Restriction Map of PSD1/YNL169C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

PSD1/YNL169C on chromosome XIV from coordinates 317671 to 316169.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 StyI SecI* | Hin6I | |MnlI MnlI | |GlaI FatI TspEI | ||HhaI SfaNI | FalI | ||| BseRI |HgaI | FalI | ||| EcoP15I |CviAII | | BsrI | ||| | FalI || NlaIII | | | MseI | ||| | FalI || | MnlI \ \ \ \ \ \\\ \ \ \\ \ \ ATGTCAATTATGCCAGTTAAGAACGCCTTGGCGCAAGGGAGGACGCTCCTCATGGGGAGG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTTAATACGGTCAATTCTTGCGGAACCGCGTTCCCTCCTGCGAGGAGTACCCCTCC / / / / //// / / / // // // | | BsrI MseI |||| | | EcoP15I || || |MnlI | TspEI |||| | FalI || || HgaI FalI |||| | FalI || |SfaNI FalI |||| BseRI || |FatI |||Hin6I || CviAII ||GlaI |NlaIII |HhaI MnlI |MnlI SecI* StyI M S I M P V K N A L A Q G R T L L M G R C Q L C Q L R T P W R K G G R S S W G G V N Y A S * E R L G A R E D A P H G E D ----:----|----:----|----:----|----:----|----:----|----:----| X D I I G T L F A K A C P L V S R M P L X T L * A L * S R R P A L S S A G * P S H * N H W N L V G Q R L P P R E E H P P CviRI* |TspEI Cac8I ||BsmI BseGI FokI ||| MseI AciI \ \ \\\ \ \ ATGCCTGCTGTAAAGTTTTCTACAAGAATGCAATTAAGAAATAGAACTGCGGTGCTATGG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGACGACATTTCAAAAGATGTTCTTACGTTAATTCTTTATCTTGACGCCACGATACC / / / / // / | Cac8I FokI | |MseI AciI BseGI | TspEI CviRI* BsmI M P A V K F S T R M Q L R N R T A V L W C L L * S F L Q E C N * E I E L R C Y G A C C K V F Y K N A I K K * N C G A M E ----:----|----:----|----:----|----:----|----:----|----:----| I G A T F N E V L I C N L F L V A T S H S A Q Q L T K * L F A I L F Y F Q P A I H R S Y L K R C S H L * S I S S R H * P TstI BsaXI Hpy99I | Hin4I | Hin4I MluI | |EcoP15I HgaI AflIII | ||HgaI BbvI | XmnI | FnuDII* | ||Hpy178III* MboI \ \ \ \ \ \\\ \ AATAGAAAGTTTTCCACGCGTCTTTTCGTTCAGCAACGACGCAGTTCTGGAGAGATTGTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCTTTCAAAAGGTGCGCAGAAAAGCAAGTCGTTGCTGCGTCAAGACCTCTCTAACAC / / / / / / / // / | HgaI | AflIII | | Hin4I || HgaI XmnI | MluI | | Hin4I |Hpy178III* FnuDII* | BsaXI EcoP15I Hpy99I TstI N R K F S T R L F V Q Q R R S S G E I V I E S F P R V F S F S N D A V L E R L W * K V F H A S F R S A T T Q F W R D C G ----:----|----:----|----:----|----:----|----:----|----:----| F L F N E V R R K T * C R R L E P S I T S Y F T K W A D K R E A V V C N Q L S Q I S L K G R T K E N L L S A T R S L N H DpnI |BbvI |BstKTI || GsuI || BinI* || Eco57MI || | BsaXI || | | TseI || | | AluI || | | MwoI || | | TstI || | | CviJI || | | |BisI || | | ||BlsI || | | ||SetI || | | |||TseI || | | ||||BisI SetI || | | ||||Hin4I MboII || | | ||||Hin4I | FatI || | | |||||BlsI | |BsmAI || | | ||||||MwoI | |CviAII || | | |||||||AciI | |Eco31I || | | |||||||BisI | || NlaIII || | | ||||||||BlsI | || | PflMI || | | |||||||||TauI AciI | || | BsiYI* \\ \ \ \\\\\\\\\\ \ \ \\ \ \ GATCGTGCCAAAGCTGCTGCCGCAAATAGCGGAAGAAAACAGGTCTCCATGAAATGGGTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGCACGGTTTCGACGACGGCGTTTATCGCCTTCTTTTGTCCAGAGGTACTTTACCCAA // / ///////////////// / / / / /// || | ||||||||||||||||AciI AciI | | | ||Eco31I || | |||||||||||||||BisI | | | ||BsmAI || | ||||||||||||||BlsI | | | |FatI || | |||||||||||||TseI | | | BsiYI* || | |||||||||||||TauI | | | CviAII || | ||||||||||||BisI | | | PflMI || | |||||||||||BlsI | | NlaIII || | ||||||||||MwoI | MboII || | ||||||||||TseI SetI || | |||||||||BisI || | ||||||||BlsI || | |||||||CviJI || | |||||||AluI || | ||||||Hin4I || | ||||||Hin4I || | |||||SetI || | ||||MwoI || | |||BinI* || | ||BsaXI || | ||TstI || | |BbvI || | Eco57MI || | GsuI || MboI || BbvI |DpnI BstKTI D R A K A A A A N S G R K Q V S M K W V I V P K L L P Q I A E E N R S P * N G L S C Q S C C R K * R K K T G L H E M G C ----:----|----:----|----:----|----:----|----:----|----:----| S R A L A A A A F L P L F C T E M F H T P D H W L Q Q R L Y R F F V P R W S I P I T G F S S G C I A S S F L D G H F P N MnlI MseI |TatI TspDTI ||Csp6I | HphI |||MnlI | |SpeI SpeI |||RsaI | ||MaeI MaeI NlaIV |MaeI |||SfaNI \ \\\ \ \ \\ \\\\ GTTTTAACTAGTTTCACCATTGTTCTAGGAACCATTTTACTAGTGTCAAGGAATGATAGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAATTGATCAAAGTGGTAACAAGATCCTTGGTAAAATGATCACAGTTCCTTACTATCA / // // / / // / // | || |SpeI | NlaIV |SpeI | |RsaI | || MaeI MaeI MaeI | MnlI | |MseI MnlI | HphI TspDTI V L T S F T I V L G T I L L V S R N D S F * L V S P L F * E P F Y * C Q G M I V F N * F H H C S R N H F T S V K E * * Y ----:----|----:----|----:----|----:----|----:----|----:----| T K V L K V M T R P V M K S T D L F S L Q K L * N * W Q E L F W K V L T L S H Y N * S T E G N N * S G N * * H * P I I T MnlI | SfeI* | |BseGI | || BseRI SspI | || | FokI Hin4II* | MseI \ \\ \ \ \ \ \ ACAGAGGAGGATGCTACAGAGGGCAAAAAAGGGAGAAGGACAAGAAAAATCAAAATATTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTCCTCCTACGATGTCTCCCGTTTTTTCCCTCTTCCTGTTCTTTTTAGTTTTATAAA // / / / // / / / || SfaNI | | |SfeI* | Hin4II* SspI |TatI | | BseRI FokI Csp6I | BseGI MnlI T E E D A T E G K K G R R T R K I K I F Q R R M L Q R A K K G E G Q E K S K Y L R G G C Y R G Q K R E K D K K N Q N I * ----:----|----:----|----:----|----:----|----:----|----:----| V S S S A V S P L F P L L V L F I L I N Y L P P H * L P C F L S F S L F F * F I C L L I S C L A F F P S P C S F D F Y K Hpy178III* AciI |TaqI TspEI CviJI | NspBII* BsmI || BsmAI \ \ \ \ \ \\ \ AACAATAATTGGCTCTTTTTCTGCTATTCTACTTTACCGCTGAATGCGATGTCTCGATTA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTATTAACCGAGAAAAAGACGATAAGATGAAATGGCGACTTACGCTACAGAGCTAAT / / / / / // / MseI | CviJI | BsmI || BsmAI TspEI NspBII* |TaqI AciI Hpy178III* N N N W L F F C Y S T L P L N A M S R L T I I G S F S A I L L Y R * M R C L D Y Q * L A L F L L F Y F T A E C D V S I M ----:----|----:----|----:----|----:----|----:----|----:----| L L L Q S K K Q * E V K G S F A I D R N * C Y N A R K R S N * K V A S H S T E I V I I P E K E A I R S * R Q I R H R S * FatI NcoI BtgZI StyI | AsuI* SecI* | |NlaIV MaeII DsaI* | |BmgT120I |MaeIII |CviAII | ||CviJI ApoI || SetI || NlaIII | ||HaeIII TspEI || TaiI || | MaeIII SetI \ \\\ \ \\ \ \\ \ \ \ TGGGGCCAAGTAAATTCTCTTACGTTACCCATTTGGGTTAGACCATGGGGTTACAGGTTA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCCGGTTCATTTAAGAGAATGCAATGGGTAAACCCAATCTGGTACCCCAATGTCCAAT /// / / / / / // / ||AsuI* | | | MaeIII | |DsaI* MaeIII |BmgT120I | | MaeII | |SecI* SetI |HaeIII | TaiI | |StyI |BtgZI | SetI | |NcoI |CviJI TspEI | |FatI NlaIV ApoI | CviAII NlaIII W G Q V N S L T L P I W V R P W G Y R L G A K * I L L R Y P F G L D H G V T G Y G P S K F S Y V T H L G * T M G L Q V I ----:----|----:----|----:----|----:----|----:----|----:----| H P W T F E R V N G M Q T L G H P * L N I P G L L N E * T V W K P * V M P N C T P A L Y I R K R * G N P N S W P T V P * MseI BinI* |HpaI | MboI |HindII | XhoII |Hpy166II | | DpnI || Hin4I | | |BstKTI || Hin4I | | ||Hpy178III* Hin4I || | BccI | | ||| MboII Hin4I \\ \ \ \ \ \\\ \ \ TATTCTTTCCTTTTTGGAGTTAACTTGGACGAGATGGAAGATCCTGATTTGACACATTAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGAAAGGAAAAACCTCAATTGAACCTGCTCTACCTTCTAGGACTAAACTGTGTAATA / // / / // / / / / | |MseI BccI | || | | | Hin4I | Hpy166II | || | | | Hin4I | HindII | || | | MboII | HpaI | || | Hpy178III* Hin4I | || XhoII Hin4I | || MboI | |DpnI | BstKTI BinI* Y S F L F G V N L D E M E D P D L T H Y I L S F L E L T W T R W K I L I * H I M F F P F W S * L G R D G R S * F D T L C ----:----|----:----|----:----|----:----|----:----|----:----| Y E K R K P T L K S S I S S G S K V C * I N K G K Q L * S P R S P L D Q N S V N I R E K K S N V Q V L H F I R I Q C M I BssKI EcoRII | ScrFI | BseBI | | AflIII | | | MaeII | | | |BtrI CviRI* Hpy188I | | | || SetI | ApoI |ApoI | | | || TaiI | TspEI |TspEI MaeIII | | | || |BsrI \ \ \\ \ \ \ \ \\ \\ GCAAATTTATCCGAATTTTTCTATCGTAACATAAAACCAGGCACACGTCCAGTAGCACAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTAAATAGGCTTAAAAAGATAGCATTGTATTTTGGTCCGTGTGCAGGTCATCGTGTT / / / / / / / / // | | | TspEI MaeIII | | | |AflIII | | | ApoI | | | |MaeII | | Hpy188I | | | |BsrI | TspEI | | | BtrI | ApoI | | TaiI CviRI* | | SetI | EcoRII | BssKI BseBI ScrFI A N L S E F F Y R N I K P G T R P V A Q Q I Y P N F S I V T * N Q A H V Q * H K K F I R I F L S * H K T R H T S S S T R ----:----|----:----|----:----|----:----|----:----|----:----| A F K D S N K * R L M F G P V R G T A C H L N I R I K R D Y C L V L C V D L L V C I * G F K E I T V Y F W A C T W Y C L MaeII | SetI | TaiI | BbvII* | | AluI | | CviJI | | MboII | | | SetI PflMI | | | | BccI BsiYI* \ \ \ \ \ \ GGCGAAGACGTTATAGCTTCTCCAAGTGATGGAAAGATTTTACAAGTTGGTATAATCAAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTTCTGCAATATCGAAGAGGTTCACTACCTTTCTAAAATGTTCAACCATATTAGTTG / / /// / / | | ||CviJI | BsiYI* | | ||AluI | PflMI | | |BbvII* BccI | | |MboII | | SetI | MaeII TaiI SetI G E D V I A S P S D G K I L Q V G I I N A K T L * L L Q V M E R F Y K L V * S T R R R Y S F S K * W K D F T S W Y N Q L ----:----|----:----|----:----|----:----|----:----|----:----| P S S T I A E G L S P F I K C T P I I L L R L R * L K E L H H F S K V L Q Y L * A F V N Y S R W T I S L N * L N T Y D V ApoI BccI TspEI EcoRI FalI | StyI Hpy188I BsrI TaqI FalI | SecI* \ \ \ \ \ \ TCTGAAACTGGCGAAATCGAACAAGTCAAGGGAATGACATATTCCATCAAAGAATTCCTT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTTTGACCGCTTTAGCTTGTTCAGTTCCCTTACTGTATAAGGTAGTTTCTTAAGGAA / / / / / / Hpy188I BsrI TaqI FalI | EcoRI FalI | TspEI | ApoI BccI S E T G E I E Q V K G M T Y S I K E F L L K L A K S N K S R E * H I P S K N S L * N W R N R T S Q G N D I F H Q R I P W ----:----|----:----|----:----|----:----|----:----|----:----| E S V P S I S C T L P I V Y E M L S N R S Q F Q R F R V L * P F S M N W * L I G R F S A F D F L D L S H C I G D F F E K CviRI* | MaeI | | XbaI | | |MaeI FalI | | |SfaNI MnlI FalI DdeI | | |Hpy178III* | Hpy188I \ \ \ \ \\ \ \ GGCACTCACTCCCACCCCTTGATGTCTAAGAGTGCATCTAGTCTAGATTTGACTTCTGAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTGAGTGAGGGTGGGGAACTACAGATTCTCACGTAGATCAGATCTAAACTGAAGACTA / / / / / /// / / SecI* FalI DdeI | MaeI ||SfaNI | Hpy188I StyI FalI CviRI* |XbaI MnlI Hpy178III* MaeI G T H S H P L M S K S A S S L D L T S D A L T P T P * C L R V H L V * I * L L M H S L P P L D V * E C I * S R F D F * * ----:----|----:----|----:----|----:----|----:----|----:----| P V * E W G K I D L L A D L R S K V E S Q C E S G G R S T * S H M * D L N S K Q A S V G V G Q H R L T C R T * I Q S R I BssKI EcoRII ApoI |SecI* TspEI ||ScrFI FauI NlaIV EcoRI ||BseBI |TspEI AciI | Hpy188I \ \\\ \\ \ \ \ GAGGAAAAGCATAGAGAATTCGCCAGGGTAAATAGAATACAATTAGCGGGTTCCGAAGAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTTTTCGTATCTCTTAAGCGGTCCCATTTATCTTATGTTAATCGCCCAAGGCTTCTG / / / / / / / / / | | EcoRII | | | | | TspRI | | BssKI | | | | Hpy188I | | SecI* | | | NlaIV | BseBI | | AciI | ScrFI | TspEI EcoRI FauI TspEI ApoI E E K H R E F A R V N R I Q L A G S E D R K S I E N S P G * I E Y N * R V P K T G K A * R I R Q G K * N T I S G F R R H ----:----|----:----|----:----|----:----|----:----|----:----| S S F C L S N A L T F L I C N A P E S S H P F A Y L I R W P L Y F V I L P N R L L F L M S F E G P Y I S Y L * R T G F V MseI BbvII* Ksp632I* | MboII | MnlI | | TspRI | | MseI MboI | | |MboII | | |MnlI | DpnI TaqI | | || CviJI | | |AhaIII* | |BstKTI |Hpy178III* \ \ \\ \ \ \ \\ \ \\ \\ ACTGAACAGCCTCTTCTTAACTTTAAAAACGAGGGCGATCAATCTGTTCGAGAGTTCAAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTTGTCGGAGAAGAATTGAAATTTTTGCTCCCGCTAGTTAGACAAGCTCTCAAGTTT / / / // /// // / // | | CviJI || ||MseI || MboI |Hpy178III* | BbvII* || |AhaIII* |DpnI TaqI | MboII || MnlI BstKTI MboII |Ksp632I* MnlI MseI T E Q P L L N F K N E G D Q S V R E F K L N S L F L T L K T R A I N L F E S S N * T A S S * L * K R G R S I C S R V Q T ----:----|----:----|----:----|----:----|----:----|----:----| V S C G R R L K L F S P S * D T R S N L C Q V A E E * S * F R P R D I Q E L T * S F L R K K V K F V L A I L R N S L E F HindII MseI MseI Hpy166II |AhaIII* \ \ \\ CCAAGTGTGTCCAAAAATATACATCTTTTAAGTCAACTTTCTTTAAACTACTTCTCTAAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTCACACAGGTTTTTATATGTAGAAAATTCAGTTGAAAGAAATTTGATGAAGAGATTA / / // | Hpy166II |MseI | HindII AhaIII* MseI P S V S K N I H L L S Q L S L N Y F S N Q V C P K I Y I F * V N F L * T T S L M K C V Q K Y T S F K S T F F K L L L * W ----:----|----:----|----:----|----:----|----:----|----:----| G L T D L F I C R K L * S E K