Restriction Map of CNM67/YNL225C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CNM67/YNL225C on chromosome XIV from coordinates 224469 to 222724.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.28500

EMBOSS_001 FatI BspHI |CviAII ApoI |TspDTI TspEI |Hpy178III* TfiI TaqI MseI |TspDTI || NlaIII HinfI Hpy188I \ \ \\ \\ \ \ \ ATGACTGATTTCGATTTAATGAATTTTCCATTTCATGAGCGTTTGGATTCTCCTGTATCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGACTAAAGCTAAATTACTTAAAAGGTAAAGTACTCGCAAACCTAAGAGGACATAGT / / / / // // / / TaqI | | TspEI || |BspHI HinfI Hpy188I | | ApoI || |FatI TfiI | TspDTI || Hpy178III* MseI || CviAII |NlaIII TspDTI M T D F D L M N F P F H E R L D S P V S * L I S I * * I F H F M S V W I L L Y Q D * F R F N E F S I S * A F G F S C I R ----:----|----:----|----:----|----:----|----:----|----:----| X V S K S K I F K G N * S R K S E G T D X S Q N R N L S N E M E H A N P N E Q I H S I E I * H I K W K M L T Q I R R Y * TsoI | TspGWI | | BstXI | | |MmeI TspEI | | || CviJI | MseI | | || |BsrI FatI | Hin4I CviJI | | || |Hin4I |CviAII \ \ \ \ \ \\ \\ \\ GAGAATGGGGAAATTAAAGACGGAGAGCCAATCCCACAAAACTGGCTAAATGAAAATCAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTACCCCTTTAATTTCTGCCTCTCGGTTAGGGTGTTTTGACCGATTTACTTTTAGTA / // / / / / // // / / Hin4I |MseI | | | | || |CviJI | CviAII TspEI | | | | || BsrI NlaIII | | | | |Hin4I | | | | MmeI | | | BstXI | | TspGWI | TsoI CviJI E N G E I K D G E P I P Q N W L N E N H R M G K L K T E S Q S H K T G * M K I M E W G N * R R R A N P T K L A K * K S C ----:----|----:----|----:----|----:----|----:----|----:----| S F P S I L S P S G I G C F Q S F S F * L S H P F * L R L A L G V F S A L H F D L I P F N F V S L W D W L V P * I F I M MfeI TspEI MseI |MboII NlaIII |HpaI || CviRI* | Hpy188I BccI |HindII || | Eco57I | |TspDTI | SetI |Hpy166II || | Eco57MI \ \\ \ \ \\ \\ \ \ GTCGGAAAATCCATCTTACCTTTATTCGTTAACCCTGAAGATGTCATCAATTGCAACTTT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCCTTTTAGGTAGAATGGAAATAAGCAATTGGGACTTCTACAGTAGTTAACGTTGAAA / / / / // / /// | Hpy188I | BccI |MseI | ||Eco57MI | TspDTI SetI Hpy166II | ||Eco57I FatI HindII | |CviRI* HpaI | TspEI | MfeI MboII V G K S I L P L F V N P E D V I N C N F S E N P S Y L Y S L T L K M S S I A T F R K I H L T F I R * P * R C H Q L Q L F ----:----|----:----|----:----|----:----|----:----|----:----| T P F D M K G K N T L G S S T M L Q L K H R F I W R V K I R * G Q L H * * N C S D S F G D * R * E N V R F I D D I A V K MboI BccI | DpnI BsmAI HinfI | |Hin4I | MlyI | Hin4I | |BstKTI | PleI | |Ksp632I* MboII | || BinI* | |MaeI | ||NdeI HphI |TspDTI | || |TspEI \ \\ \ \\\ \ \\ \ \\ \\ TCCAATGCTAGAGACTCATATGAAGAGAACAAATCACCATCTATGGATCAAATGAATTAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTACGATCTCTGAGTATACTTCTCTTGTTTAGTGGTAGATACCTAGTTTACTTAATA ///// / / / / / // / / / ||||| | | HphI TspDTI | || MboI | TspEI ||||| | Ksp632I* MboII | |DpnI BinI* ||||| | NdeI | BstKTI ||||| HinfI | BccI ||||Hin4I Hin4I |||MaeI ||BsmAI |PleI MlyI S N A R D S Y E E N K S P S M D Q M N Y P M L E T H M K R T N H H L W I K * I M Q C * R L I * R E Q I T I Y G S N E L C ----:----|----:----|----:----|----:----|----:----|----:----| E L A L S E Y S S F L D G D I S * I F * K W H * L S M H L S C I V M * P D F S N G I S S V * I F L V F * W R H I L H I I Hpy178III* | TfiI | HinfI TspDTI | | PfoI | SpeI | | BssKI | |GsuI | | EcoRII | |MaeI | | | ScrFI MaeI | |Eco57MI | | | BseBI \ \ \\ \ \ \ \ GCTAGAAATACTAGTTATCAGGAATCTCCAGGATTACAAGAACGACCAAAAAACGAAAAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGATCTTTATGATCAATAGTCCTTAGAGGTCCTAATGTTCTTGCTGGTTTTTTGCTTTTT // / // / / / / || | |SpeI | | | EcoRII || | MaeI | | | BssKI || Eco57MI | | | PfoI || GsuI | | BseBI |TspDTI | | ScrFI MaeI | HinfI | TfiI Hpy178III* A R N T S Y Q E S P G L Q E R P K N E K L E I L V I R N L Q D Y K N D Q K T K K * K Y * L S G I S R I T R T T K K R K R ----:----|----:----|----:----|----:----|----:----|----:----| A L F V L * * S D G P N C S R G F F S F H * F Y * N D P I E L I V L V V L F R F S S I S T I L F R W S * L F S W F V F F TspDTI BaeI |Csp6I | BsmAI ||RsaI | | TspDTI ||BaeI | | |Csp6I |||BseGI | | ||RsaI |||| TspEI | | ||SetI |||| | FokI \ \ \\\ \\\\ \ \ GATAAGTCTCCCATAGGTACTGATGTTCATAAAAAGGATGTACCCAATTTCATACACTCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTCAGAGGGTATCCATGACTACAAGTATTTTTCCTACATGGGTTAAAGTATGTGAGA / // // // /// / / BaeI || |Csp6I || ||Csp6I | FokI || RsaI || |RsaI TspEI |BsmAI || BseGI TspDTI |TspDTI SetI BaeI D K S P I G T D V H K K D V P N F I H S I S L P * V L M F I K R M Y P I S Y T L * V S H R Y * C S * K G C T Q F H T L Y ----:----|----:----|----:----|----:----|----:----|----:----| S L D G M P V S T * L F S T G L K M C E L Y T E W L Y Q H E Y F P H V W N * V S I L R G Y T S I N M F L I Y G I E Y V R TaqI AsuII MaeI | Ksp632I* | MboII | | MnlI CviJI TspDTI \ \ \ \ \ \ \ ACTCCTAGAGAAAACTCTTCGAAGCATTTTACGAGGGCAAATGAACAGGCTTCTGCTCAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGGATCTCTTTTGAGAAGCTTCGTAAAATGCTCCCGTTTACTTGTCCGAAGACGAGTT / / // / / MboII | |MnlI | TspDTI MaeI | Ksp632I* CviJI AsuII TaqI T P R E N S S K H F T R A N E Q A S A Q L L E K T L R S I L R G Q M N R L L L N S * R K L F E A F Y E G K * T G F C S T ----:----|----:----|----:----|----:----|----:----|----:----| V G L S F E E F C K V L A F S C A E A * * E * L F S K S A N * S P L H V P K Q E S R S F V R R L M K R P C I F L S R S L MaeIII Tsp4CI* |BbvII* || MboII || HgiCI* TspDTI || Tsp4CI* | EcoRV || | NlaIV | | Hpy178III* || | | ApoI BtgZI | | |TaqI || | | TspEI \ \ \ \\ \\ \ \ \ CCAACTGATGAACATACATCGCCAGATATCTCGATAGAAGACTGTAACGGTGCCAAAATT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTGACTACTTGTATGTAGCGGTCTATAGAGCTATCTTCTGACATTGCCACGGTTTTAA / / / // / / / / / BtgZI | | |TaqI | | | HgiCI* TspEI | | | | | NlaIV ApoI | | | | Tsp4CI* | | | | BbvII* | | | | MaeIII | | | | MboII | | | Tsp4CI* | | Hpy178III* | EcoRV TspDTI P T D E H T S P D I S I E D C N G A K I Q L M N I H R Q I S R * K T V T V P K F N * * T Y I A R Y L D R R L * R C Q N F ----:----|----:----|----:----|----:----|----:----|----:----| G V S S C V D G S I E I S S Q L P A L I V L Q H V Y M A L Y R S L L S Y