Restriction Map of PHO23/YNL097C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PHO23/YNL097C on chromosome XIV from coordinates 442358 to 441366.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.26817

EMBOSS_001 XmnI |SetI || BssKI || SecI* MaeII ApoI || EcoRII |MnlI TspEI || | ScrFI |BtrI EcoRI || | BseBI || SetI | GsuI Hpy166II || | | MseI || TaiI | Eco57MI \ \\ \ \ \ \\ \ \ \ ATGAGTTCACCAGCGAACCTATTCCCTGGATTAAACGACATAACTGACGTGCTGGAGGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCAAGTGGTCGCTTGGATAAGGGACCTAATTTGCTGTATTGACTGCACGACCTCCTT / / / /// / //// / Hpy166II | XmnI ||| MseI |||MaeII Eco57MI SetI ||EcoRII ||BtrI GsuI ||BssKI |MnlI |SecI* TaiI BseBI SetI ScrFI M S S P A N L F P G L N D I T D V L E E * V H Q R T Y S L D * T T * L T C W R N E F T S E P I P W I K R H N * R A G G I ----:----|----:----|----:----|----:----|----:----|----:----| X L E G A F R N G P N F S M V S T S S S X S N V L S G I G Q I L R C L Q R A P P H T * W R V * E R S * V V Y S V H Q L F CfrI | BalI | CviJI | HaeIII | |BsrI | |TspRI | || GsuI | || Eco57MI | || | SetI | || | |Hpy178III* | || | || MnlI | || | || |MseI BsmI | || | || || BcgI SfaNI CviRI* CviRI* \ \\ \ \\ \\ \ \ \ \ TTCCCACTGGCCACCTCCAGATATTTAACATTACTACACGAAATAGATGCAAAATGTGTG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGGTGACCGGTGGAGGTCTATAAATTGTAATGATGTGCTTTATCTACGTTTTACACAC / //// / / // / / / / EcoRI |||CfrI | | |MseI SfaNI CviRI* | CviRI* TspEI |||SetI | | BcgI | BcgI TspRI ||Eco57MI | MnlI BsmI ApoI ||GsuI Hpy178III* |HaeIII |CviJI |BalI BsrI F P L A T S R Y L T L L H E I D A K C V S H W P P P D I * H Y Y T K * M Q N V C P T G H L Q I F N I T T R N R C K M C A ----:----|----:----|----:----|----:----|----:----|----:----| N G S A V E L Y K V N S C S I S A F H T I G V P W R W I N L M V V R F L H L I H E W Q G G G S I * C * * V F Y I C F T H BcgI | MwoI | BstAPI | | ApoI | | TspEI FalI Hpy178III* MboII | | | MnlI FalI | XmnI |HphI MboI \ \ \ \ \ \ \ \\ \ CATTCTATGCCGAATTTGAACGAGAGGATAGATAAGTTCTTGAAGAAAGACTTCAATAAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAGATACGGCTTAAACTTGCTCTCCTATCTATTCAAGAACTTCTTTCTGAAGTTATTT / / / / / // BstAPI TspEI FalI | | |HphI MwoI ApoI FalI | | MboII MnlI | XmnI Hpy178III* H S M P N L N E R I D K F L K K D F N K I L C R I * T R G * I S S * R K T S I K F Y A E F E R E D R * V L E E R L Q * R ----:----|----:----|----:----|----:----|----:----|----:----| C E I G F K F S L I S L N K F F S K L L A N * A S N S R S S L Y T R S S L S * Y M R H R I Q V L P Y I L E Q L F V E I F DpnI |BstKTI || FalI BtgZI || FalI SfaNI \\ \ \ GATCACCAAACACAAGTAAGACTGCTCAATAATATCAACAAGATTTATGAAGAACTGATG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGTGGTTTGTGTTCATTCTGACGAGTTATTATAGTTGTTCTAAATACTTCTTGACTAC // / / / || MboI SfaNI TspDTI |DpnI BtgZI MboII BstKTI FalI FalI D H Q T Q V R L L N N I N K I Y E E L M I T K H K * D C S I I S T R F M K N * C S P N T S K T A Q * Y Q Q D L * R T D A ----:----|----:----|----:----|----:----|----:----|----:----| S * W V C T L S S L L I L L I * S S S I L D G F V L L V A * Y Y * C S K H L V S I V L C L Y S Q E I I D V L N I F F Q H FatI