Restriction Map of RPA49/YNL248C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RPA49/YNL248C on chromosome XIV from coordinates 182608 to 181361.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.13884

EMBOSS_001 Hpy188I Hpy178III* |BdaI | MboI |BdaI | |BceAI BsiYI* || TaqI Hin4I | ||DpnI BdaI | SetI || | TspEI |XmnI | |||BstKTI BdaI \ \ \\ \ \ \\ \ \\\\ \ ATGTCCGTGAAAAGGTCTGTTTCTGAAATCGAAATTGAAAGTGTTCAAGATCAACCCTCT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGGCACTTTTCCAGACAAAGACTTTAGCTTTAACTTTCACAAGTTCTAGTTGGGAGA / / / / // / ///// / | SetI Hpy188I | || XmnI ||||MboI BdaI BsiYI* BdaI | |TspEI |||BceAI BdaI BdaI | Hin4I ||DpnI TaqI |BstKTI Hpy178III* M S V K R S V S E I E I E S V Q D Q P S C P * K G L F L K S K L K V F K I N P L V R E K V C F * N R N * K C S R S T L C ----:----|----:----|----:----|----:----|----:----|----:----| X D T F L D T E S I S I S L T * S * G E X T R S F T Q K Q F R F Q F H E L D V R H G H F P R N R F D F N F T N L I L G R BfiI | SduI | HgiAI* | | BsrI | | | MaeIII | | | Tsp45I SecI* | | | | TspRI DsaI* | | | | | MaeII |MnlI | | | | | | SetI || MboII | | | | | | TaiI || | Hin4I TspGWI CviJI | | | | | | |TaqI \\ \ \ \ \ \ \ \ \ \ \ \\ GTTGCCGTGGGAAGTTTCTTCAAGGGCTTCCGTGCTCCCAGTGACACTACGTTCGACTTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGGCACCCTTCAAAGAAGTTCCCGAAGGCACGAGGGTCACTGTGATGCAAGCTGAAT / /// / / // / / / / / | ||DsaI* TspGWI | || TspRI | | | TaqI | ||SecI* | || BsrI | | MaeII | |MboII | |HgiAI* | TaiI | Hin4I | |SduI | SetI MnlI | BfiI Tsp45I CviJI MaeIII V A V G S F F K G F R A P S D T T F D L L P W E V S S R A S V L P V T L R S T Y C R G K F L Q G L P C S Q * H Y V R L I ----:----|----:----|----:----|----:----|----:----|----:----| T A T P L K K L P K R A G L S V V N S K Q Q R P F N R * P S G H E W H C * T R S N G H S T E E L A E T S G T V S R E V * ApoI TspEI Tsp4CI* HphI Hpy188I EcoRI | BsmAI | MaeI \ \ \ \ \ \ TACAAAAAAAAGAAGTCTGAAAAGGACGAATTCGTATTACACGGTGAAAACGAGAGACTA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTTTTTTTCTTCAGACTTTTCCTGCTTAAGCATAATGTGCCACTTTTGCTCTCTGAT / / / / / / Hpy188I EcoRI Tsp4CI* | HphI Hin4II* TspEI BsmAI MaeI ApoI Y K K K K S E K D E F V L H G E N E R L T K K R S L K R T N S Y Y T V K T R D * Q K K E V * K G R I R I T R * K R E T R ----:----|----:----|----:----|----:----|----:----|----:----| Y L F F F D S F S S N T N C P S F S L S I C F F S T Q F P R I R I V R H F R S V V F F L L R F L V F E Y * V T F V L S * HindIII | AluI SetI | CviJI | MboII | | SetI AsuI* | | MboII | | |TaqI |BmgT120I | | | TfiI | | |AsuII ||CviJI Hin4II* | | | HinfI | | || BsrI ||HaeIII \ \ \ \ \ \ \ \\ \ \\\ GAATACGAAGGTTATACTGATTCTTCTTCCCAAGCTTCGAACCAGTATGTTGTGGGCCTA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATGCTTCCAATATGACTAAGAAGAAGGGTTCGAAGCTTGGTCATACAACACCCGGAT / / / / / / / // // SetI | MboII HinfI | | | |BsrI |AsuI* MboII TfiI | | | AsuII BmgT120I | | | TaqI HaeIII | | HindIII CviJI | CviJI | AluI SetI E Y E G Y T D S S S Q A S N Q Y V V G L N T K V I L I L L P K L R T S M L W A Y I R R L Y * F F F P S F E P V C C G P I ----:----|----:----|----:----|----:----|----:----|----:----| S Y S P * V S E E E W A E F W Y T T P R L I R L N Y Q N K K G L K S G T H Q P G F V F T I S I R R G L S R V L I N H A * CviJI |NlaIV || Csp6I MseI Hpy178III* || |RsaI \ \ \\ \\ TTTAATCCAGAAAAGAAAAGTATTCAACTCTACAAGGCTCCCGTACTTGTTTCCAAAGTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTAGGTCTTTTCTTTTCATAAGTTGAGATGTTCCGAGGGCATGAACAAAGGTTTCAA / / // // MseI Hpy178III* |NlaIV |Csp6I CviJI RsaI F N P E K K S I Q L Y K A P V L V S K V L I Q K R K V F N S T R L P Y L F P K L * S R K E K Y S T L Q G S R T C F Q S C ----:----|----:----|----:----|----:----|----:----|----:----| N L G S F F L I * S * L A G T S T E L T I * D L F S F Y E V R C P E R V Q K W L K I W F L F T N L E V L S G Y K N G F N AsuI* TfiI AvaII HinfI |NlaIV BplI BciVI | DdeI |BmgT120I BplI \ \ \ \\ \ GTATCCAAGTCAAGCAAGAATCTAAGGGGTCCAAAAATAAAAAGTAAGAGTGATACTCGT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CATAGGTTCAGTTCGTTCTTAGATTCCCCAGGTTTTTATTTTTCATTCTCACTATGAGCA / / / /// / BciVI | | ||| BplI | | ||| BplI | | ||AvaII | | ||AsuI* | | |BmgT120I | | NlaIV | DdeI HinfI TfiI V S K S S K N L R G P K I K S K S D T R Y P S Q A R I * G V Q K * K V R V I L V I Q V K Q E S K G S K N K K * E * Y S S ----:----|----:----|----:----|----:----|----:----|----:----| T D L D L L F R L P G F I F L L L S V R Q I W T L C S D L P D L F L F Y S H Y E Y G L * A L I * P T W F Y F T L T I S T BccI MwoI | BplI HphI | AluI | BplI |Csp6I | CviJI | | TaqII ||RsaI CviJI | | SetI \ \ \ \\\ \ \ \ \ CCATCTGCTTTGAGAAATGCGTTGGGTGAAGCGTTTGGTACTAAAAAGGCTAAAAAAGCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGACGAAACTCTTTACGCAACCCACTTCGCAAACCATGATTTTTCCGATTTTTTCGA / // / // / / / / | |TaqII | |Csp6I | | | CviJI | BccI | RsaI | | | AluI BplI HphI | | SetI BplI | MwoI CviJI P S A L R N A L G E A F G T K K A K K A H L L * E M R W V K R L V L K R L K K L I C F E K C V G * S V W Y * K G * K S Y ----:----|----:----|----:----|----:----|----:----|----:----| G D A K L F A N P S A N P V L F A L F A D M Q K S F H T P H L T Q Y * F P * F L W R S Q S I R Q T F R K T S F L S F F S CviRI* | MboI | BglII | XhoII | | DpnI MlyI | | |XbaI PleI HindII | | |BstKTI Tsp4CI* Hpy166II | | ||MaeI | HinfI | TfiI | | ||Hpy178III* | | Hpy188I | HinfI TspGWI \ \ \\\ \ \ \ \ \ \ ATTGCAGATCTAGAAAGAAACCGTATTGACTCTGATAAGTTGACTGATTCTGCTATTGAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGTCTAGATCTTTCTTTGGCATAACTGAGACTATTCAACTGACTAAGACGATAACTG / // / // /// // / / / | || | |XbaI ||PleI |Hpy188I | HinfI TspGWI | || | | |MlyI HinfI | TfiI | || | | Tsp4CI* Hpy166II | || | Hpy178III* HindII | || | MaeI | || XhoII | || BglII | || MboI | |DpnI | BstKTI CviRI* I A D L E R N R I D S D K L T D