Restriction Map of FMP41/YNL168C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

FMP41/YNL168C on chromosome XIV from coordinates 318809 to 318030.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.32299

EMBOSS_001 TseI |BisI AluI ||BlsI CviJI |||AluI | SetI |||CviJI TseI | | TspEI ||||MaeI TspEI CviRI* |BisI | | | Hin4II* |||||SetI | BbvI | EcoT22I TspEI ||BlsI \ \ \ \ \\\\\\ \ \ \ \ \ \\\ ATGAGCTACAATTATTTGAAGGCAGCTAGAAAAATTATATGCATTGGGCGTAATTACGCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCGATGTTAATAAACTTCCGTCGATCTTTTTAATATACGTAACCCGCATTAATGCGT / / / / /// / / // / / // | CviJI | TspEI ||| MaeI | || CviRI* | |BisI | AluI Hin4II* ||CviJI | |EcoT22I | BlsI SetI ||TseI | BbvI TspEI ||AluI TspEI |BisI BlsI SetI M S Y N Y L K A A R K I I C I G R N Y A * A T I I * R Q L E K L Y A L G V I T Q E L Q L F E G S * K N Y M H W A * L R S ----:----|----:----|----:----|----:----|----:----|----:----| X L * L * K F A A L F I I H M P R L * A X S S C N N S P L * F F * I C Q A Y N R H A V I I Q L C S S F N Y A N P T I V C AluI Hin6I CviJI |GlaI | SetI ||HhaI BbvI | | TspEI Tsp4CI* \\\ \ \ \ \ \ GCGCATATCAAAGAGCTGAACAATTCAACTCCAAAACAACCGTTTTTTTTCCTAAAACCA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGCGTATAGTTTCTCGACTTGTTAAGTTGAGGTTTTGTTGGCAAAAAAAAGGATTTTGGT /// /// / / / ||Hin6I ||CviJI TspEI Tsp4CI* SetI |GlaI ||AluI TseI |BbvI HhaI SetI A H I K E L N N S T P K Q P F F F L K P R I S K S * T I Q L Q N N R F F S * N Q A Y Q R A E Q F N S K T T V F F P K T N ----:----|----:----|----:----|----:----|----:----|----:----| A C I L S S F L E V G F C G N K K R F G L A Y * L A S C N L E L V V T K K G L V R M D F L Q V I * S W F L R K K E * F W AvaI XhoI SmlI PspXI |TaqI |SetI |BmeT110I || MnlI || MaeIII || Tsp45I || | MboII || | TspDTI SetI || | BbvII* Hpy178III* |CviRI* || | | DrdI | MaeI || BspMI \\ \ \ \ \ \ \\ \ ACCTCGAGTATTGTGACACCATTGTCTTCATCATTGGTCAAGACCACTAGACCTGCAAAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAGCTCATAACACTGTGGTAACAGAAGTAGTAACCAGTTCTGGTGATCTGGACGTTTG // / /// / / / // / || | ||| | BbvII* | |SetI CviRI* || | ||| DrdI | MaeI || | ||Tsp45I Hpy178III* || | ||MaeIII || | |MboII || | TspDTI || MnlI |PspXI |SmlI |XhoI |AvaI BmeT110I TaqI T S S I V T P L S S S L V K T T R P A N P R V L * H H C L H H W S R P L D L Q T L E Y C D T I V F I I G Q D H * T C K L ----:----|----:----|----:----|----:----|----:----|----:----| V E L I T V G N D E D N T L V V L G A F L R S Y Q S V M T K M M P * S W * V Q L G R T N H C W Q R * * Q D L G S S R C V BbvII* | MboII | |TspDTI | ||BssKI | ||SecI* | |||AvaI | |||BssKI | |||SecI* | |||Cfr9I | ||||HpaII | ||||ScrFI | ||||CauII* | ||||BmeT110I | |||||SmaI | |||||ScrFI | |||||CauII* | ||||||AsuI* | ||||||Bsp120I | |||||||AsuI* | |||||||TspGWI | |||||||BmgT120I | ||||||||CviJI | ||||||||NlaIV | ||||||||HaeIII | ||||||||BmgT120I | ||||||||| ApaI | ||||||||| SduI