R H W F W S I F M C R W I D R Y F V T V T G F N MnlI TaqI BaeI |TaqI AsuII BaeI BsrI \\ \ \ \ TTTCTACAAAACTCCTTATCGAAAGAGGATTTTCGAATGTTAGAAAATGTGATACTGGGG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGATGTTTTGAGGAATAGCTTTCTCCTAAAAGCTTACAATCTTTTACACTATGACCCC / / / / / | TaqI | BaeI BsrI MnlI | BaeI AsuII TaqI F L Q N S L S K E D F R M L E N V I L G F Y K T P Y R K R I F E C * K M * Y W G S T K L L I E R G F S N V R K C D T G V ----:----|----:----|----:----|----:----|----:----|----:----| K R C F E K D F S S K R I N S F T I S P K E V F S R I S L P N E F T L F H S V P K * L V G * R F L I K S H * F I H Y Q P BaeI BaeI DdeI BfiI | TspEI | MnlI \ \ \ \ \ TATCAAAAAAAAGTTATTGAATTGGGTAGAGATAATCTAAGACAAGAGGAAAGAGCAAAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGTTTTTTTTCAATAACTTAACCCATCTCTATTAGATTCTGTTCTCCTTTCTCGTTTG / / / / / BfiI BaeI TspEI | DdeI BaeI MnlI Y Q K K V I E L G R D N L R Q E E R A N I K K K L L N W V E I I * D K R K E Q T S K K S Y * I G * R * S K T R G K S K L ----:----|----:----|----:----|----:----|----:----|----:----| Y * F F T I S N P L S L R L C S S L A F T D F F L * Q I P Y L Y D L V L P F L L I L F F N N F Q T S I I * S L L F S C V AluI CviJI Ecl136II | TaqI | SetI | SduI | SacI | HgiAI* | HgiJII* | | TseI | | |BisI | | ||BlsI | | |||AluI | | |||CviJI DdeI | | |||| SetI BbvI |SetI \ \ \\\\ \ \ \\ TCTTTACAAAAGGAGCTCGAAGCAGCTACGAAGTCAAACGACAAAACCTTAGATAACAAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAATGTTTTCCTCGAGCTTCGTCGATGCTTCAGTTTGCTGTTTTGGAATCTATTGTTT / / / /// / / / | | | ||CviJI BbvI SetI DdeI | | | ||TseI | | | ||AluI | | | |BisI | | | BlsI | | | SetI | | TaqI | Ecl136II | CviJI | AluI HgiJII* HgiAI* SacI SduI SetI S L Q K E L E A A T K S N D K T L D N K L Y K R S S K Q L R S Q T T K P * I T K F T K G A R S S Y E V K R Q N L R * Q K ----:----|----:----|----:----|----:----|----:----|----:----| E K C F S S S A A V F D F S L V K S L L S K V F P A R L L * S T L R C F R L Y C R * L L L E F C S R L * V V F G * I V F SetI | EcoNI | | BsiYI* | | | AsuI* | | | AvaII | | | DraII | | | PpuMI | | | |BmgT120I Tsp4CI* | | | || MmeI TspEI |MboII | | | || SetI \ \\ \ \ \ \\ \ AAAAAAATTGAAGAACAGACAGTATTGATTGAAAACCTAACAAAGGACCTTTCGCTGAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTTAACTTCTTGTCTGTCATAACTAACTTTTGGATTGTTTCCTGGAAAGCGACTTA / // / / / /// TspEI |MboII SetI | | ||PpuMI Tsp4CI* | | ||DraII | | ||AvaII | | ||AsuI* | | ||MmeI | | |BmgT120I | | SetI | EcoNI BsiYI* K K I E E Q T V L I E N L T K D L S L N K K L K N R Q Y * L K T * Q R T F R * I K N * R T D S I D * K P N K G P F A E * ----:----|----:----|----:----|----:----|----:----|----:----| F F I S S C V T N I S F R V F S R E S F F F F Q L V S L I S Q F G L L P G K A S F F N F F L C Y Q N F V * C L V K R Q I BtsI | BdaI | BdaI | | CviRI* BdaI | | | TspRI BdaI CviJI Hpy188I | | | | DdeI \ \ \ \ \ \ \ \ AAAGAAATGTTGGAAAAAGCCAATGATACTATTCAGACAAAACACACTGCATTACTAAGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTTACAACCTTTTTCGGTTACTATGATAAGTCTGTTTTGTGTGACGTAATGATTCA / / / / / / / / BdaI CviJI Hpy188I | | CviRI* | TspRI