTTGGATCTGCTATACAAAAGATAATTACTATT 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTAACCCCAATAATATCTCTTTCTGAACCTAGACGATATGTTTTCTATTAATGATAA / // / / / ClaI || | BinI* TspEI TaqI || XhoII || MboI |DpnI BstKTI I D W G Y Y R E R L G S A I Q K I I T I S I G V I I E K D L D L L Y K R * L L F R L G L L * R K T W I C Y T K D N Y Y S ----:----|----:----|----:----|----:----|----:----|----:----| I S Q P * * L S L S P D A I C F I I V I L R N P N N Y L F V Q I Q * V F S L * * D I P T I I S F S K S R S Y L L Y N S N FokI TsoI TseI EcoP15I BseGI |BisI | StyI | Hpy178III* ||BlsI BbvI | SecI* | | CviJI \\\ \ \ \ \ \ \ CCAGCAGCATTACAAGGGGTTTCCAATCCTGTTCCAAGGGTTGAACATCCAGATTGGCTA 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCGTCGTAATGTTCCCCAAAGGTTAGGACAAGGTTCCCAACTTGTAGGTCTAACCGAT /// / / / / / / / ||TseI BbvI | | | BseGI | CviJI |BisI | | | TsoI Hpy178III* BlsI | | SecI* | | StyI | FokI EcoP15I P A A L Q G V S N P V P R V E H P D W L Q Q H Y K G F P I L F Q G L N I Q I G * S S I T R G F Q S C S K G * T S R L A K ----:----|----:----|----:----|----:----|----:----|----:----| G A A N C P T E L G T G L T S C G S Q S E L L M V L P K W D Q E L P Q V D L N A W C C * L P N G I R N W P N F M W I P * BsaXI ApoI | MnlI MseI BsaXI TspEI \ \ \ \ \ AAAAGAAAAATCGCTACAAAGGAGGATAAGTTTAAGCAGACTTCACTAACCAAATTTTTT 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCTTTTTAGCGATGTTTCCTCCTATTCAAATTCGTCTGAAGTGATTGGTTTAAAAAA / / / / / | MnlI MseI BsaXI TspEI BsaXI ApoI K R K I A T K E D K F K Q T S L T K F F K E K S L Q R R I S L S R L H * P N F F K K N R Y K G G * V * A D F T N Q I F F ----:----|----:----|----:----|----:----|----:----|----:----| F L F I A V F S S L N L C V E S V L N K L F F F R * L P P Y T * A S K V L W I K F S F D S C L L I L K L L S * * G F K K BbvII* TaqI | MboII MnlI AsuII | |Csp6I | EcoRV | TsoI | ||RsaI BsiYI* | | TaqI \ \ \ \\\ \ \ \ \ TCGAAGACAAAGAATGTACCAACAATGGGCAAGATAAAAGATATCGAGGATTTGTTTGAA 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTTCTGTTTCTTACATGGTTGTTACCCGTTCTATTTTCTATAGCTCCTAAACAAACTT / / / // / / / / | AsuII | || BsiYI* | | TaqI | TaqI | |Csp6I | EcoRV TsoI | RsaI MnlI BbvII* MboII S K T K N V P T M G K I K D I E D L F E R R Q R M Y Q Q W A R * K I S R I C L N E D K E C T N N G Q D K R Y R G F V * T ----:----|----:----|----:----|----:----|----:----|----:----| E F V F F T G V I P L I F S I S S K N S K S S L S H V L L P C S L L Y R P N T Q R L C L I Y W C H A L Y F I D L I Q K F MboII | MboII | |TspEI | || MseI | || | TspEI SfeI* | || | | CviRI* |Tsp4CI* | || | | | BceAI CviJI \\ \ \\ \ \ \ \ \ CCAACTGTAGAAGAAGATAACGCCAAAATTAAAATTGCAAGAACTACTAAAAAGAAAGCC 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTGACATCTTCTTCTATTGCGGTTTTAATTTTAACGTTCTTGATGATTTTTCTTTCGG / / / / // // / / | SfeI* | MboII |MseI |CviRI* BceAI CviJI Tsp4CI* MboII TspEI TspEI P T V E E D N A K I K I A R T T K K K A Q L * K K I T P K L K L Q E L L K R K P N C R R R * R Q N * N C K N Y * K E S R ----:----|----:----|----:----|----:----|----:----|----:----| G V T S S S L A L I L I A L V V L F F A V L Q L L L Y R W F * F Q L F * * F S L W S Y F F I V G F N F N C S S S F L F G CspCI | BinI* | | MboI | | XhoII | | | DpnI | | | |BstKTI | | | || SpeI | | | || |MaeI AluI | | | || |MboII CviJI | | | || ||TspDTI SecI* MnlI BciVI | SetI | | | || ||| MboII | Hpy188I \ \ \ \ \ \ \ \\ \\\ \ \ \ GTATCCAAGAGGAAAAGAAATCAGCTTACAAATGAAGAAGATCCACTAGTATTGCCCTCG 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| CATAGGTTCTCCTTTTCTTTAGTCGAATGTTTACTTCTTCTAGGTGATCATAACGGGAGC / / / / / / // / / // // MnlI BciVI | CviJI | | || | | |SpeI |SecI* | AluI | | || | | MboII Hpy188I SetI | | || | | MaeI | | || | TspDTI | | || | MboII | | || XhoII | | || MboI | | |DpnI | | BstKTI | BinI* CspCI V S K R K R N Q L T N E E D P L V L P S Y P R G K E I S L Q M K K I H * Y C P R I Q E E K K S A Y K * R R S T S I A L G ----:----|----:----|----:----|----:----|----:----|----:----| T D L L F L F * S V F S S S G S T N G E R I W S S F F D A * L H L L D V L I A R Y G L P F S I L K C I F F I W * Y Q G R TfiI HinfI | MnlI | |CspCI | || FatI | || NcoI | || StyI | || SecI* | || DsaI* | || |MnlI | || |CviAII | || || NlaIII | || || | Hin4II* | || || | | TaqII CviJI TspEI | || || | | | TsoI | TspEI | MseI \ \\ \\ \ \ \ \ \ \ \ \ GAGATTCCTTCCATGGACGAGGACTATGTTGGGTGGCTAAATTATCAAAAAATTAAATGG 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTAAGGAAGGTACCTGCTCCTGATACAACCCACCGATTTAATAGTTTTTTAATTTACC // / /// / / / / // || | ||| | TsoI CviJI TspEI |MseI || | ||| TaqII TspEI || | ||Hin4II* || | |DsaI* || | |SecI* || | |StyI || | |NcoI || | |FatI || | CviAII || NlaIII || MnlI |HinfI |TfiI CspCI MnlI E I P S M D E D Y V G W L N Y Q K I K W R F L P W T R T M L G G * I I K K L N G D S F H G R G L C W V A K L S K N * M E ----:----|----:----|----:----|----:----|----:----|----:----| S I G E M S S S * T P H S F * * F I L H P S E K W P R P S H Q T A L N D F F * I L N R G H V L V I N P P * I I L F N F P BsmAI Eco31I | TaqI | |Hpy178III* AluI | ||Hpy99I CviJI HgaI | ||| TspEI BstXI | SetI \ \ \\\ \ \ \ \ AAAATCCAAGCAAGAGATAGAAAGCGTCGAGACCAATTATTTGGTAATACAAACAGCTCC 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAGGTTCGTTCTCTATCTTTCGCAGCTCTGGTTAATAAACCATTATGTTTGTCGAGG / / / // / / / / HgaI | | || | TspEI | CviJI | | || BstXI | AluI | | |Hpy178III* SetI | | TaqI | Eco31I | BsmAI Hpy99I K I Q A R D R K R R D Q L F G N T N S S K S K Q E I E S V E T N Y L V I Q T A P N P S K R * K A S R P I I W * Y K Q L P ----:----|----:----|----:----|----:----|----:----|----:----| F I W A L S L F R R S W N N P L V F L