AciI MseI | ||||||||| BseSI FnuDII* TaqI |AhaIII* | ||||||||| HgiJII* |Hin4II* \ \\ \ \\\\\\\\\ \ \\ TCGACTTTCAATGGTTTAAATGAAGACGGAACTAACCCCGGGCCCATTTTTATCCCACGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTGAAAGTTACCAAATTTACTTCTGCCTTGATTGGGGCCCGGGTAAAAATAGGGTGCG // // / ////// // |BspMI |MseI | |||||Bsp120I |FnuDII* TaqI AhaIII* | |||||AsuI* |Hin4II* | ||||BmgT120I |TspDTI | ||||AsuI* DraIII | |||BmgT120I | |||HaeIII | |||BssKI | |||NlaIV | |||CviJI | ||Cfr9I | ||BssKI | ||SecI* | ||AvaI | |BmeT110I | |HgiJII* | |CauII* | |SecI* | |HpaII | |ScrFI | |BseSI | |SduI | |ApaI | TspGWI | CauII* | ScrFI | SmaI TspDTI BbvII* MboII S T F N G L N E D G T N P G P I F I P R R L S M V * M K T E L T P G P F L S H A D F Q W F K * R R N * P R A H F Y P T R ----:----|----:----|----:----|----:----|----:----|----:----| E V K L P K F S S P V L G P G M K I G R S S K * H N L H L R F * G R A W K * G V R S E I T * I F V S S V G P G N K D W A TspDTI Hpy178III* MaeIII DraIII SetI | TspEI Tsp45I \ \ \ \ \ GGTGTGAAGGTTCATCACGAAATTGAGTTGGCATTGATTGTGAGCAAACATTTGTCCAAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCACACTTCCAAGTAGTGCTTTAACTCAACCGTAACTAACACTCGTTTGTAAACAGGTTA / / / / AciI SetI | TspEI Hpy178III* G V K V H H E I E L A L I V S K H L S N V * R F I T K L S W H * L * A N I C P M C E G S S R N * V G I D C E Q T F V Q C ----:----|----:----|----:----|----:----|----:----|----:----| P T F T * * S I S N A N I T L L C K D L R H S P E D R F Q T P M S Q S C V N T W T H L N M V F N L Q C Q N H A F M Q G I MlyI PleI AluI TspDTI CviJI DdeI | HinfI | SetI MboI | MslI | MboII | |MaeI XhoII \ \ \ \ \ \\ \ GTCACTAAGATGAAACCCGAAGAAGTCTATGACTCTATTAGTGGTGTAGCTCTAGCATTG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTGATTCTACTTTGGGCTTCTTCAGATACTGAGATAATCACCACATCGAGATCGTAAC / // / // / / / / / | |DdeI | || | HinfI | | MaeI | MslI | || MboII | CviJI Tsp45I | |PleI | AluI MaeIII | MlyI SetI TspDTI V T K M K P E E V Y D S I S G V A L A L S L R * N P K K S M T L L V V * L * H W H * D E T R R S L * L Y * W C S S S I G ----:----|----:----|----:----|----:----|----:----|----:----| T V L I F G S S T * S E I L P T A R A N H * * S S V R L L R H S * * H H L E L M D S L H F G F F D I V R N T T Y S * C Q TspDTI | CviJI DpnI | | StyI |BstKTI CviJI | | SecI* || BinI* | Hin4II* | | | SetI \\ \ \ \ \ \ \ \ GATCTTACAGCAAGAAATGTCCAAGATGAAGCCAAAAAGAAGGGGCTACCTTGGACTATA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGAATGTCGTTCTTTACAGGTTCTACTTCGGTTTTTCTTCCCCGATGGAACCTGATAT // / / // / / / / || | BinI* || | | SetI SecI* || XhoII || | CviJI StyI || MboI || TspDTI |DpnI |Hin4II* BstKTI CviJI D L T A R N V Q D E A K K K G L P W T I I L Q Q E M S K M K P K R R G Y L G L * S Y S K K C P R * S Q K E G A T L D Y K ----:----|----:----|----:----|----:----|----:----|----:----| S R V A L F T W S S A L F F P S G Q V I P D * L L F H G L H L W F S P A V K S * I K C