S A I D L Q I * K E T V L T L I S * L I L L L T C R S R K K P Y * L * * V D * F C Y * H ----:----|----:----|----:----|----:----|----:----|----:----| I A S R S L F R I S E S L N V S E A I S * Q L D L F F G Y Q S Q Y T S Q N Q * Q N C I * F S V T N V R I L Q S I R S N V AvaI |BmeT110I || CviJI || | SduI || | HgiJII* TfiI CviRI* || | |MfeI TspEI HinfI | DdeI SfaNI || | |TspEI |BseGI \ \ \ \ \\ \ \\ \\ ATTGTGGATTCCGTGAGAACTGCATCTAAGGATTTACCAACTCGGGCTCAATTGGATGAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TAACACCTAAGGCACTCTTGACGTAGATTCCTAAATGGTTGAGCCCGAGTTAACCTACTT / / / / /// / / HinfI CviRI* DdeI SfaNI ||CviJI | BseGI TfiI |AvaI TspEI BmeT110I MfeI HgiJII* SduI I V D S V R T A S K D L P T R A Q L D E L W I P * E L H L R I Y Q L G L N W M K C G F R E N C I * G F T N S G S I G * N ----:----|----:----|----:----|----:----|----:----|----:----| M T S E T L V A D L S K G V R A * N S S C Q P N R S F Q M * P N V L E P E I P H N H I G H S S C R L I * W S P S L Q I F SfaNI FokI |CviJI TaqI ApoI | TspDTI SetI ||MmeI ClaI TsoI TspRI TspEI \ \ \ \\\ \ \ \ \ ATTACTTCCAACGATAGACCTACTCCATTAGCCAATATCGATGCCACTGATGTAGAACAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGAAGGTTGCTATCTGGATGAGGTAATCGGTTATAGCTACGGTGACTACATCTTGTT / / / / // / / // TspEI | FokI SetI || SfaNI | |TsoI TspDTI |CviJI | TspRI MmeI ClaI TaqI I T S N D R P T P L A N I D A T D V E Q L L P T I D L L H * P I S M P L M * N K Y F Q R * T Y S I S Q Y R C H * C R T N ----:----|----:----|----:----|----:----|----:----|----:----| I V E L S L G V G N A L I S A V S T S C F * K W R Y V * E M L W Y R H W Q H L V N S G V I S R S W * G I D I G S I Y F L Tsp4CI* MfeI | TspDTI TspEI Hin4II* TspEI | | FnuDII* TspEI \ \ \ \ \ \ \ ATTTACCCAATTGAAAGTATAATACCAAAGAAGGAATTACAGTTTATTCGCGTTTCATCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TAAATGGGTTAACTTTCATATTATGGTTTCTTCCTTAATGTCAAATAAGCGCAAAGTAGT / / / / / / / TspEI TspEI Hin4II* | | TspDTI FnuDII* ApoI MfeI | Tsp4CI* TspEI I Y P I E S I I P K K E L Q F I R V S S F T Q L K V * Y Q R R N Y S L F A F H Q L P N * K Y N T K E G I T V Y S R F I N ----:----|----:----|----:----|----:----|----:----|----:----| I * G I S L I I G F F S N C N I R T E D F K G L Q F Y L V L S P I V T * E R K M N V W N F T Y Y W L L F * L K N A N * * Hpy188I | MmeI | | AciI TspEI TspEI \ \ \ \ \ ATTCTGAAAGAAGCGGATAAGGAAAAGAAGTTGGAATTGTTCCCATACCAAAACAATTCC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGACTTTCTTCGCCTATTCCTTTTCTTCAACCTTAACAAGGGTATGGTTTTGTTAAGG // / / / / || MmeI AciI TspEI TspEI |Hpy188I TspEI I L K E A D K E K K L E L F P Y Q N N S F * K K R I R K R S W N C S H T K T I P S E R S G * G K E V G I V P I P K Q F Q ----:----|----:----|----:----|----:----|----:----|----:----| I R F S A S L S F F N S N N G Y W F L E L E S L L P Y P F S T P I T G M G F C N N Q F F R I L F L L Q F Q E W V L V I G MlyI PleI Hin4II* AluI BstXI TspEI HinfI SetI | TspEI