Restriction Map of YNL150W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YNL150W on chromosome XIV from coordinates 349251 to 349658.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.21951

Hpy188I CviRI* TsoI | SfeI* \ \ \ \ ATGATGCAAGTAGCAACATCGGTAATGGTTAGACTATTTTATCAGAAAACTATAGAAAAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTACGTTCATCGTTGTAGCCATTACCAATCTGATAAAATAGTCTTTTGATATCTTTTT / / / / CviRI* TsoI Hpy188I SfeI* M M Q V A T S V M V R L F Y Q K T I E K * C K * Q H R * W L D Y F I R K L * K N D A S S N I G N G * T I L S E N Y R K T ----:----|----:----|----:----|----:----|----:----|----:----| X I C T A V D T I T L S N * * F V I S F X S A L L L M P L P * V I K D S F * L F H H L Y C C R Y H N S * K I L F S Y F F MaeIII MboII Tsp45I MnlI NlaIV | CviJI \ \ \ \ \ CTAAAAACAAAACAATGTCACAATGACAAAGAGGAACCCATACATACACAGAGAGCCTAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GATTTTTGTTTTGTTACAGTGTTACTGTTTCTCCTTGGGTATGTATGTGTCTCTCGGATA / / / / / | MnlI NlaIV | CviJI Tsp45I MboII MaeIII L K T K Q C H N D K E E P I H T Q R A Y * K Q N N V T M T K R N P Y I H R E P I K N K T M S Q * Q R G T H T Y T E S L F ----:----|----:----|----:----|----:----|----:----|----:----| S F V F C H * L S L S S G M C V C L A * V L F L V I D C H C L P V W V Y V S L R * F C F L T V I V F L F G Y M C L S G I SfaNI | AsuI* | AvaII | |NlaIV | |BmgT120I | || StyI | || MboII | || SecI* | || |PflMI MboII BsrI MnlI | || |BsiYI* |DdeI \ \ \ \\ \\ \\ TCTTCCAGTAGTTCCTCAATATCAGCATCACTATCTGGGTCCAACCCTTGGTTTCTTCTC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGGTCATCAAGGAGTTATAGTCGTAGTGATAGACCCAGGTTGGGAACCAAAGAAGAG / / //// // / / BsrI MnlI |||| || SecI* MboII |||| || StyI |||| |MboII |||| BsiYI* |||| PflMI |||AvaII |||AsuI* ||BmgT120I |NlaIV SfaNI S S S S S S I S A S L S G S N P W F L L L P V V P Q Y Q H H Y L G P T L G F F S F Q * F L N I S I T I W V Q P L V S S L ----:----|----:----|----:----|----:----|----:----|----:----| E E L L E E I D A D S D P D L G Q N R R N K W Y N R L I L M V I Q T W G K T E E R G T T G * Y * C * * R P G V R P K K E MboII CviJI Ksp632I* | MseI Ksp632I* |MmeI | MnlI | MboII | MaeI \\ \ \ \ \ \ \ TTAGCCTCTTCCAAAGCGTTTTCAAACAACTCCTGTTGTCTTTTAACTCTTCTTCTAGTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AATCGGAGAAGGTTTCGCAAAAGTTTGTTGAGGACAACAGAAAATTGAGAAGAAGATCAA // // / / / // |CviJI |Ksp632I* | | MseI |MaeI MmeI MnlI | MboII Ksp632I* DdeI MboII L A S S K A F S N N S C C L L T L L L V * P L P K R F Q T T P V V F * L F F * F S L F Q S V F K Q L L L S F N S S S S F ----:----|----:----|----:----|----:----|----:----|----:----| K A E E L A N E F L E Q Q R K V R R R T R L R K W L T K L C S R N D K L E E E L * G R G F R K * V V G T T K * S K K * N BbvI SfaNI TseI |CviJI MwoI || TaqI CviRI* || |MboI |BisI || || DpnI EcoP15I ||BlsI || || |BstKTI \ \\\ \\ \\ \\ TTCTTACCCCAACCGAAAGAAGTTGTTTCTGCTGTTGCAGCATCATCTGGCTTGTCGATC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAGAATGGGGTTGGCTTTCTTCAACAAAGACGACAACGTCGTAGTAGACCGAACAGCTAG / / //// / / // / EcoP15I | |||TseI | | || MboI | ||BisI | | || SetI | |BlsI | | |DpnI | CviRI* | | BstKTI MwoI | | TaqI | SfaNI | BbvI CviJI F L P Q P K E V V S A V A A S S G L S I S Y P N R K K L F L L L Q H H L A C R S L T P T E R S C F C C C S I I W L V D Q ----:----|----:----|----:----|----:----|----:----|----:----| K K G W G F S T T E A T A A D D P K D I K R V G V S L L Q K Q Q Q L M M Q S T S E * G L R F F N N R S N C C * R A Q R D AjuI | TseI | |BisI MboI | ||BlsI | DpnI MnlI AlfI | |||CviJI SetI | |BstKTI | BsmAI AlfI | |||| MboII \ \ \\ \ \ \ \ \\\\ \ AGGTCTTTTGATCTCTTTTCCTCTTTGTCTCGTTTGTCCTTTTCCACTTGGGCAGCCAAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCCAGAAAACTAGAGAAAAGGAGAAACAGAGCAAACAGGAAAAGGTGAACCCGTCGGTTG // / / / / / //// || MboI MnlI | AlfI AjuI |||MboII |DpnI | AlfI ||CviJI BstKTI BsmAI ||TseI |BisI BlsI R S F D L F S S L S R L S F S T W A A N G L L I S F P L C L V C P F P L G Q P T V F * S L F L F V S F V L F H L G S Q L ----:----|----:----|----:----|----:----|----:----|----:----| L D K S R K E E K D R K D K E V Q A A L * T K Q D R K R K T E N T R K W K P L W P R K I E K G R Q R T Q G K G S P C G V SfaNI TspEI | AlfI | AlfI | | BssKI | | SecI* | | EcoRII | | |BstXI SmlI | | ||ScrFI FokI | | ||BseBI AflII BbvI | | ||| AjuI BseGI |MseI \ \ \ \\\ \ \ \\ TGCTTCTTCGCCAATTCCCTGGATGCGATATTTCTTAAGAGTAAATAA 370 380 390 400 ----:----|----:----|----:----|----:----|----:--- ACGAAGAAGCGGTTAAGGGACCTACGCTATAAAGAATTCTCATTTATT / // / /// / // BbvI || | ||| BseGI |AflII || | ||EcoRII |FokI || | ||BssKI |SmlI || | |SecI* MseI || | BseBI || | ScrFI || TspEI || SfaNI || AjuI |BstXI AlfI AlfI C F F A N S L D A I F L K S K * A S S P I P W M R Y F L R V N X L L R Q F P G C D I S * E * I X ----:----|----:----|----:----|----:----|----:--- Q K K A L E R S A I N R L L L Y S S R R W N G P H S I E * S Y I A E E G I G Q I R Y K K L T F L # Enzymes that cut Frequency Isoschizomers AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AjuI 1 AlfI 2 AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 2 BstXI 1 CviJI 4 CviKI-1 CviRI* 2 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 2 MalI EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI FokI 1 Hpy188I 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeIII 1 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 MmeI 1 MnlI 4 MseI 2 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NlaIV 2 BspLI,BmiI,PspN4I PflMI 1 BasI,AccB7I,Van91I ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 1 SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaqI 1 TseI 2 ApeKI TsoI 1 Tsp45I 1 NmuCI TspEI 1 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AflIII AgeI AhaIII* AloI AluI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviAII CviQI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FatI FauI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindII HindIII HinfI HinP1I HpaI HpaII HphI Hpy166II Hpy178III*Hpy8I Hpy99I HspAI KasI KpnI MaeII MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaiI TaqII TatI TauI TfiI Tsp4CI* TspDTI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769