F * K E L V L H T W F Y V D K L D V K K L S S R * W T H G F I Y M K * T L K R * V V E R I SduI HgiAI* |DdeI ||Hpy188I ||| CviJI ||| | FatI ||| | BspHI ||| | |CviAII BdaI ||| | |Hpy178III* BdaI ||| | || NlaIII | CviJI BseMII ||| | || | BceAI | |NlaIV |BspCNI ||| | || | |MnlI TspGWI | ||BssKI \\ \\\ \ \\ \ \\ \ \ \\\ GGGTTTTCGTGCTCTGAGCCTCATGATACGGAACTTTTCTTTGCCGTCATTTATTTGGCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CCCAAAAGCACGAGACTCGGAGTACTATGCCTTGAAAAGAAACGGCAGTAAATAAACCGA // / / // / // / / / / // || | | || | || | BceAI TspGWI BdaI |NlaIV || | | || | || MnlI BdaI CviJI || | | || | |BspHI || | | || | |FatI || | | || | Hpy178III* || | | || | CviAII || | | || NlaIII || | | |CviJI || | | DdeI || | Hpy188I || HgiAI* || SduI |BspCNI BseMII G F S C S E P H D T E L F F A V I Y L A G F R A L S L M I R N F S L P S F I W L V F V L * A S * Y G T F L C R H L F G S ----:----|----:----|----:----|----:----|----:----|----:----| P N E H E S G * S V S S K K A T M * K A H T K T S Q A E H Y P V K R Q R * K N P P K R A R L R M I R F K E K G D N I Q S BsrI |BdaI GsuI |BdaI SetI BsaBI || HindII | AciI HpaII Eco57MI || Hpy166II | BisI ScrFI | HphI || | BstXI | |BlsI CauII* | | BccI || | | BsrI BfiI | ||TauI \ \ \ \ \\ \ \ \ \ \ \\\ CCCGGTGATTACCATCATTTCCACTCTCCAGTTGACTGGGTTTGTAAGGTTCGCCGCCAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GGGCCACTAATGGTAGTAAAGGTGAGAGGTCAACTGACCCAAACATTCCAAGCGGCGGTA /// / / / / // / / / / / //// ||| | | HphI BccI || | | BsrI | SetI |||Hin4I ||| | BsaBI || | Hpy166II BfiI |||AciI ||| Eco57MI || | HindII ||BisI ||| GsuI || BstXI |BlsI ||BssKI |BdaI TauI |HpaII |BdaI CauII* BsrI ScrFI P G D Y H H F H S P V D W V C K V R R H P V I T I I S T L Q L T G F V R F A A I R * L P S F P L S S * L G L * G S P P F ----:----|----:----|----:----|----:----|----:----|----:----| G P S * W * K W E G T S Q T Q L T R R W E R H N G D N G S E L Q S P K Y P E G G G T I V M M E V R W N V P N T L N A A M Hin4I TstI | BssKI | HphI | SecI* | |SecI* | EcoRII | |DsaI* | | ScrFI | || HgiCI* | | BseBI | || | NlaIV | | | SetI | || | | SetI | | | TspGWI | || | | | Hin4I MaeIII TstI \ \ \ \ \ \\ \ \ \ \ \ \ TTCCCAGGTGATTTATTCTCCGTGGCACCTTATTTCCAGCGTAACTTCCCTAATCTTTTC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGGTCCACTAAATAAGAGGCACCGTGGAATAAAGGTCGCATTGAAGGGATTAGAAAAG //// / / / / / // / |||| TstI HphI | | HgiCI* |MaeIII FalI |||EcoRII | | Hin4I TstI FalI |||BssKI | NlaIV ||TspGWI | SetI ||SecI* DsaI* |BseBI SecI* |ScrFI SetI F P G D L F S V A P Y F Q R N F P N L F S Q V I Y S P W H L I S S V T S L I F S P R * F I L R G T L F P A * L P * S F R ----:----|----:----|----:----|----:----|----:----|----:----| K G P S K N E T A G * K W R L K G L R K N G L H N I R R P V K N G A Y S G * D K E W T I * E G H C R I E L T V E R I K E MlyI PleI | FatI FalI | |CviAII FalI | || TspGWI FalI | Csp6I | || |HinfI FalI MmeI TspDTI | |RsaI | || |NlaIII \ \ \ \ \\ \ \\ \\ GTTCTAAATGAAAGAGTTGCTTTGTTGGGTAGTTGGAAGTACGGATTTTTTAGCATGACT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGATTTACTTTCTCAACGAAACAACCCATCAACCTTCATGCCTAAAAAATCGTACTGA / / / // //// // / MmeI