E S F G L L L Y F A D L G I I Q Y Y L C S F D L C S I S L T S V L * K T I C V A G ApaLI Cac8I | CviRI* | AluI | Hpy166II | CviJI | | SduI | | SetI | | BseSI | | |TfiI | | HgiAI* | | |HinfI | | |MaeI | | || NdeI MnlI \ \ \\ \ \ \\ \ \ CGTGAAAGAAGTGCACTAGGAAGTATGATTAGGAAGCAAGCTGAATCATATGCGAACTCC 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| GCACTTTCTTCACGTGATCCTTCATACTAATCCTTCGTTCGACTTAGTATACGCTTGAGG / / / / / / / / / | | | MaeI | CviJI | NdeI MnlI | | ApaLI | AluI HinfI | Hpy166II Cac8I TfiI | CviRI* SetI HgiAI* BseSI SduI R E R S A L G S M I R K Q A E S Y A N S V K E V H * E V * L G S K L N H M R T P * K K C T R K Y D * E A S * I I C E L H ----:----|----:----|----:----|----:----|----:----|----:----| R S L L A S P L I I L F C A S D Y A F E G H F F H V L F Y S * S A L Q I M H S S T F S T C * S T H N P L L S F * I R V G BssKI CviJI EcoRII TfiI |SecI* HinfI ||ScrFI | BetI* ||BseBI SetI | |HpaII ||| HphI MaeIII \ \ \\ \\\ \ \ ACTTGGGAGGTCTTACAATACAAGGATTCCGGTGAGCCAGGGGTTTTGGAAGTATTTGTA 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| TGAACCCTCCAGAATGTTATGTTCCTAAGGCCACTCGGTCCCCAAAACCTTCATAAACAT / / // / / // SetI | || | | |HphI | || | | EcoRII | || | | BssKI | || | | SecI* | || | BseBI | || | ScrFI | || CviJI | |BetI* | HpaII HinfI TfiI T W E V L Q Y K D S G E P G V L E V F V L G R S Y N T R I P V S Q G F W K Y L * L G G L T I Q G F R * A R G F G S I C N ----:----|----:----|----:----|----:----|----:----|----:----| V Q S T K C Y L S E P S G P T K S T N T W K P P R V I C P N R H A L P K P L I Q S P L D * L V L I G T L W P N Q F Y K Y TspEI | MseI HphI ApoI | VspI Hpy178III* SetI Hin4II* TspEI \ \ \ \ \ \ ACAATTAATGGCAAAGTCCAGAACATCACCTTCCATATACCAAAAACTATTTATATGAAA 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTAATTACCGTTTCAGGTCTTGTAGTGGAAGGTATATGGTTTTTGATAAATATACTTT / // / / / / | |VspI | | SetI Hin4II* | |MseI | Hpy178III* | TspEI HphI MaeIII T I N G K V Q N I T F H I P K T I Y M K Q L M A K S R T S P S I Y Q K L F I * N N * W Q S P E H H L P Y T K N Y L Y E I ----:----|----:----|----:----|----:----|----:----|----:----| V I L P L T W F M V K W I G F V I * I F L L * H C L G S C * R G Y V L F * K Y S C N I A F D L V D G E M Y W F S N I H F AciI BisI |BlsI MseI TspDTI ||TauI | TspEI MboII \ \\\ \ \ \ TTCAAATCTCAAACAATGCCGCTACAAAAGATTAAGAATTGCCTTATTGAAAAATCTTCT 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTTAGAGTTTGTTACGGCGATGTTTTCTAATTCTTAACGGAATAACTTTTTAGAAGA / / //// / / / TspEI TspDTI |||AciI MseI TspEI MboII ApoI ||BisI |BlsI TauI F K S Q T M P L Q K I K N C L I E K S S S N L K Q C R Y K R L R I A L L K N L L Q I S N N A A T K D * E L P Y * K I F C ----:----|----:----|----:----|----:----|----:----|----:----| N L D * V I G S C F I L F Q R I S F D E I * I E F L A A V F S * S N G * Q F I K E F R L C H R * L L N L I A K N F F R R CviRI* MaeII Cac8I AluI | MaeIII | SetI |BsiYI* CviJI | | SfaNI | TaiI ||AciI | SetI TspEI \ \ \ \ \ \\\ \ \ \ GCATCGTTACCAAATAATCCCAAAACGTCTAATCCAGCAGGCGGTCAGCTATTCAAAATT 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAGCAATGGTTTATTAGGGTTTTGCAGATTAGGTCGTCCGCCAGTCGATAAGTTTTAA / / / / / / / / / / / CviRI* | SfaNI | MaeII | | | | CviJI TspEI MaeIII TaiI | | | | AluI SetI | | | SetI | | AciI | Cac8I BsiYI* A S L P N N P K T S N P A G G Q L F K I H R Y Q I I P K R L I Q Q A V S Y S K L I V T K * S Q N V * S S R R S A I Q N Y ----:----|----:----|----:----|----:----|----:----|----:----| A D N G F L G L V D L G A P P * S N L I Q M T V L Y D W F T * D L L R D A I * F C R * W I I G F R R I W C A T L * E F N EcoP15I MboII |BetI* | CviRI* ||HpaII | |MboII ||| TfiI Hpy178III* | ||SpeI ||| HinfI | BsgI | |||MaeI AjuI \\\ \ \ \ \ \\\\ \ ACTCTACCGGAATCTGTCTTTCTGGAAGAAAAGGAAAACTGCACTAGTATCTTCAACGAT 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGATGGCCTTAGACAGAAAGACCTTCTTTTCCTTTTGACGTGATCATAGAAGTTGCTA / // / / / / / /// | || HinfI | Hpy178III* | | ||AjuI | || TfiI BsgI | | |SpeI | |BetI* | | MaeI | HpaII | CviRI* EcoP15I | MboII MboII T L P E S V F L E E K E N C T S I F N D L Y R N L S F W K K R K T A L V S S T M S T G I C L S G R K G K L H * Y L Q R * ----:----|----:----|----:----|----:----|----:----|----:----| V R G S D T K R S S F S F Q V L I K L S * E V P I Q R E P L F P F S C * Y R * R S * R F R D K Q F F L F V A S T D E V I MnlI |BsaXI || MboI || TstI || | DpnI || | |FatI TspDTI AjuI || | |BstKTI TatI |MnlI |BseRI || | ||CviAII |Csp6I || TstI || SduI || | ||| BsaXI ||RsaI || BsaXI || BseSI || | ||| |NlaIII \\\ \\ \ \\ \ \\ \ \\\ \\ GAAAATGTACTTGGTGTATTTGAGGGCACTATCACTCCTCATCAAAGAGCGATCATGGAT 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTACATGAACCACATAAACTCCCGTGATAGTGAGGAGTAGTTTCTCGCTAGTACCTA /// //// / / // //// // ||| |||| | BseSI |MnlI |||| |FatI ||| |||| | BseRI BsaXI |||| CviAII ||| |||| | SduI TstI |||MboI ||| |||| AjuI ||NlaIII ||| |||BsaXI ||BsaXI ||| ||MnlI |DpnI ||| |TstI BstKTI ||| TspDTI ||TatI |Csp6I RsaI E N V L G V F E G T I T P H Q R A I M D K M Y L V Y L R A L S L L I K E R S W I K C T W C I * G H Y H S S S K S D H G F ----:----|----:----|----:----|----:----|----:----|----:----| S F T S P T N S P V I V G * * L A I M S H F H V Q H I Q P C * * E E D F L S * P F I Y K T Y K L A S D S R M L S R D H I AluI CviJI | SetI | | MaeIII | | | AclI | | | MaeII | | | | SetI | | | | TaiI | | | | | AciI | | | | | | BsrBI MwoI | | | | | | | TaqII BstAPI | | | | | | | |BsaXI |BsrDI \ \ \ \ \ \ \ \\ \\ TTGGGAGCTTCGGTAACGTTCCGCTCAAAAGCAATGGGTGCGTTAGGCAAGGGAATACAG 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCTCGAAGCCATTGCAAGGCGAGTTTTCGTTACCCACGCAATCCGTTCCCTTATGTC / / / // / / / | CviJI | || BsaXI | BsrDI | AluI | || BsrBI BstAPI SetI | || TaqII MwoI | || AciI | |MaeII | |AclI | MaeIII TaiI SetI L G A S V T F R S K A M G A L G K G I Q W E L R * R S A Q K Q W V R * A R E Y S G S F G N V P L K S N G C V R Q G N T A ----:----|----:----|----:----|----:----|----:----|----:----| K P A E T V N R E F A I P A N P L P I C N P L K P L T G S L L L P H T L C P F V Q S S R Y R E A * F C H T R * A L S Y L MboI XhoII BseMII | DpnI |BspCNI | |BstKTI || SetI | || BinI* || EciI | || | TspDTI || | DdeI | || | EcoP15I || | |Hpy188I Hin4II* | || | | AciI || | || TspDTI \ \ \\ \ \ \ \\ \ \\ \ CAGGGTTTTGAAATGAAGGATCTTTCAATGGCGGAAAATGAAAGGTATCTGAGTGGATTT 4390 4400 4410 4420 4430 4440 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCCAAAACTTTACTTCCTAGAAAGTTACCGCCTTTTACTTTCCATAGACTCACCTAAA / // / // / / // / / / // / Hin4II* || | || | AciI || | EciI | |DdeI TsoI || | || EcoP15I || SetI | TspDTI || | |BinI* |BspCNI Hpy188I || | TspDTI BseMII || XhoII || MboI |DpnI BstKTI Q G F E M K D L S M A E N E R Y L S G F R V L K * R I F Q W R K M K G I * V D F G F * N E G S F N G G K * K V S E W I F ----:----|----:----|----:----|----:----|----:----|----:----| C P K S I F S R E I A S F S L Y R L P N A P N Q F S P D K L P P F H F T D S H I L T K F H L I K * H R F I F P I Q T S K TspDTI MfeI | ApoI TsoI CviJI TspEI | TspEI \ \ \ \ \ TCAATGGACATTGGCTATTTACTACATTTCCCAACATCAATTGGGTATGAATTTTTTTCA 4450 4460 4470 4480 4490 4500 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTACCTGTAACCGATAAATGATGTAAAGGGTTGTAGTTAACCCATACTTAAAAAAAGT / / / / / CviJI | TspDTI TspEI TspDTI TspEI ApoI MfeI S M D I G Y L L H F P T S I G Y E F F S Q W T L A I Y Y I S Q H Q L G M N F F H N G H W L F T T F P N I N W V * I F F I ----:----|----:----|----:----|----:----|----:----|----:----| E I S M P * K S C K G V D I P Y S N K E K L P C Q S N V V N G L M L Q T H I K K * H V N A I * * M E W C * N P I F K K * BssKI EcoRII |BccI ||ScrFI ||BseBI ||| CviJI FatI ||| |DdeI |CviAII ||| |Bpu10I TspDTI || NlaIII FokI BseGI ||| ||BsiYI* \ \\ \ \ \ \\\ \\\ TTATTCAAGTCATGGGGAGATACTATTACTATATTAGTTTTGAAACCATCCAACCAGGCT 4510 4520 4530 4540 4550 4560 ----:----|----:----|----:----|----:----|----:----|----:----| AATAAGTTCAGTACCCCTCTATGATAATGATATAATCAAAACTTTGGTAGGTTGGTCCGA / // / / //// | |FatI FokI BseGI |||EcoRII | CviAII |||BssKI NlaIII |||CviJI ||BsiYI* |BseBI |ScrFI BccI L F K S W G D T I T I L V L K P S N Q A Y S S H G E I L L L Y * F * N H P T R L I Q V M G R Y Y Y Y I S F E T I Q P G S ----:----|----:----|----:----|----:----|----:----|----:----| N N L D H P S V I V I N T K F G D L W A M I * T M P L Y * * * I L K S V M W G P * E L * P S I S N S Y * N Q F W G V L S BspCNI |BseMII Hpy178III* ||MmeI MnlI \ \\\ \ CAGGAAATAAATGCCTCATCATTAGGACAAATATACAAACAAATGTTTGAAAAAAAGAAA 4570 4580 4590 4600 4610 4620 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCTTTATTTACGGAGTAGTAATCCTGTTTATATGTTTGTTTACAAACTTTTTTTCTTT // /// / / || ||MmeI MnlI SetI || |BseMII || BspCNI |Hpy178III* Bpu10I DdeI Q E I N A S S L G Q I Y K Q M F E K K K R K * M P H H * D K Y T N K C L K K R K G N K C L I I R T N I Q T N V * K K E R ----:----|----:----|----:----|----:----|----:----|----:----| * S I F A E D N P C I Y L C I N S F F F E P F L H R M M L V F I C V F T Q F F S L F Y I G * * * S L Y V F L H K F F L F EcoRV | TspEI SetI MseI | | MboII \ \ \ \ \ GGTAAAATAGAAACATATTCTTACTTGGTTGATATTAAAGAAGATATCAATTTTGAGTTT 4630 4640 4650 4660 4670 4680 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTTTATCTTTGTATAAGAATGAACCAACTATAATTTCTTCTATAGTTAAAACTCAAA / / // MseI EcoRV |TspEI MboII G K I E T Y S Y L V D I K E D I N F E F V K * K H I L T W L I L K K I S I L S L * N R N I F L L G * Y * R R Y Q F * V C ----:----|----:----|----:----|----:----|----:----|----:----| P L I S V Y E * K T S I L S S I L K S N L Y F L F M N K S P Q Y * L L Y * N Q T T F Y F C I R V Q N I N F F I D I K L K TspEI | TatI | Bsp1407I | |Csp6I BbvII* TspEI EcoRV | ||RsaI | MboII | MseI \ \ \\\ \ \ \ \ GTATATTTTACAGATATCTCAAAATTGTACAGAAGACTATCACAGGAAACTACTAAATTA 4690 4700 4710 4720 4730 4740 ----:----|----:----|----:----|----:----|----:----|----:----| CATATAAAATGTCTATAGAGTTTTAACATGTCTTCTGATAGTGTCCTTTGATGATTTAAT / / /// / // EcoRV | ||Bsp1407I BbvII* |MseI | ||TatI MboII TspEI | |Csp6I | RsaI TspEI V Y F T D I S K L Y R R L S Q E T T K L Y I L Q I S Q N C T E D Y H R K L L N * I F Y R Y L K I V Q K T I T G N Y * I K ----:----|----:----|----:----|----:----|----:----|----:----| T Y K V S I E F N Y L L S D C S V V L N Q I N * L Y R L I T C F V I V P F * * I Y I K C I D * F Q V S S * * L F S S F * SetI DdeI |SfeI* | AluI |MboII | CviJI || CviRI* TspGWI | | SetI MnlI || | PstI MaeIII | | |DdeI \ \\ \ \ \ \ \ \\ AAAGAAGAAAGAGGTCTGCAGTTTTTACTCTTGTTACAATCTCCGTTTATCACTAAGCTC 4750 4760 4770 4780 4790 4800 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTCTTTCTCCAGACGTCAAAAATGAGAACAATGTTAGAGGCAAATAGTGATTCGAG / / // / / / / /// MnlI | || | SfeI* TspGWI MaeIII ||CviJI | || CviRI* ||AluI | |PstI |DdeI | MboII SetI SetI K E E R G L Q F L L L L Q S P F I T K L K K K E V C S F Y S C Y N L R L S L S S R R K R S A V F T L V T I S V Y H * A L ----:----|----:----|----:----|----:----|----:----|----:----| F S S L P R C N K S K N C D G N I V L S L L L F L D A T K V R T V I E T * * * A F F F S T Q L K * E Q * L R R K D S L E MseI | HindIII | | AluI HpaII | | CviJI | CviJI FalI | | | SetI | | SfaNI FalI | | | | BarI MboII XmnI \ \ \ \ \ \ \ \ \ \ \ TTAGGCACAATCCGGCTTCTAAACCAGATGCCCATTGTTAAGCTTTCCTTGAATGAAGTT 4810 4820 4830 4840 4850 4860 ----:----|----:----|----:----|----:----|----:----|----:----| AATCCGTGTTAGGCCGAAGATTTGGTCTACGGGTAACAATTCGAAAGGAACTTACTTCAA / // / / / / / / // DdeI |CviJI | FalI | | | MboII |XmnI HpaII | FalI | | HindIII FalI SfaNI | CviJI FalI | AluI | BarI MseI SetI L G T I R L L N Q M P I V K L S L N E V * A Q S G F * T R C P L L S F P * M K F R H N P A S K P D A H C * A F L E * S S ----:----|----:----|----:----|----:----|----:----|----:----| K P V I R S R F W I G M T L S E K F S T R L C L G A E L G S A W Q * A K R S H L * A C D P K * V L H G N N L K G Q I F N TstI | MseI | |HpaI | |MboII | |HindII | |Hpy166II TspDTI | || MaeII FalI | MfeI BarI | || | SetI FalI | TspEI | BsrI | || | TaiI \ \ \ \ \ \ \\ \ \ CTTCTACCCCAATTGAACTGGCAACCGACATTATTGAAGAAACTTGTTAACCACGTTTTA 4870 4880 4890 4900 4910 4920 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGATGGGGTTAACTTGACCGTTGGCTGTAATAACTTCTTTGAACAATTGGTGCAAAAT / / / / /// / / / TspDTI TspEI BsrI TstI ||| | | TspRI BarI ||| | | BsrI MfeI ||| | MaeII ||| TaiI ||| SetI ||MseI |Hpy166II |HindII |HpaI MboII L L P Q L N W Q P T L L K K L V N H V L F Y P N * T G N R H Y * R N L L T T F Y S T P I E L A T D I I E E T C * P R F I ----:----|----:----|----:----|----:----|----:----|----:----| R R G W N F Q C G V N N F F S T L W T K E E V G I S S A V S M I S S V Q * G R K K * G L Q V P L R C * Q L F K N V V N * MboI BclI | DpnI BsrI | |BstKTI | TsoI TspRI TstI | || BfiI BsrI MaeIII \ \ \ \ \ \\ \ \ \ TCCAGTGGTTCGTGGATTTCTCACTTGATCAAGTTATCCCAGTATAGTAACATTCCAATC 4930 4940 4950 4960 4970 4980 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTCACCAAGCACCTAAAGAGTGAACTAGTTCAATAGGGTCATATCATTGTAAGGTTAG / / // / / / / TsoI TstI || | BfiI BsrI MaeIII || BclI || MboI |DpnI BstKTI S S G S W I S H L I K L S Q Y S N I P I P V V R G F L T * S S Y P S I V T F Q S Q W F V D F S L D Q V I P V * * H S N L ----:----|----:----|----:----|----:----|----:----|----:----| D L P E H I E * K I L N D W Y L L M G I I W H N T S K E S S * T I G T Y Y C E L G T T R P N R V Q D L * G L I T V N W D MnlI |TspEI CviJI CviRI* \\ \ \ TGTAATTTGAGGCTGGATAGTATGGATTATATTATTGATGTTCTTTATGCAAGAAAACTA 4990 5000 5010 5020 5030 5040 ----:----|----:----|----:----|----:----|----:----|----:----| ACATTAAACTCCGACCTATCATACCTAATATAATAACTACAAGAAATACGTTCTTTTGAT / / / / MnlI | CviJI CviRI* TspEI C N L R L D S M D Y I I D V L Y A R K L V I * G W I V W I I L L M F F M Q E N * * F E A G * Y G L Y Y * C S L C K K T K ----:----|----:----|----:----|----:----|----:----|----:----| Q L K L S S L I S * I I S T R * A L F S R Y N S A P Y Y P N Y * Q H E K H L F V T I Q P Q I T H I I N N I N K I C S F * Hpy178III* | MboI | |MnlI | ||DpnI | |||FatI | |||BstKTI | ||||PflMI | ||||CviAII | ||||BsiYI* | ||||| NlaIII AluI | ||||| | FalI FalI CviJI | ||||| | FalI FalI | SetI | ||||| | |BsmI \ \ \ \ \\\\\ \ \\ AAAAAAGAGAACATCGTGCTTTGGTGGAATGAGAAAGCTCCACTTCCAGATCATGGAGGC 5050 5060 5070 5080 5090 5100 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTCTCTTGTAGCACGAAACCACCTTACTCTTTCGAGGTGAAGGTCTAGTACCTCCG / / / //////// / FalI | CviJI |||||||| BsmI FalI | AluI |||||||FatI SetI ||||||CviAII |||||FalI |||||FalI ||||MboI |||NlaIII ||DpnI |BsiYI* |BstKTI |PflMI Hpy178III* MnlI K K E N I V L W W N E K A P L P D H G G K K R T S C F G G M R K L H F Q I M E A K R E H R A L V E * E S S T S R S W R H ----:----|----:----|----:----|----:----|----:----|----:----| F F S F M T S Q H F S F A G S G S * P P L F L S C R A K T S H S L E V E L D H L F F L V D H K P P I L F S W K W I M S A TfiI HinfI | Hpy188I MseI FatI | |ApoI |SwaI |CviAII | |TspEI |AhaIII* || NlaIII | || TspDTI TspEI \\ \\ \ \ \\ \ \ ATTCAAAATGATTTTGATTTAAATACATCATGGATAATGAATGATTCAGAATTTCCCAAA 5110 5120 5130 5140 5150 5160 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTTTTACTAAAACTAAATTTATGTAGTACCTATTACTTACTAAGTCTTAAAGGGTTT // / // // / / |MseI | |FatI || | TspEI AhaIII* | CviAII || | ApoI SwaI NlaIII || TspDTI |Hpy188I HinfI TfiI I Q N D F D L N T S W I M N D S E F P K F K M I L I * I H H G * * M I Q N F P K S K * F * F K Y I M D N E * F R I S Q N ----:----|----:----|----:----|----:----|----:----|----:----| M * F S K S K F V D H I I F S E S N G L C E F H N Q N L Y M M S L S H N L I E W N L I I K I * I C * P Y H I I * F K G F MseI BspCNI Hpy178III* TspEI VspI DdeI SetI |BseMII |TaqI | MseI Tsp4CI* \ \ \ \\ \\ \ \ \ ATTAATAACTCAGGTGTGTATGACAATGTAGTTCTCGATGTTGGTGTTGATAATTTAACA 5170 5180 5190 5200 5210 5220 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTATTGAGTCCACACATACTGTTACATCAAGAGCTACAACCACAACTATTAAATTGT // // // // /// / |VspI |DdeI |BseMII |TaqI ||| Tsp4CI* |MseI SetI BspCNI Hpy178III* ||MseI TspEI |TspRI TspEI I N N S G V Y D N V V L D V G V D N L T L I T Q V C M T M * F S M L V L I I * Q * * L R C V * Q C S S R C W C * * F N S ----:----|----:----|----:----|----:----|----:----|----:----| I L L E P T Y S L T T R S T P T S L K V F * Y S L H T H C H L E R H Q H Q Y N L N I V * T H I V I Y N E I N T N I I * C MboI | DpnI | |BtsI | |TspRI | |BstKTI | ||MaeI | ||| MseI | ||| |HpaI | ||| |HindII Hpy166II SfaNI | ||| |Hpy166II | TspRI |MseI | ||| || Eco57I | | TspEI |VspI Hin4II* | ||| || Eco57MI \ \ \ \\ \ \ \\\ \\ \ GTGAACACAATTTTGACATCAGCATTAATCAATGATGCTGAAGGCAGTGATCTAGTTAAC 5230 5240 5250 5260 5270 5280 ----:----|----:----|----:----|----:----|----:----|----:----| CACTTGTGTTAAAACTGTAGTCGTAATTAGTTACTACGACTTCCGTCACTAGATCAATTG / / // / / // / / // Hpy166II TspEI || Hin4II* TspRI || | | |MseI |SfaNI || | | Hpy166II VspI || | | Eco57MI MseI || | | Eco57I || | | HindII || | | HpaI || | MaeI || MboI |DpnI BstKTI BtsI V N T I L T S A