BdaI | BdaI DdeI | BdaI TspRI BtsI K E M L E K A N D T I Q T K H T A L L S K K C W K K P M I L F R Q N T L H Y * V R N V G K S Q * Y Y S D K T H C I T K S ----:----|----:----|----:----|----:----|----:----|----:----| L S I N S F A L S V I * V F C V A N S L Y L F T P F L W H Y * E S L V C Q M V L F F H Q F F G I I S N L C F V S C * * T MlyI PleI | BsmAI CviJI | | HinfI HaeIII | | | TspRI | AjuI | | | | SmlI | |AluI | | | | AflII | |CviJI AjuI | | | | |MseI | || SetI NmeAIII |TaqI \ \ \ \ \\ \ \\ \ \ \\ CTCACTGACTCCTTAAGAAAGGCCGAGCTGTTTGAAATACCGATTGGTATATTGTTTTTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTGACTGAGGAATTCTTTCCGGCTCGACAAACTTTATGGCTAACCATATAACAAAAAG // / / // // / / / / |PleI | | || || | CviJI | AjuI MlyI | | || || | AluI NmeAIII | | || || SetI | | || |HaeIII | | || |CviJI | | || AjuI | | |AflII | | |SmlI | | MseI | HinfI BsmAI L T D S L R K A E L F E I P I G I L F F S L T P * E R P S C L K Y R L V Y C F S H * L L K K G R A V * N T D W Y I V F R ----:----|----:----|----:----|----:----|----:----|----:----| R V S E K L F A S S N S I G I P I N N K D * Q S R L F P R A T Q F V S Q Y I T K E S V G * S L G L Q K F Y R N T Y Q K E MnlI |HinfI || Hpy188I TspEI || | MboII | MboI MlyI || | | ApoI | | DpnI PleI || | | TspEI | | |BstKTI \ \\ \ \ \ \ \ \\ GATTTGTATGACTCGGAGGAAAATTCTTCAAAATTAGATCACATATTACAAGAAAAATAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAACATACTGAGCCTCCTTTTAAGAAGTTTTAATCTAGTGTATAATGTTCTTTTTATA / // / // / / / // / | || MnlI || MboII TspEI | || MboI | |PleI |Hpy188I ApoI | |DpnI | MlyI HinfI | BstKTI TaqI TspEI D L Y D S E E N S S K L D H I L Q E K Y I C M T R R K I L Q N * I T Y Y K K N I F V * L G G K F F K I R S H I T R K I S ----:----|----:----|----:----|----:----|----:----|----:----| S K Y S E S S F E E F N S * M N C S F Y R N T H S P P F N K L I L D C I V L F I I Q I V R L F I R * F * I V Y * L F F I SapI Ksp632I* | SfaNI | BseMII | |BspCNI | || MwoI | || | AluI | || | CviJI | || | |DdeI | || | |EspI* | || | ||SetI | || | ||| CviJI | || | ||| |AciI | || | ||| |BisI | || | ||| ||BlsI SspI | || | ||| ||MboII | MseI CviRI* | || | ||| |||TauI DdeI \ \ \ \ \\ \ \\\ \\\\ \ CCTAATATTAAAGGGTTTTTATGTGCATCACAGCAAGAAGAGCTGAGCCGCATTTCTCAG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GGATTATAATTTCCCAAAAATACACGTAGTGTCGTTCTTCTCGACTCGGCGTAAAGAGTC / / / // // / / / ///// / | MseI CviRI* || || | | | ||||AciI DdeI SspI || || | | | |||BisI || || | | | ||MboII || || | | | ||BlsI || || | | | |CviJI || || | | | |TauI || || | | | EspI* || || | | | DdeI || || | | CviJI || || | | AluI || || | SetI || || SfaNI || |MwoI || Ksp632I* || SapI |BspCNI BseMII P N I K G F L C A S Q Q E E L S R I S Q L I L K G F Y V H H S K K S * A A F L S * Y * R V F M C I T A R R A E P H F S A ----:----|----:----|----:----|----:----|----:----|----:----| G L I L P N K H A D C C S S S L R M E * D * Y * L T K I H M V A L L A S G C K E R I N F P K * T C * L L F L Q A A N R L MseI |AhaIII* || BspCNI || |BseMII || || CviRI* || || | BseMII || || | |BspCNI || || | || MnlI || || | || | AluI || || | || | CviJI || || | || | AlwNI || || | || | |DdeI || || | || | |BbvCI || || | || | |Bpu10I || || | || | ||SetI || || | || | ||| MboI || || | || | ||| XhoII || || | || | ||| | DpnI || || | || | ||| | |BstKTI || || | || | ||| | || Hpy188I || || | || | ||| | || |BinI* TspEI \\ \\ \ \\ \ \\\ \ \\ \\ \ CGATTTAAAAATGCAAAAGCAGAAGCTGAGGATCTCCGAAATGAGTTAGAGAATAAAAAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GCTAAATTTTTACGTTTTCGTCTTCGACTCCTAGAGGCTTTACTCAATCTCTTATTTTTT /// / // / // / / // / / / ||| | || | || | | || | | BinI* ||| | || | || | | || | Hpy188I ||| | || | || | | || XhoII ||| | || | || | | || MboI ||| | || | || | | |DpnI ||| | || | || | | BstKTI ||| | || | || | Bpu10I ||| | || | || | BbvCI ||| | || | || | DdeI ||| | || | || CviJI ||| | || | || AluI ||| | || | |SetI ||| | || | AlwNI ||| | || MnlI ||| | |BspCNI ||| | BseMII ||| CviRI* ||BseMII |BspCNI |MseI AhaIII* R F K N A K A E A E D L R N E L E N K K D L K M Q K Q K L R I S E M S * R I K K I * K C K S R S * G S P K * V R E * K N ----:----|----:----|----:----|----:----|----:----|----:----| R N L F A F A S A S S R R F S N S F L F A I * F H L L L L Q P D G F H T L S Y F S K F I C F C F S L I E S I L * L I F F Hpy178III* | FatI | |CviAII MseI Csp6I | || NlaIII |TspEI |RsaI \ \\ \ \\ \\ ATTGAAATCCAGACCATGAGAGAAAAAAATAATACTTTAATTGGTACAAATAAAACCCTT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTTTAGGTCTGGTACTCTCTTTTTTTATTATGAAATTAACCATGTTTATTTTGGGAA / / / // / / // TspEI | | |FatI | | |Csp6I | | CviAII | | RsaI | NlaIII | TspEI Hpy178III* MseI I E I Q T M R E K N N T L I G T N K T L L K S R P * E K K I I L * L V Q I K P F * N P D H E R K K * Y F N W Y K * N P F ----:----|----:----|----:----|----:----|----:----|----:----| I S I W V M L S F F L V K I P V F L V R F Q F G S W S L F F Y Y K L Q Y L Y F G N F D L G H S F F I I S * N T C I F G K HindII Hpy166II | TaqI ApoI | ClaI ApoI TspEI | |Hin4II* TspEI \ \ \\ \ TCCAAACAGAACAAAATACTATGTGATAAATTTGACAAGTTGACAATCGATGAGAAGGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTTGTCTTGTTTTATGATACACTATTTAAACTGTTCAACTGTTAGCTACTCTTCCTT / / / / TspEI | | ClaI ApoI | | TaqI | Hin4II* Hpy166II HindII S K Q N K I L C D K F D K L T I D E K E P N R T K Y Y V I N L T S * Q S M R R K Q T E Q N T M * * I * Q V D N R * E G N ----:----|----:----|----:----|----:----|----:----|----:----| E L C F L I S H S L N S L N V I S S F S K W V S C F V I H Y I Q C T S L R H S P G F L V F Y * T I F K V L Q C D I L L F TspEI | MseI | | AluI MnlI | | CviJI | BseGI FokI | | | SetI SetI MaeI \ \ \ \ \ \ \ \ \ ATTTTGAAAGGATGTAATGAGGAAATAAAAATTAAGCTGGAAAGGTTGAATGAAAGACTA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAACTTTCCTACATTACTCCTTTATTTTTAATTCGACCTTTCCAACTTACTTTCTGAT / / / / // / / / TspEI | BseGI FokI || CviJI SetI MaeI ApoI MnlI || AluI |MseI |SetI TspEI I L K G C N E E I K I K L E R L N E R L F * K D V M R K * K L S W K G * M K D * F E R M * * G N K N * A G K V E * K T R ----:----|----:----|----:----|----:----|----:----|----:----| I K F P H L S S I F I L S S L N F S L S F K S L I Y H P F L F * A P F T S H F V N Q F S T I L F Y F N