Restriction Map of TOP2/YNL088W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

TOP2/YNL088W on chromosome XIV from coordinates 457704 to 461990.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.12301

HindII Hpy166II | AgeI | BetI* | Cfr10I | |HpaII | || BdaI | || BdaI | || | Hin6I | || | |GlaI | || | ||HhaI | || | |||HaeII | || | |||| Hpy188I Hpy188I | || | |||| | BsaBI | ApoI BdaI | || | |||| | |MnlI | TspEI BdaI BsrI \ \\ \ \\\\ \ \\ \ \ \ \ ATGTCAACTGAACCGGTAAGCGCCTCTGATAAATATCAGAAAATTTCTCAACTGGAACAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTTGACTTGGCCATTCGCGGAGACTATTTATAGTCTTTTAAAGAGTTGACCTTGTA / /// //// / / / / / / Hpy166II ||| |||| | | Hpy188I | BdaI BsrI HindII ||| |||| | BsaBI | BdaI ||| |||| | MnlI TspEI ||| |||| Hpy188I ApoI ||| |||Hin6I ||| ||GlaI ||| |HhaI ||| HaeII ||Cfr10I ||BetI* ||AgeI |HpaII BdaI BdaI M S T E P V S A S D K Y Q K I S Q L E H C Q L N R * A P L I N I R K F L N W N I V N * T G K R L * * I S E N F S T G T Y ----:----|----:----|----:----|----:----|----:----|----:----| X D V S G T L A E S L Y * F I E * S S C X T L Q V P L R R Q Y I D S F K E V P V H * S F R Y A G R I F I L F N R L Q F M BbvI | SmlI | | Hpy178III* | | | TseI | | | |BisI | | | ||BlsI | | | |||TseI | | | |||AluI | | | |||CviJI | | | |||PvuII | | | |||NspBII* | | | ||||BisI | | | |||||BlsI | | | |||||SetI | | | ||||||CviRI* MseI Bce83I* | | | ||||||| BbvI \ \ \ \ \ \\\\\\\ \ ATCTTAAAAAGACCAGACACTTATATCGGTTCTGTTGAAACTCAAGAGCAGCTGCAATGG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAATTTTTCTGGTCTGTGAATATAGCCAAGACAACTTTGAGTTCTCGTCGACGTTACC / / / / ////// / MseI Bce83I* | | |||||| BsrDI | | |||||CviRI* | | |||||TseI | | ||||BisI | | |||BlsI | | ||NspBII* | | ||PvuII | | ||CviJI | | ||TseI | | ||AluI | | |BisI | | BlsI | | SetI | Hpy178III* | SmlI BbvI I L K R P D T Y I G S V E T Q E Q L Q W S * K D Q T L I S V L L K L K S S C N G L K K T R H L Y R F C * N S R A A A M D ----:----|----:----|----:----|----:----|----:----|----:----| I K F L G S V * I P E T S V * S C S C H Y R L F V L C K Y R N Q Q F E L A A A I D * F S W V S I D T R N F S L L L Q L P MaeIII Tsp45I | MfeI MboII | TspEI |FatI | | Csp6I |CviRI* | | |RsaI |TspDTI | | ||BssKI BsrDI ||CviAII | | ||EcoRII | Ksp632I* ||| NlaIII | | |||SecI* | | BsmAI ||| | TaqII | | ||||ScrFI | | Eco31I ||| | |BaeI | | ||||BseBI \ \ \ \\\ \ \\ \ \ \\\\\ ATATACGATGAAGAGACCGATTGCATGATTGAAAAAAATGTCACAATTGTACCAGGGTTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TATATGCTACTTCTCTGGCTAACGTACTAACTTTTTTTACAGTGTTAACATGGTCCCAAC / / / / / // / / / // / / / | | Eco31I | | || TaqII | | || | | BaeI | | BsmAI | | |FatI | | || | EcoRII | Ksp632I* | | |BaeI | | || | BssKI BbvI | | CviAII | | || | SecI* | CviRI* | | || BseBI | NlaIII | | || ScrFI TspDTI | | |Csp6I MboII | | RsaI | TspEI | MfeI Tsp45I MaeIII I Y D E E T D C M I E K N V T I V P G L Y T M K R P I A * L K K M S Q L Y Q G C I R * R D R L H D * K K C H N C T R V V ----:----|----:----|----:----|----:----|----:----|----:----| I Y S S S V S Q M I S F F T V I T G P N S I R H L S R N C S Q F F H * L Q V L T Y V I F L G I A H N F F I D C N Y W P Q BinI* | Hpy178III* TspDTI | | MboI | AciI | | | DpnI | |BisI | | | |BstKTI | ||BlsI | | | || TaqI BaeI DdeI | |||TauI | | | || ClaI \ \ \ \\\\ \ \ \ \\ \ TTCAAAATCTTTGATGAAATCTTAGTCAATGCGGCAGATAATAAAGTTCGTGATCCATCG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTTTAGAAACTACTTTAGAATCAGTTACGCCGTCTATTATTTCAAGCACTAGGTAGC / / /// / /// / / | | ||BisI | ||| MboI ClaI | | ||AciI | ||DpnI TaqI | | |BlsI | |BstKTI | | TauI | Hpy178III* | TspDTI BinI* DdeI F K I F D E I L V N A A D N K V R D P S S K S L M K S * S M R Q I I K F V I H R Q N L * * N L S Q C G R * * S S * S I D ----:----|----:----|----:----|----:----|----:----|----:----| N L I K S S I K T L A A S L L T R S G D T * F R Q H F R L * H P L Y Y L E H D M E F D K I F D * D I R C I I F N T I W R TspDTI | Hpy166II | | BseMII | | |BspCNI | | || MnlI | | || FatI | | || |CviAII | | || || NspI TfiI | | || || NlaIII HinfI | | || || |DdeI | TaqI | | || || |BbvCI BccI | ClaI | | || || |Bpu10I SfeI* BccI \ \ \ \ \ \\ \\ \\ \ \ ATGAAACGAATCGATGTAAACATACATGCTGAGGAACATACTATAGAAGTGAAAAATGAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTTGCTTAGCTACATTTGTATGTACGACTCCTTGTATGATATCTTCACTTTTTACTA / / // // // // / / / BccI | || || || || Bpu10I SfeI* BccI | || || || || BbvCI | || || || || DdeI | || || || |FatI | || || || CviAII | || || |NlaIII | || || |NspI | || || MnlI | || |BspCNI | || Hpy166II | || BseMII | |TspDTI | ClaI | TaqI HinfI TfiI M K R I D V N I H A E E H T I E V K N D * N E S M * T Y M L R N I L * K * K M M E T N R C K H T C * G T Y Y R S E K * W ----:----|----:----|----:----|----:----|----:----|----:----| I F R I S T F M C A S S C V I S T F F S S S V F R H L C V H Q P V Y * L L S F H H F S D I Y V Y M S L F M S Y F H F I I AjuI | Hin4I SetI TfiI | Hin4I | TspDTI HinfI SspI | |Hpy178III* \ \ \ \ \ \\ GGAAAAGGTATTCCCATAGAGATTCATAACAAGGAGAATATTTATATTCCTGAAATGATA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTTTCCATAAGGGTATCTCTAAGTATTGTTCCTCTTATAAATATAAGGACTTTACTAT / / / / / / SetI TspDTI HinfI | Hin4I Hpy178III* TfiI | Hin4I SspI AjuI G K G I P I E I H N K E N I Y I P E M I E K V F P * R F I T R R I F I F L K * Y K R Y S H R D S * Q G E Y L Y S * N D I ----:----|----:----|----:----|----:----|----:----|----:----| P F P I G M S I * L L S F I * I G S I I H F L Y E W L S E Y C P S Y K Y E Q F S S F T N G Y L N M V L L I N I N R F H Y HindII Hpy166II | AjuI MaeIII | | BseGI Tsp45I | | |Hin4I | MboII | | |Hin4I | | BsrI FokI | | || TspEI | | TspRI \ \ \ \\ \ \ \ \ TTTGGTCATTTGTTGACATCATCCAATTATGATGATGATGAGAAGAAAGTCACTGGTGGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCAGTAAACAACTGTAGTAGGTTAATACTACTACTACTCTTCTTTCAGTGACCACCA // // / / / / / || || BseGI TspEI | | BsrI || |Hin4I | Tsp45I || |Hin4I | MaeIII || Hpy166II | MboII || HindII TspRI |AjuI FokI F G H L L T S S N Y D D D E K K V T G G L V I C * H H P I M M M M R R K S L V V W S F V D I I Q L * * * * E E S H W W * ----:----|----:----|----:----|----:----|----:----|----:----| N P * K N V D D L * S S S S F F T V P P I Q D N T S M M W N H H H H S S L * Q H K T M Q Q C * G I I I I I L L F D S T T DdeI EspI* | HindIII ApoI | | AluI TspEI | | CviJI EcoRI Tsp4CI* | | | SetI TspDTI | TspRI SfeI* \ \ \ \ \ \ \ \ \ AGAAACGGTTATGGTGCTAAGCTTTGTAATATATTTTCCACTGAATTCATATTAGAAACT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTGCCAATACCACGATTCGAAACATTATATAAAAGGTGACTTAAGTATAATCTTTGA / /// / / / / / Tsp4CI* ||| HindIII | TspRI EcoRI PstI ||CviJI TspDTI TspEI ||AluI ApoI |EspI* |DdeI SetI R N G Y G A K L C N I F S T E F I L E T E T V M V L S F V I Y F P L N S Y * K L K R L W C * A L * Y I F H * I H I R N C ----:----|----:----|----:----|----:----|----:----|----:----| L F P * P A L S Q L I N E V S N M N S V Y F R N H H * A K Y Y I K W Q I * I L F S V T I T S L K T I Y K G S F E Y * F S CviRI* | MboI | PstI | BglII CfrI | XhoII | BalI FatI | | DpnI | CviJI |CviAII | | |BstKTI | HaeIII || NlaIII \ \ \\ \ \ \\ \ GCAGATCTAAATGTTGGCCAGAAATATGTTCAAAAATGGGAAAATAACATGAGCATTTGC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTAGATTTACAACCGGTCTTTATACAAGTTTTTACCCTTTTATTGTACTCGTAAACG / /// / / / / // | ||| XhoII | CfrI | |FatI | ||| BglII HaeIII | CviAII | ||| MboI CviJI NlaIII | ||DpnI BalI | |BstKTI | SfeI* CviRI* A D L N V G Q K Y V Q K W E N N M S I C Q I * M L A R N M F K N G K I T * A F A R S K C W P E I C S K M G K * H E H L P ----:----|----:----|----:----|----:----|----:----|----:----| A S R F T P W F Y T * F H S F L M L M Q Q L D L H Q G S I H E F I P F Y C S C K C I * I N A L F I N L F P F I V H A N A AsuI* AvaII MaeIII MseI |NlaIV Tsp45I | HphI Hin4II* |BmgT120I BccI | SetI | CviJI \ \\ \ \ \ \ \ CACCCCCCAAAAATAACATCTTACAAGAAGGGTCCATCATATACAAAGGTGACATTTAAG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGGGGGTTTTTATTGTAGAATGTTCTTCCCAGGTAGTATATGTTTCCACTGTAAATTC / /// / / / /// Hin4II* ||AvaII | SetI | ||CviJI ||AsuI* BccI | |HphI |BmgT120I | MseI NlaIV Tsp45I MaeIII H P P K I T S Y K K G P S Y T K V T F K T P Q K * H L T R R V H H I Q R * H L S P P K N N I L Q E G S I I Y K G D I * A ----:----|----:----|----:----|----:----|----:----|----:----| W G G F I V D * L F P G D Y V F T V N L G G G L F L M K C S P D M M Y L P S M * V G W F Y C R V L L T W * I C L H C K L TfiI AluI TspDTI HinfI CviJI | EcoRV | Hpy188I |MaeI | | SfaNI HpaII MseI | | TsoI ||SetI | | |DdeI Ksp632I* \ \ \ \ \ \\\ \ \ \\ \ CCGGATTTAACCAGATTCGGAATGAAAGAGCTAGATAATGATATCTTAGGAGTGATGCGA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCTAAATTGGTCTAAGCCTTACTTTCTCGATCTATTACTATAGAATCCTCACTACGCT / / // / / / / / / / / HpaII MseI || TsoI | | | TspDTI EcoRV SfaNI Ksp632I* |Hpy188I | | MaeI DdeI HinfI | CviJI TfiI | AluI SetI P D L T R F G M K E L D N D I L G V M R R I * P D S E * K S * I M I S * E * C E G F N Q I R N E R A R * * Y L R S D A K ----:----|----:----|----:----|----:----|----:----|----:----| G S K V L N P I F S S S L S I K P T I R A P N L W I R F S L A L Y H Y R L L S A R I * G S E S H F L * I I I D * S H H S MaeIII Tsp45I Hpy178III* MboII | MseI | MboII | VspI | |EcoRV | | DrdI Hpy188I \ \\ \ \ \ \ AGAAGAGTTTATGATATCAATGGTTCTGTTCGTGACATTAATGTCTATCTGAATGGCAAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTCTCAAATACTATAGTTACCAAGACAAGCACTGTAATTACAGATAGACTTACCGTTC / / / / / / / / | | EcoRV | | | VspI Hpy188I | MboII | | | MseI MboII | | DrdI | Tsp45I | MaeIII Hpy178III* R R V Y D I N G S V R D I N V Y L N G K E E F M I S M V L F V T L M S I * M A S K S L * Y Q W F C S * H * C L S E W Q V ----:----|----:----|----:----|----:----|----:----|----:----| L L T * S I L P E T R S M L T * R F P L F F L K H Y * H N Q E H C * H R D S H C S S N I I D I T R N T V N I D I Q I A L ApoI MseI TspEI TspEI TaqI \ \ \ \ TCCTTAAAGATAAGAAATTTCAAAAATTATGTTGAACTCTACTTGAAATCACTCGAAAAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAATTTCTATTCTTTAAAGTTTTTAATACAACTTGAGATGAACTTTAGTGAGCTTTTT / / / / MseI TspEI TspEI TaqI ApoI S L K I R N F K N Y V E L Y L K S L E K P * R * E I S K I M L N S T * N H S K K L K D K K F Q K L C * T L L E I T R K K ----:----|----:----|----:----|----:----|----:----|----:----| D K F I L F K L F * T S S * K F D S S F T R L S L F N * F N H Q V R S S I V R F G * L Y S I E F I I N F E V Q F * E F F HgiCI* Tsp4CI* | NlaIV | |HphI | ||AciI | ||BisI | |||BlsI Hpy188I MnlI | ||||TauI | EcoRV MaeI | Tsp4CI* | |||||DdeI | | Hpy178III* \ \ \ \ \\\\\\ \ \ \ AAAAGACAACTAGATAACGGTGAGGACGGTGCCGCTAAGTCTGATATCCCGACTATTCTT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCTGTTGATCTATTGCCACTCCTGCCACGGCGATTCAGACTATAGGGCTGATAAGAA / / / / ///// / / / / | | Tsp4CI* | ||||| | | | Hpy178III* | MnlI | ||||| | | EcoRV MaeI | ||||| | Hpy188I | ||||| DdeI | ||||AciI | |||BisI | ||HgiCI* | ||BlsI | |TauI | NlaIV | HphI Tsp4CI* K R Q L D N G E D G A A K S D I P T I L K D N * I T V R T V P L S L I S R L F F K T T R * R * G R C R * V * Y P D Y S L ----:----|----:----|----:----|----:----|----:----|----:----| F L C S S L P S S P A A L D S I G V I R F F V V L Y R H P R H R * T Q Y G S * E F S L * I V T L V T G S L R I D R S N K Hpy188I BccI AciI | EcoRV \ \ \ \ TATGAGAGAATAAACAACAGATGGGAAGTTGCTTTTGCGGTTTCTGATATCTCTTTTCAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTCTCTTATTTGTTGTCTACCCTTCAACGAAAACGCCAAAGACTATAGAGAAAAGTT / / / / BccI AciI | EcoRV Hpy188I Y E R I N N R W E V A F A V S D I S F Q M R E * T T D G K L L L R F L I S L F N * E N K Q Q M G S C F C G F * Y L F S T ----:----|----:----|----:----|----:----|----:----|----:----| * S L I F L L H S T A K A T E S I E K * K H S F L C C I P L Q K Q P K Q Y R K E I L S Y V V S P F N S K R N R I D R K L BaeI FatI NcoI StyI SecI* DsaI* |CviAII || NlaIII || | Acc65I || | HgiCI* || | |Csp6I || | ||RsaI ApoI || | ||NlaIV TspEI || | ||| KpnI EcoRI || | ||| |FatI | BsrDI || | ||| ||CviAII ApoI | | TaqII || | ||| ||| NlaIII TspEI | | CviRI* || | ||| ||| | TspEI \ \ \ \ \\ \ \\\ \\\ \ \ CAAATTTCTTTTGTGAATTCCATTGCAACTACCATGGGTGGTACCCATGTCAATTACATA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTAAAGAAAACACTTAAGGTAACGTTGATGGTACCCACCATGGGTACAGTTAATGTAT / // / / / / // / //// // / / TspEI || | | BaeI | || | |||| |FatI | BaeI ApoI || | CviRI* | || | |||| CviAII TspEI || TaqII | || | |||NlaIII |EcoRI | || | ||HgiCI* |TspEI | || | ||Acc65I |ApoI | || | |Csp6I BsrDI | || | NlaIV | || | RsaI | || KpnI | |DsaI* | |SecI* | |StyI | |NcoI | |FatI | CviAII NlaIII Q I S F V N S I A T T M G G T H V N Y I K F L L * I P L Q L P W V V P M S I T * N F F C E F H C N Y H G W Y P C Q L H N ----:----|----:----|----:----|----:----|----:----|----:----| C I E K T F E M A V V M P P V W T L * M V F K K Q S N W Q L * W P H Y G H * N C L N R K H I G N C S G H T T G M D I V Y Hpy188I BaeI ApoI | ApoI | TspEI TspEI | TspEI MboII MboII \ \ \ \ \ \ \ ACAGACCAAATTGTAAAAAAAATTTCAGAAATTTTGAAGAAAAAGAAGAAAAAAAGTGTG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTGGTTTAACATTTTTTTTAAAGTCTTTAAAACTTCTTTTTCTTCTTTTTTTCACAC / / / / / / TspEI | | TspEI MboII MboII | | ApoI | Hpy188I TspEI ApoI T D Q I V K K I S E I L K K K K K K S V Q T K L * K K F Q K F * R K R R K K V * R P N C K K N F R N F E E K E E K K C E ----:----|----:----|----:----|----:----|----:----|----:----| V S W I T F F I E S I K F F F F F F L T L L G F Q L F F K L F K S S F S S F F H C V L N Y F F N * F N Q L F L L F F T H MseI Hpy188I VspI | MseI |Hin4I | | TspDTI |Hin4I TfiI | | | TspDTI |TspEI HinfI \ \ \ \ \\ \ AAGTCTTTTCAGATTAAAAATAATATGTTCATTTTCATTAATTGTTTGATTGAGAATCCT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGAAAAGTCTAATTTTTATTATACAAGTAAAAGTAATTAACAAACTAACTCTTAGGA / / / / / / / | | TspDTI Hin4I | TspEI HinfI | TspDTI Hin4I VspI TfiI | MseI MseI Hpy188I K S F Q I K N N M F I F I N C L I E N P S L F R L K I I C S F S L I V * L R I L V F S D * K * Y V H F H * L F D * E S C ----:----|----:----|----:----|----:----|----:----|----:----| F D K * I L F L I N M K M L Q K I S F G S T K E S * F Y Y T * K * * N N S Q S D L R K L N F I I H E N E N I T Q N L I R AsuI* AvaII DraII PpuMI Hin4I SanDI SetI Hin4I |NlaIV |Hin4I |HinfI PleI |BmgT120I CviRI* |Hin4I MnlI ||BslFI |MlyI ||NlaIV \ \\ \ \\\ \\ \\\ GCATTTACCTCACAAACAAAAGAGCAACTGACAACAAGAGTCAAAGATTTTGGGTCCCGT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAAATGGAGTGTTTGTTTTCTCGTTGACTGTTGTTCTCAGTTTCTAAAACCCAGGGCA / / / / / / / /// | Hin4I MnlI Hin4I | | PleI ||SanDI | Hin4I Hin4I | | MlyI ||PpuMI | SetI | BslFI ||DraII CviRI* HinfI ||AvaII ||AsuI* |BmgT120I |NlaIV NlaIV A F T S Q T K E Q L T T R V K D F G S R H L P H K Q K S N * Q Q E S K I L G P V I Y L T N K R A T D N K S Q R F W V P L ----:----|----:----|----:----|----:----|----:----|----:----| A N V E C V F S C S V V L T L S K P D