L I N D A E G S D L V N * T Q F * H Q H * S M M L K A V I * L T E H N F D I S I N Q * C * R Q * S S * Q ----:----|----:----|----:----|----:----|----:----|----:----| T F V I K V D A N I L S A S P L S R T L L S C L K S M L M L * H H Q L C H D L * H V C N Q C * C * D I I S F A T I * N V Hpy188I |ApoI |TspEI |EcoRI || BccI || | ApaLI || | | CviRI* || | | Hpy166II || | | | SduI BceAI || | | | BseSI | SfaNI MseI || | | | HgiAI* \ \ \ \\ \ \ \ \ AATAATATGGGTATAGATGACAAAGATGCCGTTATTAACTCGCCATCTGAATTCGTGCAC 5290 5300 5310 5320 5330 5340 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTATACCCATATCTACTGTTTCTACGGCAATAATTGAGCGGTAGACTTAAGCACGTG / / / / // / / / | SfaNI MseI | || | | Hpy99I BceAI | || | | ApaLI | || | Hpy166II | || | CviRI* | || HgiAI* | || BseSI | || SduI | |EcoRI | |TspEI | |ApoI | BccI Hpy188I N N M G I D D K D A V I N S P S E F V H I I W V * M T K M P L L T R H L N S C T * Y G Y R * Q R C R Y * L A I * I R A R ----:----|----:----|----:----|----:----|----:----|----:----| L L I P I S S L S A T I L E G D S N T C C Y Y P Y L H C L H R * * S A M Q I R A I I H T Y I V F I G N N V R W R F E H V AcyI HgaI | Hpy99I | MnlI SetI | | HgaI | | MseI | MseI MnlI \ \ \ \ \ \ \ \ \ GACGCCTTTTCTAATGACGCTTTGAATGTTTTAAGAGGTATGTTAAAGGAGTGGTGGGAT 5350 5360 5370 5380 5390 5400 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCGGAAAAGATTACTGCGAAACTTACAAAATTCTCCATACAATTTCCTCACCACCCTA / / / / / / / / AcyI HgaI | | | SetI MseI MnlI | | MseI | HgaI MnlI D A F S N D A L N V L R G M L K E W W D T P F L M T L * M F * E V C * R S G G M R L F * * R F E C F K R Y V K G V V G * ----:----|----:----|----:----|----:----|----:----|----:----| S A K E L S A K F T K L P I N F S H H S R R R K * H R K S H K L L Y T L P T T P V G K R I V S Q I N * S T H * L L P P I AsuI* ApoI DraII TspEI BseGI | BssKI |CviJI | SecI* |HaeIII | EcoRII |BmgT120I ApoI | | ScrFI || FokI TspEI AciI | | BseBI \\ \ \ \ \ \ \ GAGGCCCTAAAAGAAAATTCAACCGCAGATTTGTTGGTAAATTCCCTGGCAAGTTGGGTT 5410 5420 5430 5440 5450 5460 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCGGGATTTTCTTTTAAGTTGGCGTCTAAACAACCATTTAAGGGACCGTTCAACCCAA / /// / / / / /// | ||DraII FokI TspEI AciI | ||EcoRII | ||AsuI* ApoI | ||BssKI | |BmgT120I | |SecI* | HaeIII | BseBI | CviJI | ScrFI BseGI TspEI ApoI E A L K E N S T A D L L V N S L A S W V R P * K K I Q P Q I C W * I P W Q V G F G P K R K F N R R F V G K F P G K L G S ----:----|----:----|----:----|----:----|----:----|----:----| S A R F S F E V A S K N T F E R A L Q T H P G L L F N L R L N T P L N G P L N P L G * F F I * G C I Q Q Y I G Q C T P N Hpy99I | DdeI | | TspDTI | | | EcoRV | | | |TspGWI BsmI | | | || MaeII MseI | XmnI | | | || | SetI |FalI | | TaqI | | | || | TaiI |FalI \ \ \ \ \ \ \\ \ \ \\ CAAAACCCGAATGCGAAACTATTCGACGGATTACTAAGATATCACGTTCATAACTTAACA 5470 5480 5490 5500 5510 5520 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTGGGCTTACGCTTTGATAAGCTGCCTAATGATTCTATAGTGCAAGTATTGAATTGT / / / / / / // / / / / BsmI | | TaqI | | || | | FalI MseI | Hpy99I | | || | | FalI XmnI | | || | MaeII | | || TaiI | | || SetI | | |EcoRV | | TspGWI | DdeI TspDTI Q N P N A K L F D G L L R Y H V H N L T K T R M R N Y S T D Y * D I T F I T * Q K P E C E T I R R I T K I S R S * L N K ----:----|----:----|----:----|----:----|----:----|----:----| * F G F A F S N S P N S L Y * T * L K V E F G S H S V I R R I V L I D R E Y S L L V R I R F * E V S * * S I V N M V * C ApaLI | CviRI* | Hpy166II | | SduI ApoI | | BseSI FalI | | HgiAI* FalI | | | TspDTI CviJI TspEI TspEI | | | | CviJI \ \ \ \ \ \ \ \ AAAAAAGCCTTACTTCAATTAGTAAATGAATTTAGTGCACTTGGCTCAACTATTGTATAT 5530 5540 5550 5560 5570 5580 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTCGGAATGAAGTTAATCATTTACTTAAATCACGTGAACCGAGTTGATAACATATA / / / / / / / / CviJI | FalI | | | | CviJI | FalI | | | TspDTI TspEI | | | ApaLI | | Hpy166II | | CviRI* | HgiAI* | BseSI | SduI TspEI ApoI K K A L L Q L V N E F S A L G S T I V Y K K P Y F N * * M N L V H L A Q L L Y M K S L T S I S K * I * C T W L N Y C I C ----:----|----:----|----:----|----:----|----:----|----:----| F F A K S * N T F S N L A S P E V I T Y L F L R V E I L L H I * H V Q S L * Q I F F G * K L * Y I F K T C K A * S N Y I HphI TfiI | TatI HinfI | |Csp6I | ApoI | ||RsaI MaeIII CviRI* | TspEI | ||ScaI SetI Tsp4CI* SfeI* \ \ \ \ \\\ \ \ \ GCAGACAGGAATCAAATTCTAATAAAGACAAACAAGTACTCACCTGAAAACTGTTACGCC 5590 5600 5610 5620 5630 5640 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTGTCCTTAGTTTAAGATTATTTCTGTTTGTTCATGAGTGGACTTTTGACAATGCGG / / / / /// / / / CviRI* HinfI TspEI HphI ||| SetI | MaeIII TfiI ApoI ||TatI Tsp4CI* |Csp6I ScaI RsaI A D R N Q I L I K T N K Y S P E N C Y A Q T G I K F * * R Q T S T H L K T V T P R Q E S N S N K D K Q V L T * K L L R L ----:----|----:----|----:----|----:----|----:----|----:----| A S L F * I R I F V F L Y E G S F Q * A H L C S D F E L L S L C T S V Q F S N R C V P I L N * Y L C V L V * R F V T V G Hpy178III* CviJI Hin4II* TspDTI | MseI \ \ \ \ \ TACAGCCAATATATGATGAAGGCAGTTAGAACAAATCCAATGTTTAGTTATCTGGACTTA 5650 5660 5670 5680 5690 5700 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTCGGTTATATACTACTTCCGTCAATCTTGTTTAGGTTACAAATCAATAGACCTGAAT // / / / / |CviJI Hin4II* TspDTI | MseI SfeI* Hpy178III* Y S Q Y M M K A V R T N P M F S Y L D L T A N I * * R Q L E Q I Q C L V I W T * Q P I Y D E G S * N K S N V * L S G L K ----:----|----:----|----:----|----:----|----:----|----:----| * L W Y I I F A T L V F G I N L * R S K R C G I Y S S P L * F L D L T * N D P S V A L I H H L C N S C I W H K T I Q V * MboI XhoII AclI | DpnI MaeII | |BstKTI MseI | SetI | || BinI* |FokI | TaiI | || |BccI BseGI |TspEI \ \ \ \\ \\ \ \\ AATATCAAACGTTATTGGGATCTGCTAATATGGATGGATAAGTTTAATTTTAGTGGATTA 5710 5720 5730 5740 5750 5760 ----:----|----:----|----:----|----:----|----:----|----:----| TTATAGTTTGCAATAACCCTAGACGATTATACCTACCTATTCAAATTAAAATCACCTAAT / / // / // / / / | MaeII || | |BccI BseGI | TspEI | AclI || | BinI* | FokI TaiI || XhoII MseI SetI || MboI |DpnI BstKTI N I K R Y W D L L I W M D K F N F S G L I S N V I G I C * Y G W I S L I L V D * Y Q T L L G S A N M D G * V * F * W I S ----:----|----:----|----:----|----:----|----:----|----:----| F I L R * Q S R S I H I S L N L K L P N L Y * V N N P D A L I S P Y T * N * H I I D F T I P I Q * Y P H I L K I K T S * FatI |CviAII || NspI Hpy178III* || NlaIII | AciI || | MnlI | | NspBII* BsrDI \\ \ \ \ \ \ \ GCATGTATTGAAATAGAGGAAAAGGAAAATCAGGATTATACCGCTGTTTCGCAATGGCAA 5770 5780 5790 5800 5810 5820 ----:----|----:----|----:----|----:----|----:----|----:----| CGTACATAACTTTATCTCCTTTTCCTTTTAGTCCTAATATGGCGACAAAGCGTTACCGTT / // / / / / | || MnlI | NspBII* BsrDI | |FatI | AciI | CviAII Hpy178III* NlaIII NspI A C I E I E E K E N Q D Y T A V S Q W Q H V L K * R K R K I R I I P L F R N G N M Y * N R G K G K S G L Y R C F A M A T ----:----|----:----|----:----|----:----|----:----|----:----| A H I S I S S F S F * S * V A T E C H C L M Y Q F L P F P F D P N Y R Q K A I A C T N F Y L F L F I L I I G S N R L P L BsaBI |MboI |BclI CviJI |BseGI | MnlI || DpnI MaeIII | |ApoI || |BstKTI HphI Tsp45I | |TspEI || || FokI \ \ \ \\ \\ \\ \ CTAAAGAAGTTTCTGTCACCAATATATCAGCCCGAATTTGAGGATTGGATGATGATCATA 5830 5840 5850 5860 5870 5880 ----:----|----:----|----:----|----:----|----:----|----:----| GATTTCTTCAAAGACAGTGGTTATATAGTCGGGCTTAAACTCCTAACCTACTACTAGTAT / / / / / // // / HphI Tsp45I | MnlI TspEI || || BclI MaeIII CviJI ApoI || || MboI || |DpnI || BstKTI |BsaBI BseGI L K K F L S P I Y Q P E F E D W M M I I * R S F C H Q Y I S P N L R I G * * S Y K E V S V T N I S A R I * G L D D D H I ----:----|----:----|----:----|----:----|----:----|----:----| S F F N R D G I Y * G S N S S Q I I I M V L S T E T V L I D A R I Q P N S S S * * L L K Q * W Y I L G F K L I P H H D Y TspEI AluI | ApoI CviJI | TspEI | SetI | EcoRI HgaI \ \ \ \ \ TTGGATAGTATGCTAAAGACAAAGCAGAGCTATCTAAAATTGAATTCAGGGACGCAAAGA 5890 5900 5910 5920 5930 5940 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTATCATACGATTTCTGTTTCGTCTCGATAGATTTTAACTTAAGTCCCTGCGTTTCT / / / / / / FokI | CviJI | EcoRI SetI | AluI | TspEI SetI | ApoI TspEI L D S M L K T K Q S Y L K L N S G T Q R W I V C * R Q S R A I * N * I Q G R K D G * Y A K D K A E L S K I E F R D A K T ----:----|----:----|----:----|----:----|----:----|----:----| N S L I S F V F C L * R F N F E P V C L I P Y Y A L S L A S S D L I S N L S A F Q I T H * L C L L A I * F Q I * P R L S SetI BslFI MseI MboII \ \ \ CCTACCCAAATAGTTAATGTAAAAAAACAAGATAAGGAAGATAGTGTTGAAAACTCGTTG 5950 5960 5970 5980 5990 6000 ----:----|----:----|----:----|----:----|----:----|----:----| GGATGGGTTTATCAATTACATTTTTTTGTTCTATTCCTTCTATCACAACTTTTGAGCAAC / / / / / | BslFI MseI MboII TstI HgaI P T Q I V N V K K Q D K E D S V E N S L L P K * L M * K N K I R K I V L K T R * Y P N S * C K K T R * G R * C * K L V E ----:----|----:----|----:----|----:----|----:----|----:----| G V W I T L T F F C S L S S L T S F E N V * G F L * H L F V L Y P L Y H Q F S T R G L Y N I Y F F L I L F I T N F V R Q PleI TspDTI HindIII |MlyI ||AluI ||CviJI ||| SetI ||| | MseI ||| | |AhaIII* HphI SetI BdaI ||| | ||BdaI TstI TspGWI BdaI TstI HinfI ||| | ||BdaI \ \ \ \ \ \\\ \ \\\ AACGGATTTTCTCACCTTTTTTCCAAACCACTAATGAAAAGAGTCAAAAAGCTTTTTAAA 6010 6020 6030 6040 6050 6060 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCCTAAAAGAGTGGAAAAAAGGTTTGGTGATTACTTTTCTCAGTTTTTCGAAAAATTT / / / / / / / /// / /// HphI | TspGWI BdaI TstI | | ||| | ||MseI SetI BdaI | | ||| | |AhaIII* | | ||| | BdaI | | ||| | BdaI | | ||| HindIII | | ||CviJI | | ||AluI | | |PleI | | |MlyI | | SetI | TspDTI HinfI N G F S H L F S K P L M K R V K K L F K T D F L T F F P N H * * K E S K S F L K R I F S P F F Q T T N E K S Q K A F * K ----:----|----:----|----:----|----:----|----:----|----:----| F P N E * R K E L G S I F L T L F S K L S R I K E G K K W V V L S F L * F A K * V S K R V K K G F W * H F S D F L K K F BinI* | MboI | XhoII | | DpnI | | |BstKTI MnlI | | || DdeI | BspCNI BssKI TspDTI | | || |MnlI | |BseMII MboII EcoRII \ \ \ \\ \\ \ \\ \ \ AACCAGCAAGAGTTCATTTTAGATCCTCAGTATGAGGCAGACTATGTTATTCCTGTTCTT 6070 6080 6090 6100 6110 6120 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGTCGTTCTCAAGTAAAATCTAGGAGTCATACTCCGTCTGATACAATAAGGACAAGAA / / // // / / // / TspDTI | || || DdeI | |BseMII MboII | || |MnlI | BspCNI | || XhoII MnlI | || MboI | |DpnI | BstKTI BinI* N Q Q E F I L D P Q Y E A D Y V I P V L T S K S S F * I L S M R Q T M L F L F F P A R V H F R S S V * G R L C Y S C S S ----:----|----:----|----:----|----:----|----:----|----:----| F W C S N M K S G * Y S A S * T I G T R F G A L T * K L D E T H P L S H * E Q E V L L L E N * I R L I L C V I N N R N K XbaI ScrFI MslI |MaeI BseBI Hpy188I |Hpy178III* FatI | NlaIV | BccI || Hin4II* |CviAII \ \ \ \ \\ \ \\ CCTGGTTCCCATCTGAATGTGAAAAATCCCCTTCTAGAACTTGTCAAATCACTCTGCCAT 6130 6140 6150 6160 6170 6180 ----:----|----:----|----:----|----:----|----:----|----:----| GGACCAAGGGTAGACTTACACTTTTTAGGGGAAGATCTTGAACAGTTTAGTGAGACGGTA / // // / // / / / | |NlaIV || BccI || Hin4II* | CviAII | EcoRII |MslI |XbaI NlaIII | BssKI Hpy188I Hpy178III* BseBI MaeI ScrFI P G S H L N V K N P L L E L V K S L C H L V P I * M * K I P F * N L S N H