L Q F P Q I F S * MboI | DpnI | |FatI | |BstKTI | ||CviAII | ||TspDTI | ||| NlaIII SfaNI | ||| |BinI* Hin4II* | NheI \ \\\ \\ \ \ \ GGATCATGGGAAAAAAGCAAAGAAAAATACGAAACATCATTGAAGGATAAAGAAAAAATG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAGTACCCTTTTTTCGTTTCTTTTTATGCTTTGTAGTAACTTCCTATTTCTTTTTTAC //// // / / / |||| || BinI* Hin4II* BmtI |||| |FatI |||| CviAII |||MboI ||NlaIII |TspDTI |DpnI BstKTI G S W E K S K E K Y E T S L K D K E K M D H G K K A K K N T K H H * R I K K K C I M G K K Q R K I R N I I E G * R K N A ----:----|----:----|----:----|----:----|----:----|----:----| P D H S F L L S F Y S V D N F S L S F I L I M P F F C L F I R F M M S P Y L F F S * P F F A F F F V F C * Q L I F F F H SetI MaeI MnlI |Hpy178III* |Cac8I BsrI ||NruI || BmtI AlwNI |TspEI ||FnuDII* \\ \ \ \\ \\\ CTAGCAGATGCTGAAAAGAAAACAAACACTCTATCAAAGGAACTGGATAATTTGAGGTCG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GATCGTCTACGACTTTTCTTTTGTTTGTGAGATAGTTTCCTTGACCTATTAAACTCCAGC //// / // / / / |||| AlwNI |MnlI | SetI FnuDII* |||NheI BsrI TspEI NruI ||MaeI |Cac8I SfaNI L A D A E K K T N T L S K E L D N L R S * Q M L K R K Q T L Y Q R N W I I * G R S R C * K E N K H S I K G T G * F E V A ----:----|----:----|----:----|----:----|----:----|----:----| S A S A S F F V F V R D F S S S L K L D A L L H Q F S F L C E I L P V P Y N S T * C I S F L F C V S * * L F Q I I Q P R MnlI | DdeI XmnI Hpy188I Tsp4CI* \ \ \ \ \ CGATTTGGAAACTTAGAGGGAAATACTTCTGAAAGGATTACAATAAAAAATATCTTACAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GCTAAACCTTTGAATCTCCCTTTATGAAGACTTTCCTAATGTTATTTTTTATAGAATGTC / / / / / / | MnlI DdeI XmnI Hpy188I Tsp4CI* Hpy178III* R F G N L E G N T S E R I T I K N I L Q D L E T * R E I L L K G L Q * K I S Y S I W K L R G K Y F * K D Y N K K Y L T V ----:----|----:----|----:----|----:----|----:----|----:----| R N P F K S P F V E S L I V I F F I K C A I Q F S L P F Y K Q F S * L L F Y R V S K S V * L S I S R F P N C Y F I D * L AsuI* |CviJI TspEI |HaeIII TspEI | TfiI |BmgT120I | MboII | HinfI \\ \ \ \ \ TCAAGGCCCGATATTTCGGCAGAAGAATGTAATTTCCTTATGGTTGAACAAATTGATTCA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTCCGGGCTATAAAGCCGTCTTCTTACATTAAAGGAATACCAACTTGTTTAACTAAGT /// // / / ||AsuI* |TspEI | HinfI |BmgT120I MboII | TfiI HaeIII TspEI CviJI S R P D I S A E E C N F L M V E Q I D S Q G P I F R Q K N V I S L W L N K L I Q K A R Y F G R R M * F P Y G * T N * F S ----:----|----:----|----:----|----:----|----:----|----:----| D L G S I E A S S H L K R I T S C I S E T L A R Y K P L L I Y N G * P Q V F Q N * P G I N R C F F T I E K H N F L N I * ApoI TspEI Tsp4CI* TspEI CviJI \ \ \ \ GCAAATTTGACGACTTTACAAAATACTGTCAAAGAAATTGTTTTGGCTGTTGGTATTCCT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTAAACTGCTGAAATGTTTTATGACAGTTTCTTTAACAAAACCGACAACCATAAGGA / / / / TspEI Tsp4CI* TspEI CviJI ApoI A N L T T L Q N T V K E I V L A V G I P Q I * R L Y K I L S K K L F W L L V F L K F D D F T K Y C Q R N C F G C W Y S L ----:----|----:----|----:----|----:----|----:----|----:----| A F K V V K C F V T L S I T K A T P I G L L N S S K V F Y Q * L F