R Q M * R V F L L A V S L L L * L N Q T G C K G * L C F L L Q C C S D F I K P G T TfiI HinfI | Hin4I | Hin4I | | Hpy178III* | | | MnlI | | | | MseI CviJI | | | | VspI AjuI TsoI TspDTI AjuI \ \ \ \ \ \ \ \ \ TGTGAGATTCCTCTTGAATATATTAATAAGATTATGAAAACTGATTTGGCTACAAGAATG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| ACACTCTAAGGAGAACTTATATAATTATTCTAATACTTTTGACTAAACCGATGTTCTTAC / / / / / / / / / / | HinfI | | | VspI TsoI | CviJI AjuI | TfiI | | | MseI TspDTI Hin4I | | AjuI Hin4I | MnlI Hpy178III* C E I P L E Y I N K I M K T D L A T R M V R F L L N I L I R L * K L I W L Q E C * D S S * I Y * * D Y E N * F G Y K N V ----:----|----:----|----:----|----:----|----:----|----:----| Q S I G R S Y I L L I I F V S K A V L I N H S E E Q I Y * Y S * S F Q N P * L F T L N R K F I N I L N H F S I Q S C S H Hin6I |GlaI ||HhaI |||MboII Hpy188I Hpy99I ||||TspDTI | Csp6I TspEI | HgaI ||||| BccI | |RsaI \ \ \ \\\\\ \ \ \\ TTTGAAATTGCCGACGCAAATGAAGAAAATGCGCTAAAGAAGTCTGATGGTACAAGGAAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTTTAACGGCTGCGTTTACTTCTTTTACGCGATTTCTTCAGACTACCATGTTCCTTT / / / /// / / // | Hpy99I | ||TspDTI | | |Csp6I TspEI | ||MboII | | RsaI | ||Hin6I | Hpy188I | |GlaI BccI | HhaI HgaI F E I A D A N E E N A L K K S D G T R K L K L P T Q M K K M R * R S L M V Q G K * N C R R K * R K C A K E V * W Y K E K ----:----|----:----|----:----|----:----|----:----|----:----| N S I A S A F S S F A S F F D S P V L F T Q F Q R R L H L F H A L S T Q H Y L S K F N G V C I F F I R * L L R I T C P F MwoI MboII | CviJI | Cfr10I | |HpaII SfaNI | || Csp6I | BsiYI* | || |RsaI TspEI TspEI | | BsrI | || ||Hin4II* CviJI \ \ \ \ \ \ \\ \\\ \ AGCAGAATTACTAATTACCCTAAACTGGAAGATGCCAACAAAGCCGGTACAAAAGAAGGC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTCTTAATGATTAATGGGATTTGACCTTCTACGGTTGTTTCGGCCATGTTTTCTTCCG / / / / / / / / //// / TspEI | | | BsrI | | | |||Csp6I CviJI | | SfaNI | | | ||Hin4II* | BsiYI* | | | ||RsaI TspEI | | | |Cfr10I | | | HpaII | | CviJI | MboII MwoI S R I T N Y P K L E D A N K A G T K E G A E L L I T L N W K M P T K P V Q K K A Q N Y * L P * T G R C Q Q S R Y K R R L ----:----|----:----|----:----|----:----|----:----|----:----| L L I V L * G L S S S A L L A P V F S P F C F * * N G * V P L H W C L R Y L L L A S N S I V R F Q F I G V F G T C F F A BspMI | AluI | CviJI TatI Hin4II* TfiI | | SetI |Csp6I |Hpy188I HinfI | | | CviRI* ||RsaI || EciI | AciI | | | | SetI \\\ \\ \ \ \ \ \ \ \ \ TATAAATGTACTTTAGTTCTGACAGAAGGGGATTCCGCCTTGTCATTAGCTGTTGCAGGT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTTACATGAAATCAAGACTGTCTTCCCCTAAGGCGGAACAGTAATCGACAACGTCCA /// // / / / / // // / ||TatI || EciI | AciI | || || MwoI |Csp6I |Hpy188I HinfI | || |SetI RsaI Hin4II* TfiI | || CviRI* | |BspMI | CviJI | AluI SetI Y K C T L V L T E G D S A L S L A V A G I N V L * F * Q K G I P P C H * L L Q V * M Y F S S D R R G F R L V I S C C R F ----:----|----:----|----:----|----:----|----:----|----:----| * L H V K T R V S P S E A K D N A T A P S Y I Y K L E S L L P N R R T M L Q Q L I F T S * N Q C F P I G G Q * * S N C T MwoI | AluI PflMI | CviJI DraIII | | SetI BsiYI* \ \ \ \ TTAGCTGTTGTTGGTAGAGATTATTATGGTTGTTATCCACTTCGTGGTAAAATGCTGAAT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AATCGACAACAACCATCTCTAATAATACCAACAATAGGTGAAGCACCATTTTACGACTTA / / / | CviJI BsiYI* | AluI DraIII SetI PflMI L A V V G R D Y Y G C Y P L R G K M L N * L L L V E I I M V V I H F V V K C * M S C C W * R L L W L L S T S W * N A E C ----:----|----:----|----:----|----:----|----:----|----:----| K A T T P L S * * P Q * G S R P L I S F N L Q Q Q Y L N N H N N D V E H Y F A S * S N N T S I I I T T I W K T T F H Q I MboI AluI BclI AciI CviJI | DpnI FnuDII* |MaeI | |BstKTI | ApoI CviJI ||SetI | || Hpy188I | TspEI | MseI TspEI \\\ \ \\ \ \ \ \ \ \ GTTAGAGAAGCTAGTGCTGATCAGATACTAAAAAACGCGGAAATTCAAGCCATTAAAAAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CAATCTCTTCGATCACGACTAGTCTATGATTTTTTGCGCCTTTAAGTTCGGTAATTTTTT / / / // / / / / / / | | MaeI || Hpy188I | AciI | CviJI MseI | CviJI || BclI FnuDII* TspEI | AluI || MboI ApoI SetI |DpnI BstKTI V R E A S A D Q I L K N A E I Q A I K K L E K L V L I R Y * K T R K F K P L K K * R S * C * S D T K K R G N S S H * K N ----:----|----:----|----:----|----:----|----:----|----:----| T L S A L A S * I S F F A S I * A M L F H * L L * H Q D S V L F R P F E L W * F N S F S T S I L Y * F V R F N L G N F F MboII Hin4I |TspDTI Hin4I BtgZI MaeIII Hin4I || MseI Hin4I \ \ \ \\ \ \ ATTATGGGGTTACAACATCGCAAGAAATATGAAGATACAAAATCTTTAAGATATGGGCAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TAATACCCCAATGTTGTAGCGTTCTTTATACTTCTATGTTTTAGAAATTCTATACCCGTA / / / / / / / | BtgZI MaeIII Hin4I | | Hin4I TspEI Hin4I | | Hin4I | MseI TspDTI MboII I M G L Q H R K K Y E D T K S L R Y G H L W G Y N I A R N M K I Q N L * D M G I Y G V T T S Q E I * R Y K I F K I W A S ----:----|----:----|----:----|----:----|----:----|----:----| I