Restriction Map of GIS2/YNL255C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GIS2/YNL255C on chromosome XIV from coordinates 167790 to 167329.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.15305

EMBOSS_001 BsmAI | HindIII | | AluI | | CviJI | | | SetI | | | |MaeIII | | | || MaeII CfrI Tsp4CI* | | | || | SetI | BalI |BbvII* | | | || | TaiI | CviJI || TfiI | | | || | | AciI | HaeIII || HinfI \ \ \ \\ \ \ \ \ \ \\ \ ATGTCTCAAAAAGCTTGTTACGTTTGCGGTAAGATTGGCCATTTGGCAGAAGACTGTGAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGAGTTTTTCGAACAATGCAAACGCCATTCTAACCGGTAAACCGTCTTCTGACACTA /// / / // / / / / / ||| | | |MaeII AciI | CfrI | BbvII* ||| | | MaeIII HaeIII | MboII ||| | TaiI CviJI Tsp4CI* ||| | SetI BalI ||| HindIII ||CviJI ||AluI |BsmAI SetI M S Q K A C Y V C G K I G H L A E D C D C L K K L V T F A V R L A I W Q K T V I V S K S L L R L R * D W P F G R R L * F ----:----|----:----|----:----|----:----|----:----|----:----| X D * F A Q * T Q P L I P W K A S S Q S X T E F L K N R K R Y S Q G N P L L S H H R L F S T V N A T L N A M Q C F V T I BssKI | HpaII | ScrFI | CauII* | | MaeIII Csp6I | | Tsp45I |RsaI | | | MaeII || FatI MboII MaeIII | | | | SetI || |CviAII | Hpy188I MaeIII Tsp4CI* | | | | TaiI || || NlaIII \ \ \ \ \ \ \ \ \ \\ \\ \ TCTGAAAGACTATGTTACAACTGTAACAAACCCGGTCACGTTCAAACGGATTGTACCATG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTTTCTGATACAATGTTGACATTGTTTGGGCCAGTGCAAGTTTGCCTAACATGGTAC // / / / /// / // /// // |Hpy188I | | | ||| | |MaeII ||| |FatI HinfI | | | ||| | Tsp45I ||| TspGWI TfiI | | | ||| | MaeIII ||| CviAII | | | ||| TaiI ||NlaIII | | | ||| SetI |Csp6I | | | ||BssKI RsaI | | | |HpaII | | | CauII* | | | ScrFI | | MaeIII | Tsp4CI* MaeIII S E R L C Y N C N K P G H V Q T D C T M L K D Y V T T V T N P V T F K R I V P C * K T M L Q L * Q T R S R S N G L Y H A ----:----|----:----|----:----|----:----|----:----|----:----| E S L S H * L Q L L G P * T * V S Q V M N Q F V I N C S Y C V R D R E F P N Y W R F S * T V V T V F G T V N L R I T G H AgeI BetI* Cfr10I |HpaII || MaeIII MaeIII || Tsp45I | BdaI || | BarI Tsp4CI* | BdaI || | |HphI | ApoI | BsrDI || | ||MaeII | TspEI | | MfeI || | ||| SetI TspGWI | EcoRI | | TspEI || | ||| TaiI \ \ \ \ \ \ \\ \ \\\ \ CCAAGAACAGTTGAATTCAAGCAATGTTACAATTGTGGTGAAACCGGTCACGTTAGAAGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTCTTGTCAACTTAAGTTCGTTACAATGTTAACACCACTTTGGCCAGTGCAATCTTCA / / / / / / //// // / Tsp4CI* EcoRI | | TspEI | |||| |MaeII BdaI TspEI | | MfeI | |||| Tsp45I BdaI ApoI | MaeIII | |||| MaeIII BsrDI | |||TaiI BdaI | |||SetI BdaI | ||HphI | |Cfr10I | |BetI* | |AgeI | HpaII BarI P R T V E F K Q C Y N C G E T G H V R S Q E Q L N S S N V T I V V K P V T L E V K N S * I Q A M L Q L W * N R S R * K * ----:----|----:----|----:----|----:----|----:----|----:----| G L V T S N L C H * L Q P S V P * T L L A L F L Q I * A I N C N H H F R D R * F W S C N F E L L T V I T T F G T V N S T BdaI BdaI MaeIII | TatI Tsp4CI* | |Csp6I | GsuI | ||RsaI | Eco57MI | ||| Tsp4CI* | | Cfr10I | ||| | CviRI* | | |HpaII | ||| | | AclI | | ||CfrI | ||| | | MaeII | | ||| CviJI | ||| | | | SetI | | ||| HaeIII | ||| | | | TaiI | | ||| | TsoI | ||| | | | | BarI | | ||| | | Hpy178III* \ \\\ \ \ \ \ \ \ \ \\\ \ \ \ GAATGTACTGTGCAACGTTGTTTCAACTGTAACCAAACCGGCCACATCTCCAGAGAATGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTACATGACACGTTGCAACAAAGTTGACATTGGTTTGGCCGGTGTAGAGGTCTCTTACG /// / // / / / / // // / / ||| | || MaeII | | MaeIII || |TsoI | BsmI ||| | || AclI | Eco57MI || CfrI Hpy178III* ||| | |BarI | GsuI |Cfr10I ||| | TaiI Tsp4CI* |HaeIII ||| | SetI |CviJI ||| CviRI* HpaII ||Tsp4CI* ||TatI |Csp6I RsaI E C T V Q R C F N C N Q T G H I S R E C N V L C N V V S T V T K P A T S P E N A M Y C A T L F Q L * P N R P H L Q R M P ----:----|----:----|----:----|----:----|----:----|----:----| S H V T C R Q K L Q L W V P W M E L S H H I Y Q A V N N * S Y G F R G C R W L I F T S H L T T E V T V L G A V D G S F A FatI |CviAII || NlaIII || | PsiI BbvII* || | | EcoP15I | TfiI || | | | AsuI* | HinfI || | | | AvaII | |MboII || | | | |BmgT120I BsmI | || TspDTI || | | | || TsoI \ \ \\ \ \\ \ \ \ \\ \ CCTGAACCAAAGAAGACCAGCAGATTCTCCAAAGTTTCATGTTATAAATGTGGTGGTCCA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTTGGTTTCTTCTGGTCGTCTAAGAGGTTTCAAAGTACAATATTTACACCACCAGGT // / / // / / /// || HinfI | || PsiI | ||AvaII || TfiI | |FatI | ||AsuI* |TspDTI | CviAII | |BmgT120I BbvII* NlaIII | TsoI MboII EcoP15I P E P K K T S R F S K V S C Y K C G G P L N Q R R P A D S P K F H V I N V V V Q * T K E D Q Q I L Q S F M L * M W W S K ----:----|----:----|----:----|----:----|----:----|----:----| G S G F F V L L N E L T E H * L H P P G G Q V L S S W C I R W L K M N Y I H H D R F W L L G A S E G F N * T I F T T T W CviJI |DdeI Tsp4CI* TspEI TspGWI NdeI |Bpu10I | MnlI | TspDTI | MaeIII \ \\ \ \ \ \ \ \ AACCATATGGCTAAGGACTGTATGAAAGAGGACGGAATTAGTGGATTGAAATGTTACACT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGTATACCGATTCCTGACATACTTTCTCCTGCCTTAATCACCTAACTTTACAATGTGA / / / / / / / / / | | | | MnlI | TspEI TspGWI MaeIII | | | Tsp4CI* TspDTI | | Bpu10I | | DdeI | CviJI NdeI N H M A K D C M K E D G I S G L K C Y T T I W L R T V * K R T E L V D * N V T L P Y G * G L Y E R G R N * W I E M L H L ----:----|----:----|----:----|----:----|----:----|----:----| F W I A L S Q I F S S P I L P N F H * V L G Y P * P S Y S L P R F * H I S I N C V M H S L V T H F L V S N T S Q F T V S AluI CviJI | CfrI | SetI | Cac8I | | BalI | | CviJI | | HaeIII | | | FatI | | | AflIII | | | BspLU11I* | | | |CviAII | | | || NspI | | | || NlaIII | | | || |BssKI | | | || |EcoRII | | | || ||SecI* | | | || |||ScrFI | | | || |||BseBI BslFI | | | || |||| AlwNI | CviJI MaeIII | | | || |||| | Tsp4CI* | | MaeIII Tsp4CI* \ \ \ \\ \\\\ \ \ \ \ \ \ TGTGGTCAAGCTGGCCACATGTCCAGGGACTGTCAAAATGACAGGCTTTGTTACAACTGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ACACCAGTTCGACCGGTGTACAGGTCCCTGACAGTTTTACTGTCCGAAACAATGTTGACA / / / / // // /// / // / / | | | | || || ||| Tsp4CI* |CviJI | Tsp4CI* | | | | || || ||EcoRII BslFI MaeIII | | | | || || ||BssKI | | | | || || ||SecI* | | | | || || |AlwNI | | | | || || BseBI | | | | || || ScrFI | | | | || |BspLU11I* | | | | || |AflIII | | | | || |FatI | | | | || CviAII | | | | |NlaIII | | | | |NspI | | | | CfrI | | | HaeIII | | | CviJI | | | BalI | | Cac8I | CviJI | AluI SetI C G Q A G H M S R D C Q N D R L C Y N C V V K L A T C P G T V K M T G F V T T V W S S W P H V Q G L S K * Q A L L Q L * ----:----|----:----|----:----|----:----|----:----|----:----| Q P * A P W M D L S Q * F S L S Q * L Q K H D L Q G C T W P S D F H C A K N C S T T L S A V H G P V T L I V P K T V V T CfrI | BalI | CviJI | HaeIII StyI CviJI | |BsrI SecI* |DdeI \ \\ \ \\ AACGAAACTGGCCATATTTCCAAGGATTGTCCAAAGGCTTAG 430 440 450 460 ----:----|----:----|----:----|----:----|-- TTGCTTTGACCGGTATAAAGGTTCCTAACAGGTTTCCGAATC / // / / / / MaeIII || CfrI SecI* | DdeI |HaeIII StyI CviJI |CviJI |BalI BsrI N E T G H I S K D C P K A * T K L A I F P R I V Q R L X R N W P Y F Q G L S K G L X ----:----|----:----|----:----|----:----|-- L S V P W I E L S Q G F A * Y R F Q G Y K W P N D L P K V F S A M N G L I T W L S L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AclI 1 Psp1406I AflIII 1 AgeI 1 AsiGI,BshTI,CspAI,PinAI AluI 2 AluBI AlwNI 1 CaiI ApoI 1 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 3 MlsI,MluNI,MscI,Msp20I BarI 1 BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BdaI 2 BetI* 1 BsaWI BmgT120I 1 Bpu10I 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspLU11I* 1 PscI,PciI BsrDI 1 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 4 AcoI,EaeI Csp6I 2 CviQI,RsaNI CviAII 3 CviJI 9 CviKI-1 CviRI* 1 HpyCH4V DdeI 2 BstDEI,HpyF3I Eco57MI 1 EcoP15I 1 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI FatI 3 GsuI 1 BpmI HaeIII 4 BsnI,BsuRI,BshFI,PhoI HindIII 1 HinfI 2 HpaII 3 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy178III* 1 Hpy188III Hpy188I 1 MaeII 4 HpyCH4IV MaeIII 10 MboII 2 MfeI 1 MunI MnlI 1 NdeI 1 FauNDI NlaIII 3 Hin1II,Hsp92II,FaeI NspI 1 BstNSI,XceI PsiI 1 AanI RsaI 2 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 6 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TatI 1 TfiI 2 PfeI TsoI 2 Tsp45I 2 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 3 TasI,Tsp509I,Sse9I TspGWI 2 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AhaIII* AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BamHI BbvCI BbvI BccI Bce83I* BceAI BcgI BciVI BclI BfiI BglI BglII BinI* BisI BlsI BmeT110I BmtI BplI BsaAI BsaBI BsaXI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* Bsp120I Bsp1407I BspCNI BspHI BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstF5I BstKTI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cfr9I ClaI CspCI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI Fnu4HI FnuDII* FokI FseI FspAI GlaI GsaI HaeII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindII HinP1I HpaI Hpy166II Hpy8I Hpy99I HspAI KasI KpnI Ksp632I* MaeI MauBI MboI McrI* MluI MlyI MmeI Mph1103I MroNI MseI MslI MstI* MwoI NaeI NarI NcoI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SduI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqI TaqII TauI TseI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769