Restriction Map of NNR1/YNL200C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

NNR1/YNL200C on chromosome XIV from coordinates 264453 to 263713.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.11628

EMBOSS_001 HindIII | AluI | CviJI | | SetI | | Cac8I | | | TseI | | | CviRI* | | | |BisI | | | ||BlsI | | | |||AluI | | | |||CviJI | | | |||PvuII AccI | | | |||NspBII* |Hpy166II | | | |||| TaqI || MaeII | | | |||| | BbvI || | SetI | | | |||| | | Hin4I || | TaiI | | | |||| | | | BccI || | |TspDTI | | | |||| SetI | | | |TspEI \\ \ \\ \ \ \ \\\\ \ \ \ \ \\ ATGTCTACGTTGAAAGTTGTTTCATCAAAGCTTGCAGCTGAAATCGACAAAGAATTGATG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGATGCAACTTTCAACAAAGTAGTTTCGAACGTCGACTTTAGCTGTTTCTTAACTAC // / / / / //// / / / / / || TspDTI | | | |||| | | | | TspEI || MaeII | | | |||| | | | BccI |AccI | | | |||| | | BbvI |TaiI | | | |||| | TaqI |SetI | | | |||| Hin4I Hpy166II | | | |||NspBII* | | | |||PvuII | | | |||CviJI | | | |||TseI | | | |||AluI | | | ||BisI | | | |BlsI | | | |SetI | | | CviRI* | | HindIII | | Cac8I | CviJI | AluI SetI M S T L K V V S S K L A A E I D K E L M C L R * K L F H Q S L Q L K S T K N * W V Y V E S C F I K A C S * N R Q R I D G ----:----|----:----|----:----|----:----|----:----|----:----| X D V N F T T E D F S A A S I S L S N I X T * T S L Q K M L A Q L Q F R C L I S H R R Q F N N * * L K C S F D V F F Q H AsuI* AvaII DraII PpuMI |NlaIV |BmgT120I || BsiYI* AluI || | Hpy188I BseYI Hin6I || | |TfiI AluI CviJI FnuDII* || | |MnlI CviJI | SetI |GlaI || | |HinfI Hin4I | SetI | | GsaI ||HhaI \\ \ \\ \ \ \ \ \ \ \\\ GGTCCTCAAATCGGATTCACTCTACAACAGCTAATGGAGTTAGCTGGGTTTAGTGTCGCG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGGAGTTTAGCCTAAGTGAGATGTTGTCGATTACCTCAATCGACCCAAATCACAGCGC /// / // / / / / / / / /// ||| | || | HinfI | CviJI | | BseYI ||Hin6I ||| | || | TfiI | AluI | CviJI |GlaI ||| | || Hin4I SetI | AluI FnuDII* ||| | |MnlI | GsaI HhaI ||| | Hpy188I SetI ||| BsiYI* ||PpuMI ||DraII ||AvaII ||AsuI* |BmgT120I NlaIV G P Q I G F T L Q Q L M E L A G F S V A V L K S D S L Y N S * W S * L G L V S R S S N R I H S T T A N G V S W V * C R A ----:----|----:----|----:----|----:----|----:----|----:----| P G * I P N V R C C S I S N A P N L T A P D E F R I * E V V A L P T L Q T * H R T R L D S E S * L L * H L * S P K T D R BsrI |BseMII ||BspCNI FatI ||| MnlI AflIII ||| | DdeI BspLU11I* Cac8I ||| | | BsiYI* |CviAII | CviJI ||| | | |TspRI |TspGWI \ \ \\\ \ \ \\ \\ CAGGCTGTATGTCGCCAGTTTCCACTGAGAGGCAAGACAGAAACGGAAAAGGGCAAACAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCGACATACAGCGGTCAAAGGTGACTCTCCGTTCTGTCTTTGCCTTTTCCCGTTTGTA / / /// // / / // / | CviJI ||| || | DdeI || CviAII Cac8I ||| || BsiYI* |NlaIII ||| |MnlI |NspI ||| TspRI TspGWI ||BspCNI |BseMII BsrI Q A V C R Q F P L R G K T E T E K G K H R L Y V A S F H * E A R Q K R K R A N M G C M S P V S T E R Q D R N G K G Q T C ----:----|----:----|----:----|----:----|----:----|----:----| C A T H R W N G S L P L V S V S F P L C A P Q I D G T E V S L C S L F P F P C V L S Y T A L K W Q S A L C F R F L A F M BseYI | AsuI* | |GsaI | |BmgT120I | ||BssKI BseGI | ||CviJI |BsiI* | ||EcoRII || BsmAI | ||HaeIII || Eco31I | ||| ScrFI || | FokI | ||| BseBI || | |Hin6I | ||| | MaeIII || | ||GlaI NspI | ||| | | SetI BccI || | ||MstI* NlaIII | ||| | | |FauI |AciI || | |||HhaI \ \ \\\ \ \ \\ \\ \\ \ \\\\ GTATTTGTTATTGCTGGGCCAGGTAACAATGGCGGGGATGGTCTCGTGTGCGCAAGACAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CATAAACAATAACGACCCGGTCCATTGTTACCGCCCCTACCAGAGCACACGCGTTCTGTA / / ///// / / / / / / //// / BspLU11I* | ||||| | | | AciI BseGI | |||FokI TsoI AflIII | ||||| | | BccI | ||Hin6I FatI | ||||| | MaeIII | |MstI* | ||||| | FauI | |GlaI | ||||| EcoRII | Eco31I | ||||| BssKI | BsmAI | ||||BseBI | HhaI | ||||ScrFI BsiI* | |||SetI | ||AsuI* | |BmgT120I | |HaeIII | |CviJI | BseYI GsaI V F V I A G P G N N G G D G L V C A R H Y L L L L G Q V T M A G M V S C A Q D I I C Y C W A R * Q W R G W S R V R K T F ----:----|----:----|----:----|----:----|----:----|----:----| T N T I A P G P L L P P S P R T H A L C H I Q * Q Q A L Y C H R P H D R T R L V Y K N N S P W T V I A P I T E H A C S M TsoI | HindIII Cac8I ApoI | | AluI | Hin6I TspEI | | CviJI | |GlaI EcoRI | | | SetI MaeIII | ||HhaI | TspRI \ \ \ \ \ \ \\\ \ \ TTGAAGCTTTTTGGTTACAACCCTGTTGTTTTCTACCCCAAGAGAAGCGAGCGCACTGAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTCGAAAAACCAATGTTGGGACAACAAAAGATGGGGTTCTCTTCGCTCGCGTGACTT / / / / / /// | | HindIII MaeIII | ||Hin6I | CviJI | |GlaI | AluI | TspRI SetI | HhaI Cac8I L K L F G Y N P V V F Y P K R S E R T E * S F L V T T L L F S T P R E A S A L N E A F W L Q P C C F L P Q E K R A H * I ----:----|----:----|----:----|----:----|----:----|----:----| K F S K P * L G T T K * G L L L S R V S N S A K Q N C G Q Q K R G W S F R A C Q Q L K K T V V R N N E V G L S A L A S F HphI | AluI | CviJI | PvuII | NspBII* | | SetI | | |BdaI | | |BdaI | | || Hpy166II BdaI | | || | MfeI BdaI | | || | TspEI | SmlI | | || | | ApoI | |MnlI | | || | | TspEI | ||Hpy178III* | | || | | | XmnI Bce83I* | |||BsmAI \ \ \\ \ \ \ \ \ \ \\\\ TTCTACAAACAGCTGGTTCACCAATTGAATTTTTTCAAAGTTCCTGTCCTGTCTCAAGAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AAGATGTTTGTCGACCAAGTGGTTAACTTAAAAAAGTTTCAAGGACAGGACAGAGTTCTA / // // / / / / / / / / EcoRI || |BdaI | | | Bce83I* BdaI | | BsmAI TspEI || |BdaI | | TspEI BdaI | Hpy178III* ApoI || | | | XmnI | SmlI || | | | ApoI MnlI || | | TspEI || | | MfeI || | Hpy166II || NspBII* || PvuII || CviJI || AluI |SetI HphI F Y K Q L V H Q L N F F K V P V L S Q D S T N S W F T N * I F S K F L S C L K M L Q T A G S P I E F F Q S S C P V S R * ----:----|----:----|----:----|----:----|----:----|----:----| N * L C S T * W N F K K L T G T R D * S I R C V A P E G I S N K * L E Q G T E L E V F L Q N V L Q I K E F N R D Q R L I SetI | SfaNI CviJI CviJI | | CviRI* CviRI* |BsrI SspI |HpaII | | | EcoT22I | SspI \\ \ \\ \ \ \ \ \ \ GAGGGAAACTGGCTGGAATATTTGAAGCCGGAAAAGACCTTATGCATTGTAGATGCAATA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCCTTTGACCGACCTTATAAACTTCGGCCTTTTCTGGAATACGTAACATCTACGTTAT // / / / / / / / / / |CviJI SspI | HpaII SetI | | SfaNI | SspI BsrI CviJI | CviRI* CviRI* EcoT22I E G N W L E Y L K P E K T L C I V D A I R E T G W N I * S R K R P Y A L * M Q Y G K L A G I F E A G K D L M H C R C N I ----:----|----:----|----:----|----:----|----:----|----:----| S P F Q S S Y K F G S F V K H M T S A I H P F S A P I N S A P F S R I C Q L H L L S V P Q F I Q L R F L G * A N Y I C Y CviJI | FatI | |CviAII | || NlaIII | || | MnlI | || | | CviJI BsiYI* TaqI Tsp4CI* \ \\ \ \ \ \ \ \ TTTGGTTTTAGTTTCAAGCCTCCCATGAGAGAGCCATTCAAGGGCATTGTCGAAGAACTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCAAAATCAAAGTTCGGAGGGTACTCTCTCGGTAAGTTCCCGTAACAGCTTCTTGAC / / /// / / / / | | ||MnlI | BsiYI* TaqI Tsp4CI* | | |FatI CviJI | | CviAII | NlaIII CviJI F G F S F K P P M R E P F K G I V E E L L V L V S S L P * E S H S R A L S K N C W F * F Q A S H E R A I Q G H C R R T V ----:----|----:----|----:----|----:----|----:----|----:----| N P K L K L G G M L S G N L P M T S S S I Q N * N * A E W S L A M * P C Q R L V K T K T E L R G H S L W E L A N D F F Q Hpy166II PflMI | AcyI BsiYI* | MaeII | MaeII | |ZraI | | SetI CviRI* | || SetI | | TaiI | MboII Hpy178III* | || TaiI | | |HindII | | CviRI* | BslFI | || AatII |SetI | |Hpy166II \ \ \ \ \ \ \\ \ \\ \ \\ TGCAAAGTGCAAAACATTATCCCGATTGTTTCGGTGGACGTCCCCACAGGTTGGGACGTT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ACGTTTCACGTTTTGTAATAGGGCTAACAAAGCCACCTGCAGGGGTGTCCAACCCTGCAA // / / / // // / / / / |MboII CviRI* | BslFI || |MaeII BsiYI* | | Hpy166II CviRI* Hpy178III* || |AcyI PflMI | | HindII || ZraI SetI | MaeII |AatII TaiI |TaiI SetI |SetI Hpy166II C K V Q N I I P I V S V D V P T G W D V A K C K T L S R L F R W T S P Q V G T L Q S A K H Y P D C F G G R P H R L G R * ----:----|----:----|----:----|----:----|----:----|----:----| H L T C F M I G I T E T S T G V P Q S T T C L A F C * G S Q K P P R G W L N P R A F H L V N D R N N R H V D G C T P V N PshAI | AsuI* | AvaII | BslFI | EcoP15I | |BmgT120I | ||SetI | ||| MboI | ||| Hpy188I | ||| | DpnI | ||| | |BstKTI | ||| | || DdeI | ||| | || | CviJI | ||| | || | | TspEI | ||| | || | | | MseI | ||| | || | | | VspI | ||| | || | | | |BspCNI | ||| | || | | | ||BseMII Hpy188I | ||| | || | | | ||| MnlI BslFI | Tsp4CI* \ \\\ \ \\ \ \ \ \\\ \ \ \ \ GACAAAGGTCCGATCTCTCAGCCCTCAATTAATCCTGCTGTTCTTGTATCTCTGACTGTC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTTCCAGGCTAGAGAGTCGGGAGTTAATTAGGACGACAAGAACATAGAGACTGACAG / ///// / // ///// / / / | ||||| MboI |CviJI ||||MnlI | | Tsp4CI* | ||||DpnI DdeI |||VspI | Hpy188I | |||BstKTI |||MseI BslFI | ||BslFI ||TspEI | |Hpy188I |BseMII | |AvaII BspCNI | |AsuI* | BmgT120I | EcoP15I PshAI SetI D K G P I S Q P S I N P A V L V S L T V T K V R S L S P Q L I L L F L Y L * L S Q R S D L S A L N * S C C S C I S D C P ----:----|----:----|----:----|----:----|----:----|----:----| S L P G I E * G E I L G A T R T D R V T Q C L D S R E A R L * D Q Q E Q I E S Q V F T R D R L G * N I R S N K Y R Q S D CviJI |FatI ||CviAII ||| TseI ||| CviRI* ||| NlaIII ||| |BisI MaeII ||| ||BlsI |BsaAI ||| |||AluI || SetI ||| |||CviJI TfiI || TaiI TfiI ||| |||| SetI BbvI HinfI || |TspDTI HinfI \\\ \\\\ \ \ \ \\ \\ \ CCCAAGCCATGCAGCTCTCACATAAGGGAGAATCAAACAACTCATTACGTGGGGGGAAGA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTTCGGTACGTCGAGAGTGTATTCCCTCTTAGTTTGTTGAGTAATGCACCCCCCTTCT // ///// / / / // || ||||CviJI BbvI HinfI | |TspDTI || ||||TseI TfiI | |MaeII || ||||AluI | BsaAI || |||BisI TaiI || ||BlsI SetI || ||SetI || |CviRI* || |FatI || CviAII |NlaIII CviJI P K P C S S H I R E N Q T T H Y V G G R P S H A A L T * G R I K Q L I T W G E D Q A M Q L S H K G E S N N S L R G G K I ----:----|----:----|----:----|----:----|----:----|----:----| G L G H L E * M L S F * V V * * T P P L G W A M C S E C L P S D F L E N R P P F G L W A A R V Y P L I L C S M V H P S S AvaI XhoI SmlI MboII |TaqI |BmeT110I BsaBI ||Hpy178III* ApoI |TfiI ||| MnlI TspEI CviJI CviJI |HinfI \\\ \ \ \ \ \\ TTCATTCCTCGAGATTTCGCCAATAAATTCGGCTTTGAGCCATTTGGATATGAATCCACA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAAGGAGCTCTAAAGCGGTTATTTAAGCCGAAACTCGGTAAACCTATACTTAGGTGT / / // / / / / / / | | || MnlI | CviJI CviJI | HinfI | | |Hpy178III* TspEI | TfiI | | |SmlI ApoI BsaBI | | |XhoI | | |AvaI | | BmeT110I | | TaqI | MboII HinfI TfiI F I P R D F A N K F G F E P F G Y E S T S F L E I S P I N S A L S H L D M N P Q H S S R F R Q * I R L * A I W I * I H R ----:----|----:----|----:----|----:----|----:----|----:----| N M G R S K A L L N P K S G N P Y S D V I * E E L N R W Y I R S Q A M Q I H I W E N R S I E G I F E A K L W K S I F G C TspDTI | SspI Hpy188I \ \ \ GACCAAATATTGAAACTCTGA 730 740 ----:----|----:----|- CTGGTTTATAACTTTGAGACT / / / | SspI Hpy188I TspDTI D Q I L K L * T K Y * N S X P N I E T L X ----:----|----:----|- S W I N F S Q L G F I S V R V L Y Q F E S # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AluI 7 AluBI ApoI 3 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BccI 2 Bce83I* 1 BpuEI BdaI 2 BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmeT110I 1 BmgT120I 3 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 2 BseYI 2 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BspCNI 2 BspLU11I* 1 PscI,PciI BsrI 2 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 1 Cac8I 3 BstC8I CviAII 3 CviJI 17 CviKI-1 CviRI* 6 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 1 MalI DraII 1 EcoO109I Eco31I 1 Bso31I,BspTNI,BsaI EcoP15I 1 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 3 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GlaI 3 GsaI 2 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HhaI 3 BstHHI,CfoI,AspLEI Hin4I 1 Hin6I 3 HinP1I,HspAI HindII 1 HincII HindIII 2 HinfI 4 HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 4 MaeII 4 HpyCH4IV MaeIII 2 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 MfeI 1 MunI MnlI 6 MseI 1 Tru1I,Tru9I MstI* 1 AviII,FspI,NsbI,Acc16I NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PpuMI 1 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PvuII 2 ScrFI 1 BmrFI,MspR9I,Bme1390I SetI 15 SfaNI 1 LweI SmlI 2 SmoI SspI 3 TaiI 4 TaqI 3 TfiI 4 PfeI TseI 2 ApeKI TsoI 1 Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 6 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI VspI 1 PshBI,AseI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AclI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvrII BaeI BalI BamHI BarI BbvCI BbvII* BceAI BcgI BciVI BclI BetI* BfiI BglI BglII BinI* BmtI BplI Bpu10I BsaXI BsePI BseRI BseSI BsgI BsmI Bsp120I Bsp1407I BspHI BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviQI DinI DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRV EgeI EheI Esp3I EspI* FalI FseI FspAI GsuI HaeII HgaI HgiAI* HgiCI* HgiJII* Hin4II* HpaI Hpy99I KasI KpnI Ksp632I* MaeI MauBI McrI* MluI MlyI MmeI MroNI MslI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI OliI PacI PasI PfoI PleI PmaCI PmeI PpiI PsiI PspOMI PspXI PsrI PstI PvuI RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SduI SecI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TatI TauI Tsp45I TspMI TstI Tth111I XbaI XcmI XhoII XmaCI XmaI XmaIII* # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769