I P N C C R L F Y S S V F D K L Y P C F * P T V V D C S I H L Y L I K L I H A N H P * L M A L F I F I C F R * S I P M MboI BclI |SfaNI ||DpnI |||FatI |||BspHI |||BstKTI ||||CviAII ||||Hpy178III* ||||| NlaIII ||||| | MboI ||||| | | DpnI ||||| | | |BstKTI ||||| | | ||Hpy178III* ||||| | | |||BsaBI ||||| | | ||||MboI ||||| | | |||||BccI ||||| | | ||||||DpnI ||||| | | |||||||FatI ||||| | | |||||||BspHI ||||| | | |||||||BstKTI ||||| | | ||||||||CviAII SetI ||||| | | ||||||||Hpy178III* |MseI ||||| | | ||||||||| TaqII ||TspEI ||||| | | ||||||||| NlaIII MseI ||| PsiI \\\\\ \ \ \\\\\\\\\ \ \ \\\ \ CTTATGATCATGACCGATCAAGATCATGATGGTTCGCATATTAAAGGTTTAATTATAAAC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GAATACTAGTACTGGCTAGTTCTAGTACTACCAAGCGTATAATTTCCAAATTAATATTTG /////// // ////////// // / // ||||||| || |||||||||BspHI |SetI | |PsiI ||||||| || |||||||||FatI MseI | TspEI ||||||| || ||||||||Hpy178III* MseI ||||||| || ||||||||CviAII ||||||| || |||||||TaqII ||||||| || ||||||MboI ||||||| || |||||NlaIII ||||||| || ||||DpnI ||||||| || ||||BccI ||||||| || |||BstKTI ||||||| || ||Hpy178III* ||||||| || |BsaBI ||||||| || MboI ||||||| |DpnI ||||||| BstKTI ||||||BspHI ||||||FatI |||||Hpy178III* |||||CviAII ||||SfaNI |||BclI |||MboI ||NlaIII |DpnI BstKTI L M I M T D Q D H D G S H I K G L I I N L * S * P I K I M M V R I L K V * L * T Y D H D R S R S * W F A Y * R F N Y K L ----:----|----:----|----:----|----:----|----:----|----:----| R I I M V S * S * S P E C I L P K I I F D * S * S R D L D H H N A Y * L N L * L K H D H G I L I M I T R M N F T * N Y V BssKI AluI EcoRII EcoRV ApoI CviJI | ScrFI | StyI SetI TspEI | SetI | BseBI | SecI* | TspDTI EcoRI \ \ \ \ \ \ \ \ \ TTTTTAGAAAGCTCATTTCCTGGTCTTTTGGATATCCAAGGTTTCTTACTTGAATTCATA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAATCTTTCGAGTAAAGGACCAGAAAACCTATAGGTTCCAAAGAATGAACTTAAGTAT / / / / / / / / / | CviJI | EcoRII | | | TspDTI EcoRI | AluI | BssKI | | SecI* TspEI SetI BseBI | | StyI ApoI ScrFI | SetI EcoRV F L E S S F P G L L D I Q G F L L E F I F * K A H F L V F W I S K V S Y L N S * F R K L I S W S F G Y P R F L T * I H N ----:----|----:----|----:----|----:----|----:----|----:----| K K S L E N G P R K S I W P K K S S N M S K L F S M E Q D K P Y G L N R V Q I * K * F A * K R T K Q I D L T E * K F E Y MboI Hpy188I | DpnI BsmI | |BstKTI BccI CviRI* \ \\ \ \ ACTCCGATCATCAAAGTTTCCATCACTAAACCAACAAAAAACACTATTGCATTCTACAAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGGCTAGTAGTTTCAAAGGTAGTGATTTGGTTGTTTTTTGTGATAACGTAAGATGTTA / // / / / / | || MboI BccI | CviRI* | |DpnI BsmI | BstKTI Hpy188I T P I I K V S I T K P T K N T I A F Y N L R S S K F P S L N Q Q K T L L H S T I S D H Q S F H H * T N K K H Y C I L Q Y ----:----|----:----|----:----|----:----|----:----|----:----| V G I M L T E M V L G V F F V I A N * L L E S * * L K W * * V L L F C * Q M R C S R D D F N G D S F W C F V S N C E V I TspDTI ApoI Hin4I | TfiI TspEI HpaII | MnlI | HinfI MboII Hin4I \ \ \ \ \ \ \ ATGCCGGACTATGAAAAATGGAGAGAGGAAGAATCGCACAAATTTACTTGGAAGCAGAAG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGCCTGATACTTTTTACCTCTCTCCTTCTTAGCGTGTTTAAATGAACCTTCGTCTTC / / / / / / // | Hin4I MnlI TspDTI | | |TspEI HpaII | | |ApoI | | Hin4I | MboII HinfI TfiI M P D Y E K W R E E E S H K F T W K Q K C R T M K N G E R K N R T N L L G S R S A G L * K M E R G R I A Q I Y L E A E V ----:----|----:----|----:----|----:----|----:----|----:----| I G S * S F H L S S S D C L N V Q F C F Y A P S H F I S L P L I A C I * K S A S H R V I F F P S L F F R V F K S P L L L TaqI Hpy188I TstI PsiI TstI MaeI BslFI | SspI AsuII \ \ \ \ \ \ \ TATTATAAAGGATTAGGGACTTCTCTAGCACAAGAAGTCCGAGAATATTTTTCGAACTTG 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| ATAATATTTCCTAATCCCTGAAGAGATCGTGTTCTTCAGGCTCTTATAAAAAGCTTGAAC / / / / / // / PsiI TstI MaeI | | |TstI AsuII | | SspI TaqI | Hpy188I BslFI Y Y K G L G T S L A Q E V R E Y F S N L I I K D * G L L * H K K S E N I F R T W L * R I R D F S S T R S P R I F F E L G ----:----|----:----|----:----|----:----|----:----|----:----| Y * L P N P V E R A C S T R S Y K E F K T N Y L I L S K E L V L L G L I N K S S I I F S * P S R * C L F D S F I K R V Q XmnI |SspI CviRI* \\ \ GACAGACATTTGAAAATATTCCATTCTTTGCAGGGTAATGATAAAGATTACATTGATTTA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTCTGTAAACTTTTATAAGGTAAGAAACGTCCCATTACTATTTCTAATGTAACTAAAT // / / |SspI CviRI* SetI XmnI D R H L K I F H S L Q G N D K D Y I D L T D I * K Y S I L C R V M I K I T L I * Q T F E N I P F F A G * * * R L H * F S ----:----|----:----|----:----|----:----|----:----|----:----| S L C K F I N W E K C P L S L S * M S K P C V N S F I G N K A P Y H Y L N C Q N V S M Q F Y E M R Q L T I I F I V N I * BssKI SexAI Tsp4CI* EcoRII | BseMII | ScrFI | |BspCNI | BseBI AluI | || BsmAI | |SetI CviJI | || | CviJI | || Csp6I | SetI | || | |DdeI | || |RsaI \ \ \ \\ \ \\ \ \\ \\ GCTTTCTCCAAGAAAAAGGCAGATGACCGTAAAGAATGGCTGAGACAATACGAACCTGGT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAAGAGGTTCTTTTTCCGTCTACTGGCATTTCTTACCGACTCTGTTATGCTTGGACCA / / // // / / / // CviJI | |BspCNI || DdeI | | |RsaI AluI | BseMII |BsmAI | | EcoRII Tsp4CI* CviJI | | SexAI | | BssKI | BseBI | ScrFI SetI A F S K K K A D D R K E W L R Q Y E P G L S P R K R Q M T V K N G * D N T N L V F L Q E K G R * P * R M A E T I R T W Y ----:----|----:----|----:----|----:----|----:----|----:----| A K E L F F A S S R L S H S L C Y S G P L K R W S F P L H G Y L I A S V I R V Q S E G L F L C I V T F F P Q S L V F R T MseI |AhaIII* || TfiI || HinfI TspEI || | TspEI MseI | MseI Tsp4CI* || | |TspDTI VspI | VspI \ \\ \ \\ \ \ \ ACTGTTTTAGACCCTACTTTAAAAGAGATTCCAATTAGCGACTTCATTAATAAGGAATTA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TGACAAAATCTGGGATGAAATTTTCTCTAAGGTTAATCGCTGAAGTAATTATTCCTTAAT // // // / / // |Tsp4CI* |MseI || TspEI VspI |VspI Csp6I AhaIII* |TspDTI MseI |MseI HinfI TspEI TfiI T V L D P T L K E I P I S D F I N K E L L F * T L L * K R F Q L A T S L I R N * C F R P Y F K R D S N * R L H * * G I N ----:----|----:----|----:----|----:----|----:----|----:----| V T K S G V K F S I G I L S K M L L S N Y Q K L G * K L L S E L * R S * * Y P I S N * V R S * F L N W N A V E N I L F * Tsp4CI* MseI | TaqI |AhaIII* CfrI | McrI* || AjuI | CviJI | | TfiI || |BssKI | HaeIII | | HinfI BccI || |EcoRII \ \ \ \ \ \ \\ \\ ATCCTTTTTTCTTTGGCCGATAATATACGGTCGATTCCCAATGTTTTAGATGGATTTAAA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGAAAAAAGAAACCGGCTATTATATGCCAGCTAAGGGTTACAAAATCTACCTAAATTT / / // / / / / /// | CfrI || | HinfI BccI | ||SetI HaeIII || | TfiI | |MseI CviJI || TaqI | AhaIII* |McrI* AjuI Tsp4CI* I L F S L A D N I R S I P N V L D G F K S F F L W P I I Y G R F P M F * M D L N P F F F G R * Y T V D S Q C F R W I * T ----:----|----:----|----:----|----:----|----:----|----:----| I R K E K A S L I R D I G L T K S P N L L G K K K P R Y Y V T S E W H K L H I * D K K R Q G I I Y P R N G I N * I S K F ScrFI BseBI |CfrI ApoI |SetI TspEI || BalI | MseI || CviJI MmeI | |AhaIII* || HaeIII | AjuI | || Hpy188I \\ \ \ \ \ \\ \ CCTGGCCAAAGAAAAGTTCTTTATGGTTGTTTCAAAAAAAATTTAAAGTCGGAACTGAAA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| GGACCGGTTTCTTTTCAAGAAATACCAACAAAGTTTTTTTTAAATTTCAGCCTTGACTTT / / / // /// / | | CfrI |MmeI ||MseI Hpy188I | EcoRII AjuI |AhaIII* | HaeIII TspEI | BssKI ApoI | CviJI | BalI BseBI ScrFI P G Q R K V L Y G C F K K N L K S E L K L A K E K F F M V V S K K I * S R N * K W P K K S S L W L F Q K K F K V G T E S ----:----|----:----|----:----|----:----|----:----|----:----| G P W L F T R * P Q K L F F K F D S S F V Q G F F L E K H N N * F F N L T P V S R A L S F N K I T T E F F I * L R F Q F FatI NcoI StyI SecI* DsaI* AluI |CviAII CviJI MaeII ||OliI | SetI |BsaAI Csp6I ||MslI | | MwoI || SetI |RsaI ||| NlaIII | | | CviRI* || TaiI ||HphI ||| |BceAI \ \ \ \ \\ \ \\\ \\\ \\ GTAGCTCAACTTGCACCATACGTGAGCGAATGTACGGCATATCACCATGGTGAGCAGTCA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CATCGAGTTGAACGTGGTATGCACTCGCTTACATGCCGTATAGTGGTACCACTCGTCAGT / / / / / // // / /// / / | | MwoI | | |MaeII |Csp6I | ||| BceAI HphI | CviJI | | BsaAI RsaI | ||DsaI* | AluI | TaiI HphI | ||SecI* SetI | SetI | ||StyI CviRI* | ||NcoI | ||FatI | |CviAII | MslI | OliI NlaIII V A Q L A P Y V S E C T A Y H H G E Q S * L N L H H T * A N V R H I T M V S S H S S T C T I R E R M Y G I S P W * A V I ----:----|----:----|----:----|----:----|----:----|----:----| T A * S A G Y T L S H V A Y * W P S C D L L E V Q V M R S R I Y P M D G H H A T Y S L K C W V H A F T R C I V M T L L * NheI CviJI |MaeI AsuI* ||Cac8I AvaII ||| BmtI |NlaIV HphI ||| CviJI XcmI |BmgT120I SspI \ \\\ \ \ \\ \ TTGGCACAAACTATTATTGGGCTAGCCCAAAACTTTGTTGGGTCCAACAATATTTACTTG 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGTGTTTGATAATAACCCGATCGGGTTTTGAAACAACCCAGGTTGTTATAAATGAAC / /// / /// / | ||CviJI XcmI ||AvaII SspI | ||NheI ||AsuI* | |MaeI |BmgT120I | Cac8I NlaIV CviJI BmtI L A Q T I I G L A Q N F V G S N N I Y L W H K L L L G * P K T L L G P T I F T C G T N Y Y W A S P K L C W V Q Q Y L L A ----:----|----:----|----:----|----:----|----:----|----:----| N A C V I I P S A W F K T P D L L I * K M P V F * * Q A L G F S Q Q T W C Y K S Q C L S N N P * G L V K N P G V I N V Q TseI CviRI* |BisI ||BlsI |||AciI |||NspBII* ||||BisI |||||BlsI ||||||TseI CviJI ||||||TauI MmeI | SfaNI ||||||MwoI |SetI Csp6I | | BsrI |||||||BisI || Tsp4CI* |RsaI | | TspRI ||||||||BlsI \\ \ \\ \ \ \ \\\\\\\\\ CTATTACCTAACGGTGCTTTCGGTACAAGAGCCACTGGTGGTAAAGATGCAGCGGCAGCG 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| GATAATGGATTGCCACGAAAGCCATGTTCTCGGTGACCACCATTTCTACGTCGCCGTCGC // / // // / / ////// /// |MmeI Tsp4CI* || |CviJI | SfaNI |||||| ||TseI SetI || TspRI BsrI |||||| |BisI |Csp6I |||||| BlsI RsaI |||||BisI |||||AciI ||||BlsI |||NspBII* |||MwoI |||TseI |||TauI ||BisI |BlsI CviRI* L