Restriction Map of RPS7B/YNL096C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

RPS7B/YNL096C on chromosome XIV from coordinates 444315 to 443398.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 MboI BglII XhoII | DpnI AluI | |BstKTI CviJI MnlI | || MmeI | SetI TspEI TspDTI \ \ \\ \ \ \ \ \ ATGTCCTCTGTCCAATCCAAGATCTTATCCCAAGCTCCAAGTGAGTTGGAATTACAAGTC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGGAGACAGGTTAGGTTCTAGAATAGGGTTCGAGGTTCACTCAACCTTAATGTTCAG / // / / / / / MnlI || XhoII | CviJI | TspDTI || BglII | AluI TspEI || MboI SetI || MmeI |DpnI BstKTI M S S V Q S K I L S Q A P S E L E L Q V C P L S N P R S Y P K L Q V S W N Y K S V L C P I Q D L I P S S K * V G I T S R ----:----|----:----|----:----|----:----|----:----|----:----| X D E T W D L I K D W A G L S N S N C T X T R Q G I W S R I G L E L H T P I V L H G R D L G L D * G L S W T L Q F * L D SetI | TaqI | ClaI | |MboI | || GsuI | || DpnI | || Eco57MI | || |XbaI | || |BseRI | || |BstKTI | || |Hin4II* | || ||MaeI | || ||Hpy178III* FalI CviJI | || ||| AluI FalI | BsmAI | || ||| CviJI Hpy178III* | Eco31I | || ||| | SetI | MnlI | | SmlI BsrDI \ \\ \\\ \ \ \ \ \ \ \ \ GCCAAGACCTTCATCGATCTAGAAAGCTCCTCTCCAGAACTAAAGGCTGACTTGAGACCA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTCTGGAAGTAGCTAGATCTTTCGAGGAGAGGTCTTGATTTCCGACTGAACTCTGGT / /// / // / / / / / / / // SetI ||| | || | | FalI | MnlI CviJI | |BsrDI ||| | || | | FalI Hpy178III* | SmlI ||| | || | CviJI Eco31I ||| | || | AluI BsmAI ||| | || SetI ||| | |XbaI ||| | Hpy178III* ||| | MaeI ||| MboI ||Hin4II* ||DpnI |BstKTI |BseRI |ClaI |TaqI Eco57MI GsuI A K T F I D L E S S S P E L K A D L R P P R P S S I * K A P L Q N * R L T * D H Q D L H R S R K L L S R T K G * L E T I ----:----|----:----|----:----|----:----|----:----|----:----| A L V K M S R S L E E G S S F A S K L G R W S R * R D L F S R E L V L P Q S S V G L G E D I * F A G R W F * L S V Q S W CviRI* TseI | FalI Bce83I* |BisI | FalI | Hpy188I MseI TspEI ||BlsI \ \ \ \ \ \ \\\ TTGCAAATCAAATCTATCAGAGAAGTATGTTAAAAGTTATATAATTTGGAAGCAGCAACA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTTTAGTTTAGATAGTCTCTTCATACAATTTTCAATATATTAAACCTTCGTCGTTGT / / / / / / /// / | CviRI* Bce83I* Hpy188I MseI TspEI ||TseI MboII FalI |BisI FalI BlsI L Q I K S I R E V C * K L Y N L E A A T C K S N L S E K Y V K S Y I I W K Q Q H A N Q I Y Q R S M L K V I * F G S S N I ----:----|----:----|----:----|----:----|----:----|----:----| N C I L D I L S T H * F N Y L K S A A V M A F * I * * L L I N F T I Y N P L L L Q L D F R D S F Y T L L * I I Q F C C C MboII | BbvI | | FalI CviRI* FalI | | FalI | TspEI FalI \ \ \ \ \ \ TTGTGATTTCTTCTAAAGGGGTTCTTTGCAGTAATTTTTTCAAAAAAGAGTGATTTTGAG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AACACTAAAGAAGATTTCCCCAAGAAACGTCATTAAAAAAGTTTTTTCTCACTAAAACTC / / / / / FalI BbvI | | TspEI FalI | FalI | FalI CviRI* L * F L L K G F F A V I F S K K S D F E C D F F * R G S L Q * F F Q K R V I L S V I S S K G V L C S N F F K K E * F * A ----:----|----:----|----:----|----:----|----:----|----:----| N H N R R F P N K A T I K E F F L S K S M T I E E L P T R Q L L K K L F S H N Q Q S K K * L P E K C Y N K * F L T I K L FatI |CviAII AlwNI || NlaIII Hpy188I | TspDTI || | TspDTI | AluI | | ApoI || | | TaqI | CviJI | | TspEI || | | |Hpy178III* TspEI | | SetI \ \ \ \\ \ \ \\ \ \ \ \ CAGTATCTGTATGAAATTTTCATGTGTTCGAGAAAAATAGTAATTCCGAGAGCTGTCAAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTCATAGACATACTTTAAAAGTACACAAGCTCTTTTTATCATTAAGGCTCTCGACAGTTA / / / / // // // / / | TspDTI | | || |Hpy178III* || | CviJI AlwNI | | || TaqI || | AluI | | |TspDTI || SetI | | |FatI |Hpy188I | | CviAII TspEI | NlaIII TspEI ApoI Q Y L Y E I F M C S R K I V I P R A V N S I C M K F S C V R E K * * F R E L S I V S V * N F H V F E K N S N S E S C Q Y ----:----|----:----|----:----|----:----|----:----|----:----| C Y R Y S I K M H E L F I T I G L A T L A T D T H F K * T N S F F L L E S L Q * L I Q I F N E H T R S F Y Y N R S S D I FatI |CviAII || NlaIII TspDTI StuI || | AclI |CviJI CviJI FalI || | MaeII || FalI HaeIII MnlI FalI || | | SetI || FalI | StyI | Csp6I | TaqI || | | TaiI || | BtgZI | SecI* | |RsaI | ClaI \\ \ \ \ \\ \ \ \ \ \ \\ \ \ ACCATGAACGTTGCGATGAGCCTTTGAACTATAAAGGCCTCCTTGGTCAGTACCAATATC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTACTTGCAACGCTACTCGGAAACTTGATATTTCCGGAGGAACCAGTCATGGTTATAG / /// / / / / / / / // | ||| MaeII | CviJI | HaeIII | | |Csp6I | ||| AclI | FalI | CviJI | | |FalI | ||TaiI | FalI | StuI | | |FalI | ||SetI TspDTI BtgZI | | RsaI | |FatI | MnlI | CviAII SecI* NlaIII StyI T M N V A M S L * T I K A S L V S T N I P * T L R * A F E L * R P P W S V P I S H E R C D E P L N Y K G L L G Q Y Q Y R ----:----|----:----|----:----|----:----|----:----|----:----| V M F T A I L R Q V I F A E K T L V L I Y W S R Q S S G K F * L P R R P * Y W Y G H V N R H A K S S Y L G G Q D T G I D TspDTI | Cac8I StyI TfiI | | FnuDII* SetI SecI* HinfI MboII \ \ \ \ \ \ \ GATGAATAAAATAGAAGCACGCGAAAAAGACCTTACCCCAAGGAGAAGAATCACAAACCC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTATTTTATCTTCGTGCGCTTTTTCTGGAATGGGGTTCCTCTTCTTAGTGTTTGGG / / / / / / / / ClaI | | FnuDII* SetI SecI* | MboII TaqI | Cac8I StyI HinfI TspDTI TfiI D E * N R S T R K R P Y P K E K N H K P M N K I E A R E K D L T P R R R I T N P * I K * K H A K K T L P Q G E E S Q T L ----:----|----:----|----:----|----:----|----:----|----:----| S S Y F L L V R F L G * G L S F F * L G R H I F Y F C A F F V K G W P S S D C V I F L I S A R S F S R V G L L L I V F G XmnI TspEI | TspDTI | |MaeIII | || TspDTI | || | BbvI TseI BdaI | || | | BdaI |BisI TfiI BdaI | || | | BdaI ||BlsI HinfI \ \ \\ \ \ \ \\\ \ TTTTTTGTTATGAATGAACCAATTCAGTTACTAACTTTATTTCAACGCTGCTTGATTCTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAAACAATACTTACTTGGTTAAGTCAATGATTGAAATAAAGTTGCGACGAACTAAGAA / / // / / / / /// / BdaI | || | | | BbvI ||TseI HinfI BdaI | || | | BdaI |BisI TfiI | || | | BdaI BlsI | || | MaeIII | || TspDTI | |TspEI | TspDTI XmnI F F V M N E P I Q L L T L F Q R C L I L F L L * M N Q F S Y * L Y F N A A * F L F C Y E * T N S V T N F I S T L L D S Y ----:----|----:----|----:----|----:----|----:----|----:----| K K T I F S G I * N S V K N * R Q K I R R K Q * S H V L E T V L K I E V S S S E K K N H I F W N L * * S * K L A A Q N K MaeIII Tsp45I | AgeI | BetI* | SgrAI BslFI | Cfr10I | SpeI HphI | |HpaII | |MaeI BfiI BsrI \ \ \\ \ \\ \ \ ATTGTTTAGATTGATGTCACCGGTGGTAAGAAAGCACTAGTCCTTTTTGTCCCAGTTCCA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TAACAAATCTAACTACAGTGGCCACCATTCTTTCGTGATCAGGAAAAACAGGGTCAAGGT / / // /// / / / HphI | |Cfr10I ||SpeI BfiI BsrI SetI | |SgrAI |MaeI | |BetI* BslFI | |AgeI | HpaII Tsp45I MaeIII I V * I D V T G G K K A L V L F V P V P L F R L M S P V V R K H * S F L S Q F Q C L D * C H R W * E S T S P F C P S S S ----:----|----:----|----:----|----:----|----:----|----:----| I T * I S T V P P L F A S T R K T G T G * Q K S Q H * R H Y S L V L G K Q G L E N N L N I D G T T L F C * D K K D W N W AluI CviJI AsuI* | SetI AvaII | | MwoI |BmgT120I TspEI ApoI | | | CviRI* ||SetI TspEI | BsiYI* TspEI \ \ \ \ \\\ \ \ \ \ GCTTTGTCTGCATACCATAAGGTCCAAACCAAATTGACCCGTGAATTGGAAAAGAAATTC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAACAGACGTATGGTATTCCAGGTTTGGTTTAACTGGGCACTTAACCTTTTCTTTAAG / / / / // / / / / | MwoI CviRI* | |AvaII TspEI | TspEI TspEI CviJI | |AsuI* BsiYI* ApoI AluI | BmgT120I SetI A L S A Y H K V Q T K L T R E L E K K F L C L H T I R S K P N * P V N W K R N S F V C I P * G P N Q I D P * I G K E I P ----:----|----:----|----:----|----:----|----:----|----:----| A K D A Y W L T W V L N V R S N S F F N L K T Q M G Y P G F W I S G H I P F S I S Q R C V M L D L G F Q G T F Q F L F E Tsp4CI* XbaI | FatI |MaeI | |CviAII TfiI |Hpy178III* | || NlaIII CviJI HinfI MboII || BccI \ \\ \ \ \ \ \\ \ CCTGACCGTCATGTTATTTTCTTGGCTGAAAGAAGAATCTTGCCAAAACCATCTAGAACA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTGGCAGTACAATAAAAGAACCGACTTTCTTCTTAGAACGGTTTTGGTAGATCTTGT / / // / / / // / | | |FatI CviJI | MboII || BccI | | CviAII HinfI |XbaI | NlaIII TfiI Hpy178III* Tsp4CI* MaeI P D R H V I F L A E R R I L P K P S R T L T V M L F S W L K E E S C Q N H L E H * P S C Y F L G * K K N L A K T I * N I ----:----|----:----|----:----|----:----|----:----|----:----| G S R * T I K K A S L L I K G F G D L V G Q G D H * K R P Q F F F R A L V M * F R V T M N N E Q S F S S D Q W F W R S C XbaI |MaeI |Hpy178III* || BsmAI || Eco31I || |EcoP15I || || BinI* || || | MboI || || | XhoII || || | | DpnI Hpy166II || || | | |BstKTI |Hpy178III* || || | | ||Hpy178III* || SetI \\ \\ \ \ \\\ \\ \ TCTAGACAAGTCCAAAAGAGACCAAGATCCAGAACTTTGACTGCTGTTCACGACAAGGTT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGATCTGTTCAGGTTTTCTCTGGTTCTAGGTCTTGAAACTGACGACAAGTGCTGTTCCAA // // / // / / / / / |XbaI || | || | Hpy178III* | | SetI Hpy178III* || | || XhoII | Hpy178III* MaeI || | || MboI Hpy166II || | |DpnI || | BstKTI || BinI* |Eco31I |BsmAI EcoP15I S R Q V Q K R P R S R T L T A V H D K V L D K S K R D Q D P E L * L L F T T R F * T S P K E T K I Q N F D C C S R Q G F ----:----|----:----|----:----|----:----|----:----|----:----| D L C T W F L G L D L V K V A T * S L T M * V L G F S V L I W F K S Q Q E R C P R S L D L L S W S G S S Q S S N V V L N FatI |CviAII || BbvII* || |NlaIII || || MboII TspEI \\ \\ \ \ TTGGAAGACATGGTTTTCCCAACTGAAATTGTCGGTAAAAGAGTTAGATATTTGGTTGGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTTCTGTACCAAAAGGGTTGACTTTAACAGCCATTTTCTCAATCTATAAACCAACCA / // / / | || BbvII* TspEI | || MboII | |FatI | CviAII NlaIII L E D M V F P T E I V G K R V R Y L V G W K T W F S Q L K L S V K E L D I W L V G R H G F P N * N C R * K S * I F G W W ----:----|----:----|----:----|----:----|----:----|----:----| K S S M T K G V S I T P L L T L Y K T P K P L C P K G L Q F Q R Y F L * I N P Q Q F V H N E W S F N D T F S N S I Q N T MaeIII | BinI* | | MboI | | XhoII SetI HinfI | | | DpnI | MlyI | StyI MmeI FokI | | | |BstKTI | PleI | SecI* |BseGI |TaqI \ \ \ \\ \ \ \ \ \\ \\ GGTAACAAGATCCAAAAGGTTTTGTTAGACTCCAAGGATGTTCAACAAATCGACTACAAG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTGTTCTAGGTTTTCCAAAACAATCTGAGGTTCCTACAAGTTGTTTAGCTGATGTTC / / // / / // / / // // | | || | SetI |PleI | | |BseGI |FokI | | || XhoII MlyI | | MmeI TaqI | | || MboI | SecI* | | |DpnI | StyI | | BstKTI