TspDTI FalI |Csp6I |||| || HinfI FalI RsaI |||| |FatI |||| CviAII |||TspGWI ||NlaIII |PleI MlyI V L N E R V A L L G S W K Y G F F S M T F * M K E L L C W V V G S T D F L A * L S K * K S C F V G * L E V R I F * H D S ----:----|----:----|----:----|----:----|----:----|----:----| T R F S L T A K N P L Q F Y P N K L M V R E L H F L Q K T P Y N S T R I K * C S N * I F S N S Q Q T T P L V S K K A H S MboI BclI | DpnI | |BstKTI | ||Hpy178III* | ||| ApoI | ||| TspEI | ||| | MaeIII | ||| | Tsp45I ApoI | ||| | | ApoI CviRI* TspEI | ||| | | TspEI \ \ \ \\\ \ \ \ CCTGTTGGTGCAACAAATGTTGGTTCAATCAAGTTGAATTTTGATCAAGAATTTGTGACA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GGACAACCACGTTGTTTACAACCAAGTTAGTTCAACTTAAAACTAGTTCTTAAACACTGT / / // / / / / CviRI* | || | | TspEI Tsp45I | || | | ApoI MaeIII | || | Hpy178III* | || BclI | || MboI | |DpnI | BstKTI TspEI ApoI P V G A T N V G S I K L N F D Q E F V T L L V Q Q M L V Q S S * I L I K N L * Q C W C N K C W F N Q V E F * S R I C D K ----:----|----:----|----:----|----:----|----:----|----:----| G T P A V F T P E I L N F K S * S N T V E Q Q H L L H Q N L * T S N Q D L I Q S R N T C C I N T * D L Q I K I L F K H C SetI | BssKI | EcoRII | | ScrFI | | BseBI NlaIV | | BspMI \ \ \ \ AATTCAAAGAGCGACAAACACTTGGAACCACATACCTGCTACCAGGCAGTATATGAGAAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGTTTCTCGCTGTTTGTGAACCTTGGTGTATGGACGATGGTCCGTCATATACTCTTA / / / / // TspEI NlaIV SetI | |BspMI ApoI | EcoRII | BssKI BseBI ScrFI N S K S D K H L E P H T C Y Q A V Y E N I Q R A T N T W N H I P A T R Q Y M R M F K E R Q T L G T T Y L L P G S I * E C ----:----|----:----|----:----|----:----|----:----|----:----| F E F L S L C K S G C V Q * W A T Y S F L N L S R C V S P V V Y R S G P L I H S I * L A V F V Q F W M G A V L C Y I L I HphI MnlI MseI | MboII CviRI* |SspI |FokI | |CviJI | BsmI |SfaNI TsoI BseGI || TaqII | || TspEI \ \ \\ \ \ \\ \ \ \\ \ GCAAGTAAAATATTGGGAGGGATGCCTTTGGTTAAGGGTGAAGAAATGGGTGGCTTTGAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTCATTTTATAACCCTCCCTACGGAAACCAATTCCCACTTCTTTACCCACCGAAACTT / / / / / / // / / / / CviRI* | | | TsoI BseGI || FokI | | CviJI BsmI | | SfaNI |TaqII | MboII | SspI MseI HphI MnlI A S K I L G G M P L V K G E E M G G F E Q V K Y W E G C L W L R V K K W V A L N K * N I G R D A F G * G * R N G W L * I ----:----|----:----|----:----|----:----|----:----|----:----| A L L I N P P I G K T L P S S I P P K S H L Y F I P L S A K P * P H L F P H S Q C T F Y Q S P H R Q N L T F F H T A K F Tsp4CI* | TatI ApoI | TspRI AluI TspEI | |Csp6I CviJI | TspRI | ||RsaI | SetI | | MseI TaqI \ \\\ \ \ \ \ \ \ TTGGGTAGCACTGTTGTACTTTGTTTTGAAGCTCCCACTGAATTTAAGTTCGATGTTAGG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCATCGTGACAACATGAAACAAAACTTCGAGGGTGACTTAAATTCAAGCTACAATCC / / / /// / / / / / / | | | ||TatI | | TspRI | MseI TaqI | | | |Csp6I | CviJI TspEI | | | RsaI | AluI ApoI | | Tsp4CI* SetI | TspRI TspEI L G S T V V L C F E A P T E F K F D V R W V A L L Y F V L K L P L N L S S M L G G * H C C T L F * S S H * I * V R C * G ----:----|----:----|----:----|----:----|----:----|----:----| N