Q K P Q Q Y E C I Q R S * L I S D F F N N Q S N T N R TfiI MseI HinfI Cac8I FatI | TspGWI |TsoI | CviJI TspEI |CviAII \ \ \\ \ \ \ \\ TATCCAAAGTTAAGGCGAAAGATTCCGTTGCTGGCTATCAAATTGAAATATGAAAACATC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGGTTTCAATTCCGCTTTCTAAGGCAACGACCGATAGTTTAACTTTATACTTTTGTAG / / / / / / / TspGWI | HinfI | CviJI TspEI NlaIII MseI | TfiI Cac8I TsoI Y P K L R R K I P L L A I K L K Y E N I I Q S * G E R F R C W L S N * N M K T S S K V K A K D S V A G Y Q I E I * K H H ----:----|----:----|----:----|----:----|----:----|----:----| * G F N L R F I G N S A I L N F Y S F M K D L T L A F S E T A P * * I S I H F C I W L * P S L N R Q Q S D F Q F I F V D MaeII NlaIII | SetI Hpy178III* | TspDTI | TaiI | TfiI | | TspEI | | CviRI* | HinfI \ \ \ \ \ \ \ \ ATGCTGTCCAATTTTGCTCAACGTCTGCATAGACAAGTATATAGTCAAGAAATGAATCTA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TACGACAGGTTAAAACGAGTTGCAGACGTATCTGTTCATATATCAGTTCTTTACTTAGAT // / / / / / / |TspDTI TspEI | | CviRI* | HinfI |FatI | MaeII | TfiI CviAII TaiI Hpy178III* SetI M L S N F A Q R L H R Q V Y S Q E M N L C C P I L L N V C I D K Y I V K K * I * A V Q F C S T S A * T S I * S R N E S K ----:----|----:----|----:----|----:----|----:----|----:----| M S D L K A * R R C L C T Y L * S I F R * A T W N Q E V D A Y V L I Y D L F S D H Q G I K S L T Q M S L Y I T L F H I * ApoI TspEI | TspDTI | | MboI HindII | | | DpnI Hpy166II Hin4I | | | |BstKTI | BccI Hin4I | | | || Hin4I | Hin6I |TfiI | | | || Hin4I | FnuDII* |HinfI | | | || |BinI* | |GlaI ||BseGI MboI | | | || || TspGWI | ||HhaI ||| HphI FokI \ \ \ \\ \\ \ \ \\\ \\\ \ \ AAGAAATTTACGGATCAAGCATACTATGATTTTATGTCAACGCGCAGGATGGATTCCATA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTAAATGCCTAGTTCGTATGATACTAAAATACAGTTGCGCGTCCTACCTAAGGTAT / / // / / / / /// / / // | | || MboI | TspGWI | ||| | | |HinfI | | |Hin4I BinI* | ||| | | |TfiI | | |Hin4I | ||| | | HphI | | |DpnI | ||| | BseGI | | BstKTI | ||| Hin4I | TspEI | ||| Hin4I | ApoI | ||Hin6I TspDTI | |GlaI | |BccI | FnuDII* | HhaI Hpy166II HindII K K F T D Q A Y Y D F M S T R R M D S I R N L R I K H T M I L C Q R A G W I P * E I Y G S S I L * F Y V N A Q D G F H R ----:----|----:----|----:----|----:----|----:----|----:----| F F N V S * A Y * S K I D V R L I S E M L S I * P D L M S H N * T L A C S P N W L F K R I L C V I I K H * R A P H I G Y SetI | Hpy178III* | | AsuI* | | AvaII | | |BmgT120I | | || MslI | | || | BccI | | || | |MboI | | || | |BclI | | || | || DpnI | | || | || |BstKTI | | || | || || PfoI | | || | || || BssKI | | || | || || EcoRII DpnI | | || | || || | ScrFI |BstKTI | | || | || || | BseBI || MnlI | | || | || || | | BccI \\ \ \ \ \\ \ \\ \\ \ \ \ GATCACCATTTGGAGAGGTGTCTGGACCATCTGTATGATCATATCCTGGAGAAGATGGTG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGTGGTAAACCTCTCCACAGACCTGGTAGACATACTAGTATAGGACCTCTTCTACCAC // / / / / // / /// / / / || | MnlI SetI | || | ||| BclI | EcoRII || FokI | || | ||| MboI | BssKI || MboI | || | ||DpnI | PfoI |DpnI | || | |BstKTI | BccI BstKTI | || | BccI BseBI | || MslI ScrFI | |AvaII | |AsuI* | BmgT120I