HinfI | MaeIII BinI* G N K I Q K V L L D S K D V Q Q I D Y K V T R S K R F C * T P R M F N K S T T S * Q D P K G F V R L Q G C S T N R L Q V ----:----|----:----|----:----|----:----|----:----|----:----| P L L I W F T K N S E L S T * C I S * L H Y C S G F P K T L S W P H E V F R S C T V L D L L N Q * V G L I N L L D V V L AluI CviJI | SetI HindII TfiI | | AccI Hpy166II ApoI HinfI | | |Hpy166II | BsrI TspEI TspEI \ \ \ \\ \ \ \ \ TTGGAATCTTTCCAAGCTGTCTACAACAAGTTGACTGGCAAACAAATTGTTTTTGAAATT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTTAGAAAGGTTCGACAGATGTTGTTCAACTGACCGTTTGTTTAACAAAAACTTTAA / / / // / / / / HinfI | | |AccI | BsrI TspEI TspEI TfiI | | Hpy166II Hpy166II ApoI | CviJI HindII | AluI SetI L E S F Q A V Y N K L T G K Q I V F E I W N L S K L S T T S * L A N K L F L K F G I F P S C L Q Q V D W Q T N C F * N S ----:----|----:----|----:----|----:----|----:----|----:----| N S D K W A T * L L N V P L C I T K S I T P I K G L Q R C C T S Q C V F Q K Q F Q F R E L S D V V L Q S A F L N N K F N CviJI \ CCAAGCCAGACCAACTAA 910 ----:----|----:--- GGTTCGGTCTGGTTGATT / CviJI P S Q T N * Q A R P T X K P D Q L X ----:----|----:--- G L W V L * E L G S W S W A L G V L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AclI 1 Psp1406I AgeI 1 AsiGI,BshTI,CspAI,PinAI AluI 5 AluBI AlwNI 1 CaiI ApoI 3 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 1 Bce83I* 1 BpuEI BdaI 2 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 2 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 BseGI 1 BstF5I,BtsCI BseRI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BstKTI 4 BtgZI 1 Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 1 CviQI,RsaNI CviAII 4 CviJI 10 CviKI-1 CviRI* 3 HpyCH4V DpnI 4 MalI Eco31I 2 Bso31I,BspTNI,BsaI Eco57MI 1 EcoP15I 1 FalI 6 FatI 4 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GsuI 1 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI Hin4II* 1 HpyAV HindII 1 HincII HinfI 5 HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 2 MaeI 4 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 3 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MlyI 1 SchI MmeI 2 MnlI 3 MseI 1 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NlaIII 4 Hin1II,Hsp92II,FaeI PleI 1 PpsI RsaI 1 AfaI SecI* 3 BseDI,BssECI,BsaJI SetI 11 SgrAI 1 SmlI 1 SmoI SpeI 1 BcuI,AhlI StuI 1 Eco147I,PceI,SseBI,AatI StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 4 TfiI 4 PfeI TseI 2 ApeKI Tsp45I 1 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 12 TasI,Tsp509I,Sse9I XbaI 3 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AciI AcyI AflII AflIII AhaIII* AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BceAI BcgI BciVI BclI BglI BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseSI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtrI BtsI CauII* Cfr9I CfrI CspCI DdeI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III Eco57I EcoICRI EcoNI EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FauI FseI FspAI GlaI GsaI HaeII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin6I HindIII HinP1I HpaI Hpy99I HspAI KasI KpnI Ksp632I* MauBI McrI* MfeI MluI Mph1103I MroNI MslI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI ScrFI SduI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SspI StyD4I SwaI TaqII TatI TauI TsoI TspGWI TspMI TspRI TstI Tth111I VspI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769