S A M W F P S E C E K S P S R T C Q I T L P C ----:----|----:----|----:----|----:----|----:----|----:----| G P E W R F T F F G R R S S T L D S Q W E Q N G D S H S F D G E L V Q * I V R G R T G M Q I H F I G K * F K D F * E A M TatI |Csp6I ||RsaI ||| TspEI ||| | EcoP15I ||| | | BseMII ||| | | |BspCNI ||| | | ||Hpy178III* ||| | | ||| AsuI* ||| | | ||| AvaII NlaIII ||| | | ||| DraII |FatI ||| | | ||| PpuMI ||CviAII ||| | | ||| |BmgT120I ||| MaeIII ||| | | ||| ||NlaIV ||| |NlaIII ||| | | ||| ||| DdeI \\\ \\ \\\ \ \ \\\ \\\ \ GTCATGTTACTTTCAAAGAGTACAATTTTAGAAATCAGGACCCTGAGAAAAGAACTGCTG 6190 6200 6210 6220 6230 6240 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTACAATGAAAGTTTCTCATGTTAAAATCTTTAGTCCTGGGACTCTTTTCTTGACGAC // // / /// / / // / // / || || MaeIII ||| | | || | || DdeI || |FatI ||| | | || | |PpuMI || CviAII ||| | | || | |DraII |NlaIII ||| | | || | |AvaII FatI ||| | | || | |AsuI* ||| | | || | BmgT120I ||| | | || | NlaIV ||| | | || Hpy178III* ||| | | |BspCNI ||| | | BseMII ||| | EcoP15I ||| TspEI ||TatI |Csp6I RsaI V M L L S K S T I L E I R T L R K E L L S C Y F Q R V Q F * K S G P * E K N C * H V T F K E Y N F R N Q D P E K R T A E ----:----|----:----|----:----|----:----|----:----|----:----| T M N S E F L V I K S I L V R L F S S S H * T V K L S Y L K L F * S G S F L V A D H * K * L T C N * F D P G Q S F F Q Q MwoI | AciI | | ApoI | | TspEI | | EcoRI | | | BinI* | | | | MboI | | | | XhoII TspEI Eco57I | | | | | DpnI | MboII Eco57MI | | | | | |BstKTI HinfI \ \ \ \ \ \ \ \ \\ \ AAGATATTTGAATTGCGTGAGTTTGCTAAAGTAGCGGAATTCAAAGATCCAAGTTTGAGT 6250 6260 6270 6280 6290 6300 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTATAAACTTAACGCACTCAAACGATTTCATCGCCTTAAGTTTCTAGGTTCAAACTCA / / / / / / // / / | | Eco57MI MwoI AciI | || XhoII HinfI | | Eco57I | || MboI | TspEI | |DpnI MboII | BstKTI EcoRI TspEI BinI* ApoI K I F E L R E F A K V A E F K D P S L S R Y L N C V S L L K * R N S K I Q V * V D I * I A * V C * S S G I Q R S K F E S ----:----|----:----|----:----|----:----|----:----|----:----| F I N S N R S N A L T A S N L S G L K L S S I Q I A H T Q * L L P I * L D L N S L Y K F Q T L K S F Y R F E F I W T Q T BsiI* | BsmAI | |PleI | ||MlyI | ||HgiCI* | ||| NlaIV TspDTI | ||| | HpaII | Tsp4CI* Hpy188I \ \\\ \ \ \ \ \ CTCGTGGTGCCGGATTTTTTATGTGAATACTGTTTTTTCATTTCTGATATTGACTTTTGT 6310 6320 6330 6340 6350 6360 ----:----|----:----|----:----|----:----|----:----|----:----| GAGCACCACGGCCTAAAAAATACACTTATGACAAAAAAGTAAAGACTATAACTGAAAACA // / / / / / / || | | HpaII | Tsp4CI* Hpy188I || | HgiCI* TspDTI || BsmAI || NlaIV |PleI |MlyI BsiI* L V V P D F L C E Y C F F I S D I D F C S W C R I F Y V N T V F S F L I L T F V R G A G F F M * I L F F H F * Y * L L * ----:----|----:----|----:----|----:----|----:----|----:----| R T T G S K K H S Y Q K K M E S I S K Q D R P A P N K I H I S N K * K Q Y Q S K E H H R I K * T F V T K E N R I N V K T TseI |BisI ||BlsI |||AluI |||CviJI |||| SetI |||| |AlwNI |||| |Hpy178III* FatI |||| || TfiI |CviAII |||| || HinfI || NlaIII |||| || |TspDTI || | Hpy188I |||| || || BbvI || | | MaeIII CviJI |||| || || | HgaI || | | Tsp45I | MseI \\\\ \\ \\ \ \ \\ \ \ \ \ \ AAGGCAGCTCCTGAATCTATTTTTTCATGCGTCAGATGTCACAAAGCCTTTAATCAAGTA 6370 6380 6390 6400 6410 6420 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGTCGAGGACTTAGATAAAAAAGTACGCAGTCTACAGTGTTTCGGAAATTAGTTCAT /// / / / / / // / / / / ||| | | | | | || Hpy188I | CviJI MseI ||| | | | | | |FatI Tsp45I ||| | | | | | CviAII MaeIII ||| | | | | NlaIII ||| | | | HgaI ||| | | BbvI ||| | HinfI ||| | TfiI ||| Hpy178III* ||| TspDTI ||AlwNI ||CviJI ||TseI ||AluI |BisI BlsI SetI K A A P E S I F S C V R C H K A F N Q V R Q L L N L F F H A S D V T K P L I K Y G S S * I Y F F M R Q M S Q S L * S S I ----:----|----:----|----:----|----:----|----:----|----:----| L A A G S D I K E H T L H * L A K L * T Y P L E Q I * K K M R * I D C L R * D L L C S R F R N K * A D S T V F G K I L Y Hin4I Hin4I | MaeII MseI | | SetI |TspEI | | TaiI || GsuI | | | Hpy188I || Eco57MI | | | | EcoRV || |SfaNI SetI | | | | | TaqI || |Hpy178III* |TfiI | | | | | | TfiI || || Hin4I CviRI* |HinfI | | | | | | HinfI || || Hin4I \ \\ \ \ \ \ \ \ \ \\ \\ \ TTGTTGCAAGAACACCTGATTCAAAAACTACGTTCTGATATCGAATCCTATTTAATTCAA 6430 6440 6450 6460 6470 6480 ----:----|----:----|----:----|----:----|----:----|----:----| AACAACGTTCTTGTGGACTAAGTTTTTGATGCAAGACTATAGCTTAGGATAAATTAAGTT / / / / / / / / / / // / / CviRI* SetI | Hin4I | | | | | HinfI || | Hpy178III* | Hin4I | | | | | TfiI || TspEI HinfI | | | | TaqI |Eco57MI TfiI | | | EcoRV |Hin4I | | Hpy188I |Hin4I | MaeII |GsuI TaiI MseI SetI L L Q E H L I Q K L R S D I E S Y L I Q C C K N T * F K N Y V L I S N P I * F K V A R T P D S K T T F * Y R I L F N S R ----:----|----:----|----:----|----:----|----:----|----:----| N N C S C R I * F S R E S I S D * K I * I T A L V G S E F V V N Q Y R I R N L E Q Q L F V Q N L F * T R I D F G I * N L SduI MaeII BseSI |MaeIII | Tsp4CI* |Tsp45I | | FatI || SetI | | TspRI Hpy178III* || TaiI | | |CviAII \ \\ \ \ \ \\ GATTTGAGATGCTCCAGATGTCATAAAGTGAAACGTGACTATATGAGTGCCCACTGTCCA 6490 6500 6510 6520 6530 6540 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAACTCTACGAGGTCTACAGTATTTCACTTTGCACTGATATACTCACGGGTGACAGGT / / / / / / / / / SfaNI Hpy178III* | | Tsp45I | | | NlaIII | | MaeIII | | Tsp4CI* | MaeII | TspRI TaiI BseSI SetI SduI D L R C S R C H K V K R D Y M S A H C P I * D A P D V I K * N V T I * V P T V H F E M L Q M S * S E T * L Y E C P L S M ----:----|----:----|----:----|----:----|----:----|----:----| S K L H E L H * L T F R S * I L A W Q G L N S I