CviJI \ \ \ \ \ \ \ AAGTATGTGGCAAAGAAATTGGACTCTTTGACACAACCTTCACAAATGACCAAATTACAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTCATACACCGTTTCTTTAACCTGAGAAACTGTGTTGGAAGTGTTTACTGGTTTAATGTC / // / / / / / / / BstXI || | HinfI SetI Hin4II* | | CviJI || TspEI | | AluI |PleI | SetI MlyI TspEI K Y V A K K L D S L T Q P S Q M T K L Q S M W Q R N W T L * H N L H K * P N Y S V C G K E I G L F D T T F T N D Q I T A ----:----|----:----|----:----|----:----|----:----|----:----| L Y T A F F N S E K V C G E C I V L N C W T H P L S I P S K S V V K V F S W I V L I H C L F Q V R Q C L R * L H G F * L BsrI | AccI MluI | |BssNAI AflIII | |Hpy166II | FnuDII* SetI | ||BfiI | | HgaI \ \ \\\ \ \ \ CTACTATACTACTTATCACTATTACTGGGCGTATACGAAAATAGACGCGTGAATAACAAG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GATGATATGATGAATAGTGATAATGACCCGCATATGCTTTTATCTGCGCACTTATTGTTC / // / / / BsrI |AccI | AflIII HgaI Hpy166II | MluI BssNAI FnuDII* BfiI L L Y Y L S L L L G V Y E N R R V N N K Y Y T T Y H Y Y W A Y T K I D A * I T R T I L L I T I T G R I R K * T R E * Q D ----:----|----:----|----:----|----:----|----:----|----:----| S S Y * K D S N S P T Y S F L R T F L L A V I S S I V I V P R I R F Y V R S Y C * * V V * * * * Q A Y V F I S A H I V L Tsp4CI* | Hpy178III* SmlI | | MnlI AflII SetI | | | BccI |MseI \ \ \ \ \ \\ ACGAAGTTGTTAGAAAGGTTGAACAGTCCTCCTGAAATCTTGGTAGATGGTATCTTAAGC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTTCAACAATCTTTCCAACTTGTCAGGAGGACTTTAGAACCATCTACCATAGAATTCG / / / / / // SetI Tsp4CI* | | BccI |AflII | MnlI |SmlI Hpy178III* MseI T K L L E R L N S P P E I L V D G I L S R S C * K G * T V L L K S W * M V S * A E V V R K V E Q S S * N L G R W Y L K Q ----:----|----:----|----:----|----:----|----:----|----:----| V F N N S L N F L G G S I K T S P I K L S S T T L F T S C D E Q F R P L H Y R L R L Q * F P Q V T R R F D Q Y I T D * A MboI | DpnI | |BstKTI | || MboI BssKI | || | DpnI CviJI | || | MboII EcoRII | || | |TspDTI | ScrFI | || | |BstKTI Tsp4CI* | BseBI Tsp4CI* | || | || BinI* \ \ \ \ \ \\ \ \\ \ AGATTTACCGTGATAAAGCCTGGACAGTTTGGAAGATCAAAGGATCGCTCCTATTTCATT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAAATGGCACTATTTCGGACCTGTCAAACCTTCTAGTTTCCTAGCGAGGATAAAGTAA / / / / / // / // / / Tsp4CI* | | | Tsp4CI* || MboI || MboI BinI* | | EcoRII |DpnI |DpnI | | BssKI BstKTI BstKTI | BseBI TspDTI | ScrFI MboII CviJI R F T V I K P G Q F G R S K D R S Y F I D L P * * S L D S L E D Q R I A P I S L I Y R D K A W T V W K I K G S L L F H * ----:----|----:----|----:----|----:----|----:----|----:----| L N V T I F G P C N P L D F S R E * K M C I * R S L A Q V T Q F I L P D S R N * S K G H Y L R S L K S S * L I A G I E N CviRI* MboII | EcoT22I |TspDTI | |TspDTI \\ \ \\ GACCCACAAAATGAAGATAAAATCTTATGCTACATCTTGGCAATCATAATGCATTTGGAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGGTGTTTTACTTCTATTTTAGAATACGATGTAGAACCGTTAGTATTACGTAAACCTA / / // TspDTI | |TspDTI MboII | CviRI* EcoT22I D P Q N E D K I L C Y I L A I I M H L D T H K M K I K S Y A T S W Q S * C I W I P T K * R * N L M L H L G N H N A F G * ----:----|----:----|----:----|----:----|----:----|----:----| S G C F S S L I K H * M K A I M I C K S Q G V F H L Y F R I S C R P L * L A N P V W L I F I F D * A V D Q C D Y H M Q I DdeI Bpu10I TspEI SetI Hin4II* \ \ \ \ AACTTCATTGTTGAAATCACACCCTTAGCACACGAATTGAACTTGAAACCTTCCAAAGTT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAAGTAACAACTTTAGTGTGGGAATCGTGTGCTTAACTTGAACTTTGGAAGGTTTCAA / / / / Bpu10I TspEI SetI Hin4II* DdeI N F I V E I T P L A H E L N L K P S K V T S L L K S H P * H T N * T * N L P K L L H C * N H T L S T R I E L E T F Q S C ----:----|----:----|----:----|----:----|----:----|----:----| L K M T S I V G K A C S N F K F G E L T Y S * Q Q F * V R L V R I S S S V K W L V E N N F D C G * C V F Q V Q F R G F N Tsp4CI* |BglI |MwoI ||BseMII |||BspCNI ||||CviJI |||||SmlI |||||TspRI ||||||MnlI ||||||| AluI ||||||| CviJI Bce83I* ||||||| |DdeI | HgiCI* ||||||| |BbvCI Csp6I | | SetI ||||||| |Bpu10I |RsaI | | NlaIV ||||||| ||SetI \\ \ \ \ \\\\\\\ \\\ GTCAGTTTGTTCAGGGTACTTGGTGCTATTGTCAAAGGTGCCACAGTGGCTCAAGCTGAG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTCAAACAAGTCCCATGAACCACGATAACAGTTTCCACGGTGTCACCGAGTTCGACTC // / / / / //// // /// / |Csp6I | | | | |||| || ||| Bpu10I RsaI | | | | |||| || ||| BbvCI | | | | |||| || ||| DdeI | | | | |||| || ||CviJI | | | | |||| || ||AluI | | | | |||| || |SmlI | | | | |||| || SetI | | | | |||| |MnlI | | | | |||| CviJI | | | | |||BspCNI | | | | ||BseMII | | | | |Tsp4CI* | | | | MwoI | | | | BglI | | | HgiCI* | | | TspRI | | NlaIV | SetI Bce83I* V S L F R V L G A I V K G A T V A Q A E S V C S G Y L V L L S K V P Q W L K L R Q F V Q G T W C Y C Q R C H S G S S * G ----:----|----:----|----:----|----:----|----:----|----:----| T L K N L T S P A I T L P A V T A * A S Q * N T * P V Q H * Q * L H W L P E L Q D T Q E P Y K T S N D F T G C H S L S L TatI |Csp6I ||RsaI ||ScaI ||| SfeI* ||| | TseI ||| | CviRI* ||| | |BisI ||| | ||BlsI ||| | ||PstI ||| | |||AluI PsiI BsmI ||| | |||CviJI | BbvI CviJI | BarI ||| | |||| SetI | |TspEI BarI \ \ \ \\\ \ \\\\ \ \ \\ \ GCTTTTGGCATTCCAAAAAGTACTGCAGCTTCTTATAAAATTGCCACTATGAAAGTTCCA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAAACCGTAAGGTTTTTCATGACGTCGAAGAATATTTTAACGGTGATACTTTCAAGGT / // /// //// / / // | |BarI ||| |||CviJI | | |TspEI | BsmI ||| |||TseI | | BbvI CviJI ||| |||AluI | BarI ||| ||SfeI* PsiI ||| ||BisI ||| |BlsI ||| |SetI ||| CviRI* ||TatI ||PstI |Csp6I ScaI RsaI A F G I P K S T A A S Y K I A T M K V P L L A F Q K V L Q L L I K L P L * K F H F W H S K K Y C S F L * N C H Y E S S I ----:----|----:----|----:----|----:----|----:----|----:----| A K P M G F L V A A E * L I A V I F T G P K Q C E L F Y Q L K K Y F Q W * S L E S K A N W F T S C S R I F N G S H F N W AsuI* AvaII MseI |MboII | TspDTI |BmgT120I | | AluI || MboII | | CviJI Ksp632I* || |MaeII | | | SetI | Ksp632I* || || SetI | | | | SetI |MnlI |MnlI ||SetI || TaiI \ \ \ \ \ \\ \\ \\\ \\ \ TTTAAGCTACCTGAAATGACAAGAAGAGGAAGAGGTCCAAGACGTTAG 1210 1220 1230 1240 ----:----|----:----|----:----|----:----|----:--- AAATTCGATGGACTTTACTGTTCTTCTCCTTCTCCAGGTTCTGCAATC / / / / / / / / / / // // / | | | SetI | | | | | | || || MaeII | | CviJI | | | | | | || |TaiI | | AluI | | | | | | || |SetI | MseI | | | | | | || MboII | SetI | | | | | | |AvaII TspDTI | | | | | | |AsuI* | | | | | | BmgT120I | | | | | MboII | | | | SetI | | | Ksp632I* | | MnlI | Ksp632I* MnlI F K L P E M T R R G R G P R R * L S Y L K * Q E E E E V Q D V X * A T * N D K K R K R S K T L X ----:----|----:----|----:----|----:----|----:--- N L S G S I V L L P L P G L R * M * A V Q F S L F L F L D L V N K L * R F H C S S S S T W S T L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 1 AluI 6 AluBI ApoI 2 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BarI 1 BbvCI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BccI 2 Bce83I* 1 BpuEI BceAI 1 BciVI 1 BfuI BdaI 2 BfiI 2 BmrI,BmuI BglI 1 BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmeT110I 1 BmgT120I 3 BplI 2 Bpu10I 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BsrI 3 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 4 BstXI 1 ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviJI 15 CviKI-1 CviRI* 4 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 4 MalI DsaI* 1 BtgI,BstDSI EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 1 Hin4II* 4 HpyAV HindII 1 HincII HindIII 1 HinfI 6 HphI 2 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 4 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 1 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MfeI 2 MunI MluI 1 MlyI 2 SchI MmeI 2 MnlI 5 MseI 3 Tru1I,Tru9I MwoI 2 HpyF10VI,BstMWI NlaIV 3 BspLI,BmiI,PspN4I PleI 2 PpsI PsiI 1 AanI PstI 1 RsaI 4 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 17 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI TaiI 2 TaqI 4 TaqII 1 TatI 1 TfiI 4 PfeI TseI 1 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 6 TspEI 14 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 3 TscAI XbaI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvrII BaeI BalI BamHI BbvII* BcgI BclI BetI* BmtI BsaAI BsaBI BsaXI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BstAPI BstEII BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI CspCI CviAII DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRV EgeI EheI Esp3I EspI* FalI FaqI FatI FauI FseI FspAI GlaI GsaI GsuI HaeII HhaI Hin6I HinP1I HpaI HpaII Hpy99I HspAI KasI KpnI MauBI McrI* MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NmeAIII NotI NruI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TauI TspMI TstI Tth111I VspI XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769