L P N G A F G T R A T G G K D A A A A Y Y L T V L S V Q E P L V V K M Q R Q R I T * R C F R Y K S H W W * R C S G S E ----:----|----:----|----:----|----:----|----:----|----:----| S N G L P A K P V L A V P P L S A A A A A I V * R H K R Y L L W Q H Y L H L P L * * R V T S E T C S G S T T F I C R C R BinI* EcoP15I | MboI | TspEI | | DpnI BbvI BbvI TspEI | | MseI HphI | | |BstKTI \ \ \ \ \ \ \ \ \ \\ AGATATATCTACACAGAATTGAACAAATTAACTCGTAAGATATTTCACCCTGCTGATGAT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TCTATATAGATGTGTCTTAACTTGTTTAATTGAGCATTCTATAAAGTGGGACGACTACTA / / / / // / / // BbvI BbvI | | |MseI HphI | |DpnI | | TspEI | BstKTI | EcoP15I BinI* TspEI R Y I Y T E L N K L T R K I F H P A D D D I S T Q N * T N * L V R Y F T L L M I I Y L H R I E Q I N S * D I S P C * * S ----:----|----:----|----:----|----:----|----:----|----:----| L Y I * V S N F L N V R L I N * G A S S S I Y R C L I S C I L E Y S I E G Q Q H S I D V C F Q V F * S T L Y K V R S I I TstI BsaXI | MboII | | Tsp4CI* | | | NlaIV | | | TspRI MboII | | | |CviJI | TspEI \ \ \ \\ \ \ CCATTATACAAATATATACAAGAAGATGAGAAAACAGTGGAGCCAGAGTGGTATTTACCA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAATATGTTTATATATGTTCTTCTACTCTTTTGTCACCTCGGTCTCACCATAAATGGT / / / // / // / / MboI | | || | |CviJI | BsaXI | | || | NlaIV | TstI | | || Tsp4CI* MboII | | |MboII | | TspRI | BsaXI TstI P L Y K Y I Q E D E K T V E P E W Y L P H Y T N I Y K K M R K Q W S Q S G I Y Q I I Q I Y T R R * E N S G A R V V F T N ----:----|----:----|----:----|----:----|----:----|----:----| G N Y L Y I C S S S F V T S G S H Y K G D M I C I Y V L L H S F L P A L T T N V W * V F I Y L F I L F C H L W L P I * W MseI BseMII |HpaI |BspCNI |HindII CviJI |Hpy166II |BsrI || MnlI |TspRI || |Tsp4CI* || TatI || || DdeI || |Csp6I BsaXI TfiI || || BbvCI || ||RsaI | TstI HinfI || || Bpu10I || ||ScaI \ \ \ \\ \\ \ \\ \\\ ATTCTTCCTATGATTCTTGTTAACGGTGCTGAGGGTATTGGCACTGGCTGGAGTACTTAC 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGAAGGATACTAAGAACAATTGCCACGACTCCCATAACCGTGACCGACCTCATGAATG / / // //// / / // /// TspEI | || |||Tsp4CI* Bpu10I TspRI |CviJI ||TatI | || ||MnlI BbvCI BsrI |Csp6I | || |MseI DdeI ScaI | || Hpy166II RsaI | || HindII | || HpaI | |BspCNI | BseMII HinfI TfiI I L P M I L V N G A E G I G T G W S T Y F F L * F L L T V L R V L A L A G V L T S S Y D S C * R C * G Y W H W L E Y L H ----:----|----:----|----:----|----:----|----:----|----:----| I R G I I R T L P A S P I P V P Q L V * L E E * S E Q * R H Q P Y Q C Q S S Y K N K R H N K N V T S L T N A S A P T S V GsuI Eco57MI TspEI | MnlI | PsiI MseI MnlI Hpy99I \ \ \ \ \ \ \ ATTCCTCCATTCAACCCATTGGAAATTATAAAGAATATAAGACATTTAATGAACGACGAG 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGAGGTAAGTTGGGTAACCTTTAATATTTCTTATATTCTGTAAATTACTTGCTGCTC / / // / / / | MnlI |PsiI | | Hpy99I Eco57MI TspEI | MnlI GsuI MseI I P P F N P L E I I K N I R H L M N D E F L H S T H W K L * R I * D I * * T T R S S I Q P I G N Y K E Y K T F N E R R G ----:----|----:----|----:----|----:----|----:----|----:----| M G G N L G N S I I F F I L C K I F S S C E E M * G M P F * L S Y L V N L S R R N R W E V W Q F N Y L I Y S M * H V V L FokI |AluI |CviJI ||SmlI ||TspDTI |||SetI AsuI* |||| TspGWI AvaII |||| | BseRI |BmgT120I |||| | | BseGI ||AgeI |||| | | CviRI* ||BetI* |||| | | | EcoT22I ||BseGI |||| | | | | SecI* ||Cfr10I |||| | | | | DsaI* |||HpaII |||| | | | | | SfaNI |||| Csp6I |||| | | | | | |Bce83I* |||| |RsaI |||| | | | | | ||BccI |||| || FokI TspEI CviJI \\\\ \ \ \ \ \ \\\ \\\\ \\ \ \ \ GAGCTTGAGCAAATGCATCCGTGGTTTAGGGGATGGACCGGTACTATTGAAGAAATTGAG 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGAACTCGTTTACGTAGGCACCAAATCCCCTACCTGGCCATGATAACTTCTTTAACTC /// / / / / / / // / // //// / / / ||| | | | | CviRI* | |SfaNI | || |||| FokI | MboII ||| | | | EcoT22I | BccI | || |||Csp6I | CviJI ||| | | | BseGI Bce83I* | || ||RsaI TspEI ||| | | BseRI DsaI* | || |Cfr10I ||| | SmlI SecI* | || |BetI* ||| TspGWI | || |AgeI ||| FokI | || HpaII ||CviJI | |AvaII ||AluI | |AsuI* |TspDTI | BmgT120I SetI BseGI E L E Q M H P W F R G W T G T I E E I E S L S K C I R G L G D G P V L L K K L S A * A N A S V V * G M D R Y Y * R N * A ----:----|----:----|----:----|----:----|----:----|----:----| S S S C I C G H N L P H V P V I S S I S P A Q A F A D T T * P I S R Y * Q L F Q L K L L H M R P K P S P G T S N F F N L MaeII | SetI | TaiI Csp6I Hin4I | |DdeI MaeIII |RsaI BsaXI | || BseMII MboII | MnlI || Tsp4CI* | TspEI | || |BspCNI \ \ \ \\ \ \ \ \ \\ \\ CCTCTGCGTTACAGAATGTACGGTAGGATTGAACAAATTGGAGATAACGTCTTAGAAATA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGACGCAATGTCTTACATGCCATCCTAACTTGTTTAACCTCTATTGCAGAATCTTTAT / / /// / / / / / // / / | MaeIII ||| | BsaXI TspEI | | || DdeI BsaXI MnlI ||| Hin4I | | |BspCNI Hin4I ||Tsp4CI* | | BseMII |Csp6I | MaeII RsaI TaiI SetI P L R Y R M Y G R I E Q I G D N V L E I L C V T E C T V G L N K L E I T S * K * S