C S I D L I F G F L L P * R P S Y SetI MslI FokI |FatI AciI ||CviAII SfeI* BsmAI ||| NlaIII | BplI | FnuDII* TspDTI ||| | Hin4II* | BplI | | FauI BseGI \ \\\ \ \ \ \ \ \ \ \ AGCAAGGGTTTTGACACCTTCATGCCAATCTCTGCTATAGTCTCCCGCGAGAAGTTCTCA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTTCCCAAAACTGTGGAAGTACGGTTAGAGACGATATCAGAGGGCGCTCTTCAAGAGT / / // // / / / / / / / TspDTI | || || Hin4II* | SfeI* | | | BseGI | || |FatI BplI | | FauI | || CviAII BplI | BsmAI | |NlaIII | FokI | MslI FnuDII* SetI AciI S K G F D T F M P I S A I V S R E K F S A R V L T P S C Q S L L * S P A R S S H Q G F * H L H A N L C Y S L P R E V L I ----:----|----:----|----:----|----:----|----:----|----:----| L L P K S V K M G I E A I T E R S F N E L C P N Q C R * A L R Q * L R G R S T R A L T K V G E H W D R S Y D G A L L E * PleI |MlyI || SduI || HgiAI* || | MseI || | |HpaI || | |HindII || | |Hpy166II BplI Hpy188I || | || BsmAI BplI |HinfI || | || | Tsp4CI* \ \\ \\ \ \\ \ \ TCCTACAAATCAAACTTACAGGATATTTTCAGAGTCAAGTGCTCTGTTAACGGACAGTTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGGATGTTTAGTTTGAATGTCCTATAAAAGTCTCAGTTCACGAGACAATTGCCTGTCAAC / / / / / // / / BplI | | | PleI |MseI | BsmAI BplI | | | MlyI | Tsp4CI* | | HgiAI* Hpy166II | | SduI HindII | HinfI HpaI Hpy188I S Y K S N L Q D I F R V K C S V N G Q L P T N Q T Y R I F S E S S A L L T D S * L Q I K L T G Y F Q S Q V L C * R T V E ----:----|----:----|----:----|----:----|----:----|----:----| D * L D F K C S I K L T L H E T L P C N M R C I L S V P Y K * L * T S Q * R V T G V F * V * L I N E S D L A R N V S L Q FatI SetI |CviAII || NlaIII BccI Csp6I || | CviRI* TaqII | TspGWI |RsaI || | |MnlI | CviRI* \ \ \\ \\ \ \\ \ \ AGACAAGATGGTGGTACTAACCTCATGTTGCACCCACTCCATAAAATACTGCAACACATA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTTCTACCACCATGATTGGAGTACAACGTGGGTGAGGTATTTTATGACGTTGTGTAT // // / / // / / / |TspGWI || | | || CviRI* TaqII CviRI* BccI || | | || MnlI || | | |FatI || | | CviAII || | NlaIII || SetI |Csp6I RsaI R Q D G G T N L M L H P L H K I L Q H I D K M V V L T S C C T H S I K Y C N T Y T R W W Y * P H V A P T P * N T A T H I ----:----|----:----|----:----|----:----|----:----|----:----| L C S P P V L R M N C G S W L I S C C M S V L H H Y * G * T A G V G Y F V A V C S L I T T S V E H Q V W E M F Y Q L V Y AarI BspMI |Csp6I FatI ||RsaI |CviAII ||BsrI || NlaIII |||Hpy166II || | EcoRV |||| SfeI* || | |XcmI |||| |SetI || | || Hpy178III* |||| ||CviRI* || | || | NlaIV |||| ||| PstI || | || | |BssKI |||| ||| Sse8387I || | || | ||HpaII |||| ||| | SetI || | || | |||ScrFI |||| ||| | AarI || | || | |||CauII* EcoRV HphI |||| ||| | BspMI \\ \ \\ \ \\\\ \ \ \\\\ \\\ \ \ TCTACCATGATATCTCTGGAACCGGGTGATATCATTTTGACTGGTACACCTGCAGGTGTA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGGTACTATAGAGACCTTGGCCCACTATAGTAAAACTGACCATGTGGACGTCCACAT / // / / / / / / / / /// / /// | || EcoRV | | | | EcoRV