CviRI* |CviAII ||EcoT22I ||| NspI ||| BseRI ||| NlaIII ||| | GsuI XbaI MboII ||| | BseGI BslFI |TspDTI ||| | Eco57MI |MaeI ||MnlI BccI FokI ||| | | BsmAI BstXI |Hpy178III* \\\ \ \ \\\ \ \ \ \ \\ CCATCGCTGGAGGAGAAAATGCATGTCTCATCCATTATGCTGGATAATCTAGACAGATTG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGCGACCTCCTCTTTTACGTACAGAGTAGGTAATACGACCTATTAGATCTGTCTAAC / / / / //// // // / MnlI BccI | | |||Eco57MI |BstXI |BslFI AatII | | |||BseGI BsmAI |XbaI TaiI | | |||GsuI | SetI | | ||FatI Hpy178III* | | |CviAII MaeI | | BseRI | CviRI* | NlaIII | NspI EcoT22I FokI P S L E E K M H V S S I M L D N L D R L H R W R R K C M S H P L C W I I * T D * I A G G E N A C L I H Y A G * S R Q I D ----:----|----:----|----:----|----:----|----:----|----:----| G D S S S F I C T E D M I S S L R S L N A M A P P S F A H R M W * A P Y D L C I W R Q L L F H M D * G N H Q I I * V S Q AcyI MaeII |ZraI || SetI || TaiI || BssKI || AatII ApoI || | HpaII TstI TspEI || | ScrFI | Hpy178III* | MnlI TaqII || | CauII* TspEI | | TspDTI | | MaeI | SetI \\ \ \ \ \ \ \ \ \ \ \ \ ACGTCCCGGTTAGAATTGGCGTATGAAGTCGCAATCAAGAACACAGAAATTCCTAGAGGT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGCAGGGCCAATCTTAACCGCATACTTCAGCGTTAGTTCTTGTGTCTTTAAGGATCTCCA // /// / / / / / / // / || ||BssKI TspEI TstI | | | | || TstI || |HpaII | | | | |TaqII || CauII* | | | | |SetI || ScrFI | | | | MaeI |MaeII | | | TspEI |AcyI | | | ApoI ZraI | | MnlI | Hpy178III* TspDTI T S R L E L A Y E V A I K N T E I P R G R P G * N W R M K S Q S R T Q K F L E V V P V R I G V * S R N Q E H R N S * R F ----:----|----:----|----:----|----:----|----:----|----:----| V D R N S N A Y S T A I L F V S I G L P S T G T L I P T H L R L * S C L F E * L R G P * F Q R I F D C D L V C F N R S T BccI | CviRI* | | BsrDI | | | SetI | | | | FatI MseI | | | | BspHI | TstI | | | | |CviAII | | FokI | | | | |Hpy178III* | | | BsrI | | | | || MnlI | | | | Hpy166II | | | | || NlaIII Hin4I | | | | |BfiI BseGI | | | | || |BccI | TspDTI \ \ \ \ \\ \ \ \ \ \ \\ \\ \ \ TTAAGACTGGGTGTGGACAACCATCCAGCAATGCACCTCCATCATGAACTAATGGAAAAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AATTCTGACCCACACCTGTTGGTAGGTCGTTACGTGGAGGTAGTACTTGATTACCTTTTT / / / / / / // / // / / / MseI | | | BseGI | |SetI | || | Hin4I TspDTI | | Hpy166II | CviRI* | || BccI | | BfiI | BsrDI | |BspHI | FokI BccI | |FatI BsrI | Hpy178III* | CviAII | MnlI NlaIII L R L G V D N H P A M H L H H E L M E K * D W V W T T I Q Q C T S I M N * W K K K T G C G Q P S S N A P P S * T N G K N ----:----|----:----|----:----|----:----|----:----|----:----| K L S P T S L W G A I C R W * S S I S F N L V P H P C G D L L A G G D H V L P F * S Q T H V V M W C H V E M M F * H F F Hin4I | Hpy99I | | Cac8I | | | SapI | | | Ksp632I* | | | | AlwNI | | | | | TspRI | | | | | | TfiI | | | | | | HinfI | | | | | | | Ksp632I* | | | | | | | | Hpy178III* | | | | | | | | |MboII | | | | | | | | || BbvI | | | | | | | | || | Eco57I | | | | | | | | || | Eco57MI \ \ \ \ \ \ \ \ \\ \ \ ATAGAGAGCAAATCAAACAGCAAATCGTCGCAGGCACTGAAGAGCGAATCAAGAAGAGAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TATCTCTCGTTTAGTTTGTCGTTTAGCAGCGTCCGTGACTTCTCGCTTAGTTCTTCTCTT / / // / //// / / | Hpy99I || Ksp632I* |||| | BbvI Hin4I || SapI |||| Eco57MI |AlwNI |||| Eco57I Cac8I |||Hpy178III* TspRI ||Ksp632I* |MboII HinfI TfiI I E S K S N S K S S Q A L K S E S R R E * R A N Q T A N R R R H * R A N Q E E K R E Q I K Q Q I V A G T E E R I K K R S ----:----|----:----|----:----|----:----|----:----|----:----| I S L L D F L L D D C A S F L S D L L S F L S C I L C C I T A P V S S R I L F L Y L A F * V A F R R L C Q L A F * S S F CviJI |FatI |NcoI |StyI |SecI* |DsaI* ||CviAII ||| MboII ||| |NlaIII ||| ||TseI ||| ||MwoI ||| ||CviJI ||| |||BisI ||| ||||BlsI AciI MlyI ||| ||||| MnlI BsiYI* EciI | Cac8I PleI \\\ \\\\\ \ \ \ \ \ \ GCCATGGCTGCCAACAGGAGGCAGGGCGAACATTACTCCGCCAGCACACACCAACAAGAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTACCGACGGTTGTCCTCCGTCCCGCTTGTAATGAGGCGGTCGTGTGTGGTTGTTCTG // /////// / / / / // || ||||||| BsiYI* EciI | Cac8I |PleI || ||||||TseI AciI MlyI || ||||||MnlI || |||||BisI || ||||BlsI || |||CviJI || ||DsaI* || ||SecI* || ||StyI || ||NcoI || ||FatI || |CviAII || MboII || MwoI |NlaIII CviJI A M A A N R R Q G E H Y S A S T H Q Q D P W L P T G G R A N I T P P A H T N K T H G C Q Q E A G R T L L R Q H T P T R R ----:----|----:----|----:----|----:----|----:----|----:----| A M A A L L L C P S C * E A L V C W C S L W P Q W C S A P R V N S R W C V G V L G H S G V P P L A F M V G G A C V L L V TseI |BisI ||BlsI ||| Cac8I Bce83I* ||| | BsiI* |MaeIII Hpy99I ||| | |TspGWI || BsrI | MnlI ||| | || BbvI || TspRI HinfI | | HgaI ||| | || | CviJI XcmI || EcoP15I \ \ \ \ \\\ \ \\ \ \ \ \\ \ GACTCAAAGAACGACGCAAACTACGGAGGCAGCAGGCACGAGAGCCAAGACCACACTGGT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAGTTTCTTGCTGCGTTTGATGCCTCCGTCGTCCGTGCTCTCGGTTCTGGTGTGACCA / / / / /// / / / // / / / HinfI Hpy99I MnlI | ||| | | | |BbvI | | BsrI | ||| | | | CviJI | Bce83I* | ||| | | BsiI* TspRI | ||| | TspGWI XcmI | ||| Cac8I | ||TseI | |BisI | BlsI HgaI D S K N D A N Y G G S R H E S Q D H T G T Q R T T Q T T E A A G T R A K T T L V L K E R R K L R R Q Q A R E P R P H W * ----:----|----:----|----:----|----:----|----:----|----:----| S E F F S A F * P P L L C S L W S W V P R S L S R R L S R L C C A R S G L G C Q V * L V V C V V S A A P V L A L V V S T BinI* | MboI | |BsmAI TseI | |Eco31I SmlI MwoI | ||DpnI | Hpy178III* |BisI | |||BstKTI | | BbvI CviJI ||BlsI | ||||Hpy178III* \ \ \ \ \\\ \ \\\\\ AACAACACAAACTCAAGAAAAAGAGCCAACGCTGCCAATACCAACAACGCCGATCCAGAG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTGTGTTTGAGTTCTTTTTCTCGGTTGCGACGGTTATGGTTGTTGCGGCTAGGTCTC // / / / / /// / // /// |MaeIII | | | | ||TseI | || ||Hpy178III* EcoP15I | | | | |BisI | || |Eco31I | | | | BlsI | || |BsmAI | | | MwoI | || MboI | | CviJI | |DpnI | BbvI | BstKTI Hpy178III* BinI* SmlI N N T N S R K R A N A A N T N N A D P E T T Q T Q E K E P T L P I P T T P I Q R Q H K L K K K S Q R C Q Y Q Q R R S R D ----:----|----:----|----:----|----:----|----:----|----:----| L L V F E L F L A L A A L V L L A S G S Y C C L S L F F L W R Q W Y W C R R D L V V C V * S F S G V S G I G V V G I W L BseRI |MwoI ||HphI BceAI MnlI BceAI ||| CviJI |MwoI \ \ \\\ \ \\ ACCAAAAAACGCAAGAGGAGAGTTGCCACCACAGCCGTTTCACCAAGCACTATCAGCACG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTTTTTGCGTTCTCCTCTCAACGGTGGTGTCGGCAAAGTGGTTCGTGATAGTCGTGC / / / / / / / MnlI BceAI | | CviJI | BceAI | HphI MwoI BseRI MwoI T K K R K R R V A T T A V S P S T I S T P K N A R G E L P P Q P F H Q A L S A R Q K T Q E E S C H H S R F T K H Y Q H G ----:----|----:----|----:----|----:----|----:----|----:----| V L F R L L L T A V V A T E G L V I L V S W F V C S S L Q W W L R K V L C * * C G F F A L P S N G G C G N * W A S D A R MmeI |BssKI |EcoRII HgaI ||SecI* Csp6I |||ScrFI TseI |RsaI |||BseBI |BisI BceAI |SetI SfeI* |||| HgaI ||BlsI \ \\ \ \\\\ \ \\\ GCAACTGCCGTCAATAATGGCAGGATAGGTACATCTACAGCGTCCAGGGGAGTTAGCAGC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTGACGGCAGTTATTACCGTCCTATCCATGTAGATGTCGCAGGTCCCCTCAATCGTCG / / // / // / / / /// BceAI | || HgaI |MmeI | | | ||Hpy99I | |Csp6I SfeI* | | | ||TseI | RsaI | | | |BisI SetI | | | BlsI | | HgaI | EcoRII | BssKI | SecI* BseBI ScrFI A T A V N N G R I G T S T A S R G V S S Q L P S I M A G * V H L Q R P G E L A A N C R Q * W Q D R Y I Y S V Q G S * Q R ----:----|----:----|----:----|----:----|----:----|----:----| A V A T L L P L I P V D V A D L P T L L P L Q R * Y H C S L Y M * L T W P L * C C S G D I I A P Y T C R C R G P S N A A Hpy99I Hpy188I EcoRV AciI | BbvI MwoI | Hpy178III* EcoP15I | BsrBI \ \ \ \ \ \ \ \ GTCGGAAACAGCAACAACAGCAGGATATCAAGACCAAAAACCAACGACTACGGCGAACCG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCCTTTGTCGTTGTTGTCGTCCTATAGTTCTGGTTTTTGGTTGCTGATGCCGCTTGGC / / / / / / / Hpy188I | MwoI | Hpy178III* EcoP15I BsrBI BbvI EcoRV AciI V G N S N N S R I S R P K T N D Y G E P S E T A T T A G Y Q D Q K P T T T A N R R K Q Q Q Q Q D I K T K N Q R L R R T A ----:----|----:----|----:----|----:----|----:----|----:----| T P F L L L L L I D L G F V L S * P S G R R F C C C C C S I L V L F W R S R R V D S V A V V A P Y * S W F G V V V A F R Hin6I MaeIII |GlaI BceAI Tsp4CI* TsoI BccI ||HhaI \ \ \ \ \\\ CTCTACTGCTACTGTAACCAAGTGGCATACGGGGAAATGGTGGGGTGTGATGGCGCAGAC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GAGATGACGATGACATTGGTTCACCGTATGCCCCTTTACCACCCCACACTACCGCGTCTG / / / / / /// / | | MaeIII TsoI BccI ||| Tsp4CI* | Tsp4CI* ||Hin6I BceAI |GlaI HhaI L Y C Y C N Q V A Y G E M V G C D G A D S T A T V T K W H T G K W W G V M A Q T L L L L * P S G I R G N G G V * W R R L ----:----|----:----|----:----|----:----|----:----|----:----| S * Q * Q L W T A Y P S I T P H S P A S A R S S S Y G L P M R P F P P T H H R L E V A V T V L H C V P F H H P T I A C V FatI |CviAII || MlyI || PleI Tsp4CI* || NlaIII | AluI || | PflMI | CviJI || | BsiYI* DdeI | |MaeI || | | HinfI SauI* | ||SetI NlaIV || | | | TaqI |SetI \ \\\ \ \\ \ \ \ \ \\ TGTGAGCTAGAATGGTTCCATTTGCCATGTATTGGACTCGAAACTCTACCTAAGGGCAAG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ACACTCGATCTTACCAAGGTAAACGGTACATAACCTGAGCTTTGAGATGGATTCCCGTTC / / / / / /// / / / / | | MaeI NlaIV | ||PleI | TaqI SetI SauI* | CviJI | |FatI HinfI DdeI | AluI | |MlyI SetI | BsiYI* | CviAII | PflMI NlaIII C E L E W F H L P C I G L E T L P K G K V S * N G S I C