Hpy178III* D H H L E R C L D H L Y D H I L E K M V I T I W R G V W T I C M I I S W R R W * S P F G E V S G P S V * S Y P G E D G E ----:----|----:----|----:----|----:----|----:----|----:----| S * W K S L H R S W R Y S * I R S F I T L D G N P S T D P G D T H D Y G P S S P I V M Q L P T Q V M Q I I M D Q L L H H MboII \ AAGTAA ----:- TTCATT / MboII K * S X V X ----:- F Y S T L L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 1 DraI AjuI 1 AluI 6 AluBI AlwNI 2 CaiI ApoI 7 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 3 BbvCI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 5 BclI 1 FbaI,Ksp22I BdaI 2 BfiI 1 BmrI,BmuI BinI* 4 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 3 BmtI 1 BspOI Bpu10I 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 3 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 3 Alw26I,BstMAI BspCNI 3 BspHI 1 CciI,PagI,RcaI BsrI 3 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 7 BstXI 1 BtgZI 1 BtsI 1 Cac8I 2 BstC8I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 3 CviQI,RsaNI CviAII 5 CviJI 15 CviKI-1 CviRI* 5 HpyCH4V DdeI 7 BstDEI,HpyF3I DpnI 7 MalI DraII 1 EcoO109I Ecl136II 1 EcoICRI Eco57I 1 AcuI Eco57MI 2 EcoNI 1 BstENI,XagI EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 5 FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 1 GsuI 1 BpmI HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 2 HpyAV Hin6I 1 HinP1I,HspAI HindII 3 HincII HinfI 9 HpaI 1 KspAI HphI 2 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 6 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 6 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 1 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 9 MfeI 1 MunI MlyI 3 SchI MmeI 2 MnlI 9 MseI 9 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NdeI 1 FauNDI NheI 1 AsuNHI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NmeAIII 1 NruI 1 BtuMI,Bsp68I PfoI 2 PleI 3 PpsI PpuMI 1 Psp5II,PspPPI RsaI 3 AfaI SacI 1 Psp124BI,SstI SapI 1 LguI,PciSI,BspQI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SetI 15 SfaNI 2 LweI SmlI 1 SmoI SpeI 1 BcuI,AhlI SspI 1 TaiI 1 TaqI 8 TauI 1 TfiI 6 PfeI TseI 1 ApeKI TsoI 2 Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 12 TspEI 23 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 2 TscAI XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflIII AgeI AlfI AloI ApaI ApaLI AscI Asp718I AvaI AvrII BalI BamHI BarI Bce83I* BceAI BcgI BciVI BetI* BglI BglII BmeT110I BplI BsaAI BsaBI BsaXI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstZ17I BtrI CauII* Cfr10I Cfr9I CfrI CspCI DinI DraIII DrdI DsaI* Eam1105I EciI Eco31I Eco47III EcoP15I EcoRI EcoT22I EgeI EheI Esp3I FalI FaqI FauI FseI FspAI GsaI HaeII HgaI HindIII HpaII Hpy99I KasI KpnI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NcoI NgoMIV NotI NsiI NspBII* NspI OliI PacI PasI PflMI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacII SalI SanDI SauI* ScaI SecI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TatI Tsp45I TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769