HphI | ||| | ||SfeI* | || XcmI | | | BssKI | ||| | |SetI | |FatI | | CauII* | ||| | CviRI* | CviAII | | HpaII | ||| Sse8387I NlaIII | | ScrFI | ||| PstI | NlaIV | ||BspMI Hpy178III* | ||SetI | ||AarI | |Hpy166II | |Csp6I | RsaI BsrI S T M I S L E P G D I I L T G T P A G V L P * Y L W N R V I S F * L V H L Q V * Y H D I S G T G * Y H F D W Y T C R C R ----:----|----:----|----:----|----:----|----:----|----:----| D V M I D R S G P S I M K V P V G A P T I * W S I E P V P H Y * K S Q Y V Q L H R G H Y R Q F R T I D N Q S T C R C T Y BssKI CviJI EcoRII | ScrFI | BseBI | | MaeIII | | Tsp45I | | BstEII | | | Tsp4CI* | | | | Hpy166II | | | | |HphI | | | | || Tsp4CI* | | | | || | TspRI | | | | || | | AluI | | | | || | | CviJI | | | | || | | | SetI BdaI | | | | || | | | | BdaI BdaI | | | | || | | | | BdaI SspI MseI | | | | || | | | | |CviRI* |DrdI \ \ \ \ \ \\ \ \ \ \ \\ \\ GGCGAGTTAAAGCCTGGTGACCGTGTTCACTGTGAGCTATTGCAGAATAATGACAATATT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTCAATTTCGGACCACTGGCACAAGTGACACTCGATAACGTCTTATTACTGTTATAA / / / / / / / / / / / / / / // | | | | | | | | | | | | | CviRI* |SspI | | | | | | | | | | | | BdaI DrdI | | | | | | | | | | | | BdaI | | | | | | | | | | | CviJI | | | | | | | | | | | AluI | | | | | | | | | | SetI | | | | | | | | | Tsp4CI* | | | | | | | | Hpy166II | | | | | | | | HphI | | | | | | | TspRI | | | | | | Tsp4CI* | | | | | | BstEII | | | | | | Tsp45I | | | | | | MaeIII | | | | | EcoRII | | | | | BssKI | | | | BseBI | | | | ScrFI | | | CviJI | | MseI | BdaI | BdaI BspMI AarI G E L K P G D R V H C E L L Q N N D N I A S * S L V T V F T V S Y C R I M T I L R V K A W * P C S L * A I A E * * Q Y C ----:----|----:----|----:----|----:----|----:----|----:----| P S N F G P S R T * Q S S N C F L S L I L R T L A Q H G H E S H A I A S Y H C Y A L * L R T V T N V T L * Q L I I V I N TspDTI | CfrI | XmaIII* | | BssKI | | CviJI | | HaeIII | | |HpaII | | |McrI* SalI | | ||ScrFI |TaqI | | ||CauII* |AccI | | ||| AsuI* ||HindII | | ||| AvaII ||Hpy166II | | ||| |NlaIV ||| FatI | | ||| |BmgT120I ||| |CviAII | | ||| || NdeI ||| || NlaIII | | ||| || | ApoI ||| || | TaqI | | ||| || | TspEI ||| || | AsuII | | ||| || | | BslFI TspDTI \\\ \\ \ \ \ \ \\\ \\ \ \ \ \ GTCGACATGAACTTCGAATGTGAAAATCGGCCGGGACCATATGAATTTAGAGAAACATAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCTGTACTTGAAGCTTACACTTTTAGCCGGCCCTGGTATACTTAAATCTCTTTGTATT /// // / / // // /// / / / / ||| |FatI | TspDTI || || ||| NdeI | | TspDTI ||| CviAII AsuII || || ||AvaII | BslFI ||NlaIII TaqI || || ||AsuI* TspEI ||SalI || || |BmgT120I ApoI |AccI || || BssKI |TaqI || || NlaIV Hpy166II || |CauII* HindII || |HpaII || |ScrFI || XmaIII* || CfrI |HaeIII |CviJI McrI* V D M N F E C E N R P G P Y E F R E T * S T * T S N V K I G R D H M N L E K H X R H E L R M * K S A G T I * I * R N I X ----:----|----:----|----:----|----:----|----:----|----:----| T