H V L D S K L Y L R A S * A R M V P F A M Y W T R N S T * G Q V ----:----|----:----|----:----|----:----|----:----|----:----| Q S S S H N W K G H I P S S V R G L P L S H A L I T G N A M Y Q V R F E V * P C T L * F P E M Q W T N S E F S * R L A L Hpy99I |MwoI || CviRI* Tsp4CI* \\ \ \ TGGTATTGCGACGACTGCAAAAAAAAACTGTGA 970 980 990 ----:----|----:----|----:----|--- ACCATAACGCTGCTGACGTTTTTTTTTGACACT / / / / | MwoI CviRI* Tsp4CI* Hpy99I W Y C D D C K K K L * G I A T T A K K N C X V L R R L Q K K T V X ----:----|----:----|----:----|--- H Y Q S S Q L F F S H T T N R R S C F F V T P I A V V A F F F Q S # Enzymes that cut Frequency Isoschizomers AatII 1 AciI 2 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AluI 1 AluBI AlwNI 1 CaiI ApoI 3 AcsI,XapI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 4 BseXI,BstV1I,Lsp1109I BccI 4 Bce83I* 1 BpuEI BceAI 4 BcgI 1 BfiI 1 BmrI,BmuI BinI* 1 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseRI 2 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspHI 1 CciI,PagI,RcaI BsrBI 1 AccBSI,MbiI BsrDI 1 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstAPI 1 BstKTI 2 BstXI 1 BtgZI 1 BtrI 1 BmgBI,AjiI Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI Csp6I 1 CviQI,RsaNI CviAII 4 CviJI 7 CviKI-1 CviRI* 5 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 2 MalI DsaI* 1 BtgI,BstDSI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 4 EcoP15I 2 EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 2 FatI 4 FokI 2 GlaI 1 GsuI 3 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HhaI 1 BstHHI,CfoI,AspLEI Hin4I 1 Hin6I 1 HinP1I,HspAI HinfI 3 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 1 Hpy99I 4 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 2 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MlyI 2 SchI MmeI 1 MnlI 9 MseI 3 Tru1I,Tru9I MwoI 7 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 2 PpsI RsaI 1 AfaI SapI 1 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 3 BmrFI,MspR9I,Bme1390I SecI* 3 BseDI,BssECI,BsaJI SetI 9 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 1 TaqII 1 TfiI 1 PfeI TseI 4 ApeKI TsoI 1 Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 4 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI TstI 1 XbaI 1 XcmI 1 XmnI 2 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AccI AclI AflII AflIII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BamHI BarI BbvCI BbvII* BciVI BclI BdaI BetI* BglI BglII BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseMII BsePI BseSI BseYI BsgI Bsp120I Bsp1407I BspCNI BspLU11I* BspMI BspMII* BspOI BssNAI Bst1107I BstEII BstZ17I BtsI Cfr10I Cfr9I ClaI CspCI DinI DraII DraIII DrdI Eam1105I Ecl136II Eco47III EcoICRI EcoNI EgeI EheI Esp3I EspI* FauI FnuDII* FseI FspAI GsaI HaeII HgiAI* HgiCI* HgiJII* Hin4II* HindII HindIII HpaI KasI KpnI MauBI McrI* MfeI MluI MroNI MslI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NspBII* OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TatI TauI Tsp45I TspMI Tth111I VspI XhoI XhoII XmaCI XmaI XmaIII* # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769