S W I D Y L S V H S Y S H G S D I Q S A G S T M F H F T V I H T G V T W NlaIII | MroNI | Cfr10I | BsiYI* | |HpaII | ||NaeI | ||Cac8I | ||| Hin6I | ||| |GlaI | ||| ||HhaI | ||| ||Hin4II* | ||| ||FnuDII* | ||| |||BsiYI* MseI \ \\\ \\\\ \ TGTGCCGGCGCGTGGGAAGGAACTCTCCCCAGAGAAAGCATTGTTCAAAAGTTAAATGTG 6550 6560 6570 6580 6590 6600 ----:----|----:----|----:----|----:----|----:----|----:----| ACACGGCCGCGCACCCTTCCTTGAGAGGGGTCTCTTTCGTAACAAGTTTTCAATTTACAC // ///// / || ||||FnuDII* MseI || ||||Hin6I || |||Hin4II* || |||GlaI || ||Cfr10I || ||BsiYI* || ||MroNI || ||HhaI || |HpaII || Cac8I || NaeI |FatI BsiYI* CviAII C A G A W E G T L P R E S I V Q K L N V V P A R G K E L S P E K A L F K S * M C C R R V G R N S P Q R K H C S K V K C V ----:----|----:----|----:----|----:----|----:----|----:----| H A P A H S P V R G L S L M T * F N F T M H R R T P L F E G W L F C Q E F T L H T G A R P F S S E G S F A N N L L * I H Tsp4CI* MseI CviJI | TsoI \ \ \ \ TTTAAGCAAGTAGCCAAGTATTACGGTTTTGATATATTATTGAGTTGTATTGCTGATTTG 6610 6620 6630 6640 6650 6660 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTCGTTCATCGGTTCATAATGCCAAAACTATATAATAACTCAACATAACGACTAAAC / / // MseI CviJI |TsoI Tsp4CI* F K Q V A K Y Y G F D I L L S C I A D L L S K * P S I T V L I Y Y * V V L L I * * A S S Q V L R F * Y I I E L Y C * F D ----:----|----:----|----:----|----:----|----:----|----:----| N L C T A L Y * P K S I N N L Q I A S K T * A L L W T N R N Q Y I I S N Y Q Q N K L L Y G L I V T K I Y * Q T T N S I Q NdeI \ ACCATATGA ----:---- TGGTATACT / NdeI T I * P Y X H M X ----:---- V M H S W I G Y S # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 3 FblI,XmiI AciI 16 BspACI,SsiI AclI 4 Psp1406I AcyI 3 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 4 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 5 DraI AjuI 2 AlfI 2 AluI 23 AluBI AlwNI 2 CaiI ApaLI 3 Alw44I,VneI ApoI 21 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 3 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BamHI 1 BarI 1 BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 8 BpiI,BpuAI,BstV2I,BbsI BccI 14 BceAI 8 BcgI 1 BciVI 2 BfuI BclI 3 FbaI,Ksp22I BdaI 2 BetI* 5 BsaWI BfiI 2 BmrI,BmuI BglII 2 BinI* 12 AlwI,BspPI,AclWI BisI 10 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 10 BmgT120I 3 BplI 2 Bpu10I 1 BsaAI 4 BstBAI,Ppu21I BsaBI 3 Bse8I,BseJI BsaXI 4 BseBI 8 Bst2UI,BstNI,BstOI,MvaI BseGI 9 BstF5I,BtsCI BseMII 9 BsePI 1 BssHII,PauI BseRI 2 BseSI 5 BaeGI,BstSLI BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 9 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 8 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 9 BspHI 1 CciI,PagI,RcaI BspLU11I* 2 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 1 AccBSI,MbiI BsrDI 2 BseMI,Bse3DI BsrI 8 BseNI,Bse1I,BsrSI BssKI 11 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstKTI 26 BstXI 3 BtgZI 1 BtsI 2 Cac8I 9 BstC8I CauII* 3 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I ClaI 4 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 13 CviQI,RsaNI CspCI 1 CviAII 26 CviJI 56 CviKI-1 CviRI* 22 HpyCH4V DdeI 15 BstDEI,HpyF3I DpnI 26 MalI DraII 2 EcoO109I DrdI 1 AasI,DseDI DsaI* 3 BtgI,BstDSI EciI 2 Eco31I 2 Bso31I,BspTNI,BsaI Eco57I 3 AcuI Eco57MI 5 EcoP15I 4 EcoRI 7 EcoRII 8 AjnI,Psp6I,PspGI EcoRV 7 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 2 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 8 FatI 26 FauI 1 SmuI FnuDII* 4 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 9 GlaI 6 GsuI 2 BpmI HaeII 1 BstH2I HaeIII 7 BsnI,BsuRI,BshFI,PhoI HgaI 8 CseI HgiAI* 3 Bbv12I,BsiHKAI,Alw21I HgiCI* 3 BanI,BshNI,BspT107I,AccB1I HhaI 6 BstHHI,CfoI,AspLEI Hin4I 8 Hin4II* 18 HpyAV Hin6I 6 HinP1I,HspAI HindII 6 HincII HindIII 6 HinfI 25 HpaI 2 KspAI HpaII 11 HapII,BsiSI,MspI HphI 15 AsuHPI Hpy166II 15 Hpy8I Hpy178III* 27 Hpy188III Hpy188I 20 Hpy99I 5 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 12 FspBI,BfaI,XspI MaeII 15 HpyCH4IV MaeIII 21 MboI 26 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 35 MfeI 3 MunI MlyI 5 SchI MmeI 1 MnlI 33 MroNI 1 NgoMIV MseI 39 Tru1I,Tru9I MslI 4 RseI,SmiMI MwoI 7 HpyF10VI,BstMWI NaeI 1 PdiI NcoI 3 Bsp19I NdeI 2 FauNDI NlaIII 26 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NspBII* 3 MspA1I NspI 5 BstNSI,XceI PasI 1 PflMI 2 BasI,AccB7I,Van91I PfoI 1 PleI 5 PpsI PpuMI 1 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PsiI 1 AanI PstI 2 PvuII 1 RsaI 13 AfaI SalI 1 SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 11 BmrFI,MspR9I,Bme1390I SduI 5 MhlI,Bsp1286I SecI* 11 BseDI,BssECI,BsaJI SetI 75 SfaNI 8 LweI SfeI* 6 BstSFI,SfcI,BfmI SnaBI 2 Eco105I,BstSNI SpeI 3 BcuI,AhlI SphI 1 PaeI,BbuI SspI 4 StyI 6 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 15 TaqI 20 TaqII 5 TatI 7 TauI 6 TfiI 20 PfeI TseI 4 ApeKI TsoI 8 Tsp45I 4 NmuCI Tsp4CI* 12 HpyCH4III,TaaI,Bst4CI TspDTI 30 TspEI 62 TasI,Tsp509I,Sse9I TspGWI 7 TspRI 10 TscAI TstI 3 Tth111I 1 PflFI,PsyI,AspI VspI 4 PshBI,AseI XbaI 2 XhoII 13 BstYI,MflI,PsuI,BstX2I XmnI 4 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AflII AloI ApaI AscI AvaI AvrII BalI BbvCI Bce83I* BglI BmeT110I BmtI BseYI Bsp120I BspOI BstEII BtrI Cfr9I CfrI DinI DraIII Eam1105I Ecl136II Eco47III EcoICRI EcoNI EgeI EheI FseI FspAI GsaI HgiJII* KasI MauBI McrI* MluI MstI* NarI NheI NmeAIII NotI NruI OliI PacI PmaCI PmeI PpiI PspOMI PspXI PsrI PvuI RsrII SacI SacII SanDI SapI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SplI* SrfI Sse232I* Sse8387I StuI TspMI XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769