P L V T T S Q K S A G V S N L N S T L I P Y C Q Q V K N Q L E W Q I * T R H * Q T A S N Y K T K F S G S F K L E I N P BccI | MseI | SetI BslFI MseI | | HphI TspEI | TspEI |AhaIII* \ \ \ \ \ \ \\ GTTGGTGATAAGGTTAAGATGGGACAGAAATTAGGCATAATTGGAAAGAATGATTTAAAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CAACCACTATTCCAATTCTACCCTGTCTTTAATCCGTATTAACCTTTCTTACTAAATTTT / / // / / / // | | |MseI TspEI | TspEI |MseI | | HphI BslFI AhaIII* | BccI SetI V G D K V K M G Q K L G I I G K N D L K L V I R L R W D R N * A * L E R M I * N W * * G * D G T E I R H N W K E * F K M ----:----|----:----|----:----|----:----|----:----|----:----| T P S L T L I P C F N P M I P F F S K F P Q H Y P * S P V S I L C L Q F S H N L N T I L N L H S L F * A Y N S L I I * F TGA --- ACT * X X --- H I S # Enzymes that cut Frequency Isoschizomers AciI 6 BspACI,SsiI AflIII 2 AhaIII* 3 DraI AluI 3 AluBI ApoI 9 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 5 BceAI 1 BclI 1 FbaI,Ksp22I BdaI 2 BfiI 1 BmrI,BmuI BinI* 2 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmgT120I 1 BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 1 BseRI 2 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI BspCNI 1 BspHI 1 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrI 5 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BstKTI 4 BstXI 1 BtgZI 1 BtrI 1 BmgBI,AjiI Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Csp6I 3 CviQI,RsaNI CviAII 5 CviJI 9 CviKI-1 CviRI* 5 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 4 MalI DsaI* 2 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57MI 2 EcoP15I 2 EcoRI 2 EcoRII 4 AjnI,Psp6I,PspGI FalI 6 FatI 5 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 1 GsuI 2 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HindII 3 HincII HinfI 1 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 5 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 5 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 MluI 1 MlyI 1 SchI MmeI 1 MnlI 11 MseI 13 Tru1I,Tru9I MwoI 2 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PflMI 2 BasI,AccB7I,Van91I PleI 1 PpsI RsaI 3 AfaI ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 6 BseDI,BssECI,BsaJI SetI 13 SfaNI 4 LweI SfeI* 1 BstSFI,SfcI,BfmI SpeI 2 BcuI,AhlI SspI 2 StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 4 TaqII 1 TatI 2 TauI 2 TseI 2 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 16 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 3 TscAI TstI 2 XbaI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BcgI BciVI BetI* BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsePI BseSI BseYI BsgI BsiI* Bsp120I Bsp1407I BspLU11I* BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstZ17I BtsI Cfr10I Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco47III Eco57I EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I EspI* FseI FspAI GsaI HaeII HgiJII* HindIII KasI KpnI MauBI McrI* MfeI Mph1103I MroNI MslI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TfiI TspMI Tth111I VspI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769