S M F K S H S F R G P G Y S N L S V Y Q R C S S R I H F D A P V M H I * L F M D V H V E F T F I P R S W I F K S F C L # Enzymes that cut Frequency Isoschizomers AarI 2 AccI 1 FblI,XmiI AciI 2 BspACI,SsiI AhaIII* 1 DraI AluI 5 AluBI ApaI 1 ApoI 1 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 2 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 1 BdaI 2 BinI* 1 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmeT110I 2 BmgT120I 3 BplI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseSI 1 BaeGI,BstSLI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI Bsp120I 1 PspOMI BspMI 3 BfuAI,Acc36I,BveI BsrI 1 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 1 CauII* 4 BcnI,BpuMI,NciI,AsuC2I Cfr9I 1 TspMI,XmaCI,XmaI CfrI 1 AcoI,EaeI Csp6I 2 CviQI,RsaNI CviAII 4 CviJI 10 CviKI-1 CviRI* 6 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 1 MalI DraIII 1 AdeI DrdI 2 AasI,DseDI EcoRII 1 AjnI,Psp6I,PspGI EcoRV 2 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 4 FauI 1 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GlaI 1 HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 4 HpyAV Hin6I 1 HinP1I,HspAI HindII 2 HincII HinfI 2 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 1 MaeI 3 FspBI,BfaI,XspI MaeIII 3 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 2 SchI MnlI 2 MseI 3 Tru1I,Tru9I MslI 2 RseI,SmiMI NdeI 1 FauNDI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I PleI 2 PpsI PspXI 1 PstI 1 RsaI 2 AfaI SalI 1 ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 13 SfeI* 2 BstSFI,SfcI,BfmI SmaI 1 SmlI 1 SmoI Sse8387I 1 SdaI,SbfI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaqI 4 TaqII 1 TseI 2 ApeKI Tsp45I 3 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 8 TspEI 6 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI XcmI 1 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 1 BstYI,MflI,PsuI,BstX2I XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AclI AcyI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaLI AscI Asp718I AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BceAI BcgI BciVI BclI BetI* BfiI BglI BglII BmtI Bpu10I BsaAI BsaBI BsaXI BseMII BsePI BseRI BseYI BsgI BsiI* BsiYI* BsmI Bsp1407I BspCNI BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstXI BstZ17I BtgZI BtrI BtsI Cac8I Cfr10I ClaI CspCI DinI DraII DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EgeI EheI Esp3I EspI* FalI FseI FspAI GsaI GsuI HaeII HgaI HgiCI* Hin4I HindIII Hpy99I KasI KpnI Ksp632I* MaeII MauBI MfeI MluI MmeI MroNI MstI* MwoI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PsrI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* ScaI SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SnaBI SpeI SphI SplI* SrfI Sse232I* StuI SwaI TaiI TatI TauI TfiI TsoI TstI Tth111I VspI XbaI XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769