A L Q N V R * D * T N W R * R L R N N ----:----|----:----|----:----|----:----|----:----|----:----| G R R * L I Y P L I S C I P S L T K S I A E A N C F T R Y S Q V F Q L Y R R L F R Q T V S H V T P N F L N S I V D * F Y Cac8I | CviJI TatI SetI DdeI | | XcmI FalI |Csp6I |MseI BsaXI | | | PflMI FalI ||RsaI || FalI | Hin4I | | | BsiYI* TaqI ||ScaI || FalI \ \ \ \ \ \ \ \\\ \\ \ ACTGAGTTGCCAGCCAGAACTTGGACATCGACTATAAAGGAGTACTTACTTTTAGGTTTA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTCAACGGTCGGTCTTGAACCTGTAGCTGATATTTCCTCATGAATGAAAATCCAAAT / / / // / / /// / / / DdeI | | || FalI TaqI ||TatI | FalI MseI | | || FalI |Csp6I | FalI | | |BsiYI* ScaI SetI | | |PflMI RsaI | | XcmI | CviJI Cac8I T E L P A R T W T S T I K E Y L L L G L L S C Q P E L G H R L * R S T Y F * V * * V A S Q N L D I D Y K G V L T F R F K ----:----|----:----|----:----|----:----|----:----|----:----| V S N G A L V Q V D V I F S Y K S K P K L Q T A L W F K S M S * L P T S V K L N S L Q W G S S P C R S Y L L V * K * T * BssKI SecI* EcoRII | ScrFI | BseBI | | MboI | | | DpnI | | | |BstKTI TseI BseRI AciI | | | || MnlI |BisI | BbvI | MaeIII | | | || |BinI* ||BlsI | TspDTI \ \ \ \ \ \\ \\ \\\ \ \ AGCGGTAACGATAAAATAAAACCCTGGATCAAAGATATGGAGGAGCAGCACGATGATAAC 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCCATTGCTATTTTATTTTGGGACCTAGTTTCTATACCTCCTCGTCGTGCTACTATTG / / //// / / / /// / / AciI MaeIII |||| | | BinI* ||TseI | TspDTI |||| | MnlI |BisI BseRI |||| MboI BlsI |||DpnI ||EcoRII ||BstKTI ||BssKI |SecI* BseBI ScrFI S G N D K I K P W I K D M E E Q H D D N A V T I K * N P G S K I W R S S T M I T R * R * N K T L D Q R Y G G A A R * * H ----:----|----:----|----:----|----:----|----:----|----:----| L P L S L I F G Q I L S I S S C C S S L L R Y R Y F L V R S * L Y P P A A R H Y A T V I F Y F G P D F I H L L L V I I V HphI | BseMII | |BspCNI | || MnlI | || | TsoI | || | |DdeI ApoI | || | |SauI* TspEI | || | ||SetI CviJI SetI \ \ \\ \ \\\ \ \ ATCAAATTCATAATCACGCTATCACCTGAGGAAATGGCTAAAACAAGGAAAATAGGTTTT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTTAAGTATTAGTGCGATAGTGGACTCCTTTACCGATTTTGTTCCTTTTATCCAAAA / / / // / / / / / BbvI | | || | SetI SauI* CviJI SetI | | || | TsoI DdeI | | || MnlI | | |BspCNI | | BseMII | HphI TspEI ApoI I K F I I T L S P E E M A K T R K I G F S N S * S R Y H L R K W L K Q G K * V F Q I H N H A I T * G N G * N K E N R F L ----:----|----:----|----:----|----:----|----:----|----:----| M L N M I V S D G S S I A L V L F I P K C * I * L * A I V Q P F P * F L S F L N D F E Y D R * * R L F H S F C P F Y T K BinI* MseI | TspDTI |AhaIII* | | MboI || TspEI | | | DpnI || TspDTI | | | |BstKTI \\ \ \ \ \ \\ TATGAAAGATTTAAACTAATTTCGCCTATAAGTTTGATGAATATGGTCGCATTTGATCCT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTTTCTAAATTTGATTAAAGCGGATATTCAAACTACTTATACCAGCGTAAACTAGGA // / / / // / || | TspEI | || MboI || TspDTI | |DpnI |MseI | BstKTI AhaIII* TspDTI BinI* Y E R F K L I S P I S L M N M V A F D P M K D L N * F R L * V * * I W S H L I L * K I * T N F A Y K F D E Y G R I * S S ----:----|----:----|----:----|----:----|----:----|----:----| * S L N L S I E G I L K I F I T A N S G K H F I * V L K A * L N S S Y P R M Q D I F S K F * N R R Y T Q H I H D C K I R MnlI | Hpy178III* | | TspGWI | | | TatI | | | |Csp6I ApoI MaeII | | | ||RsaI SspI TspEI | SetI | | | ||| TspEI | MseI |TspDTI | TaiI \ \ \ \\\ \ \ \ \\ \ \ CACGGGAAAATCAAGAAGTACAATTCCGTGAATGAAATATTAAGCGAATTTTACTACGTC 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCCCTTTTAGTTCTTCATGTTAAGGCACTTACTTTATAATTCGCTTAAAATGATGCAG / // /// / / / / / / / / MnlI || ||| TspEI | | | | | | Hpy188I || ||TatI | | | | | MaeII || |Csp6I | | | | TaiI || RsaI | | | | SetI |Hpy178III* | | | TspEI TspGWI | | | ApoI | | TspDTI | MseI SspI H G K I K K Y N S V N E I L S E F Y Y V T G K S R S T I P * M K Y * A N F T T S R E N Q E V Q F R E * N I K R I L L R Q ----:----|----:----|----:----|----:----|----:----|----:----| * P F I L F Y L E T F S I N L S N * * T E R S F * S T C N R S H F I L R I K S R V P F D L L V I G H I F Y * A F K V V D MaeIII | SetI | | MnlI | | | Tsp4CI* | | | | BplI | | | | BplI Hpy188I | | | | | TspRI | MaeI NdeI | | | | | | SetI \ \ \ \ \ \ \ \ \ \ AGACTAGAATACTATCAAAAAAGAAAAGACCATATGAGCGAAAGGTTACAGTGGGAGGTA 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGATCTTATGATAGTTTTTTCTTTTCTGGTATACTCGCTTTCCAATGTCACCCTCCAT / / / // / / MaeI NdeI | || | SetI | || Tsp4CI* | || MaeIII | |MnlI | |BplI | |BplI | TspRI SetI R L E Y Y Q K R K D H M S E R L Q W E V D * N T I K K E K T I * A K G Y S G R * T R I L S K K K R P Y E R K V T V G G R ----:----|----:----|----:----|----:----|----:----|----:----| L S S Y * * F L F S W I L S L N C H S T * V L I S D F F F L G Y S R F T V T P P S * F V I L F S F V M H A F P * L P L Y HphI |MseI ||HpaI ||HindII ApoI ||Hpy166II TspEI ||| MaeIII | BplI ||| Tsp45I | BplI MseI ||| Tsp4CI* \ \ \ \\\ \ GAGAAATACTCTTTCCAAGTAAAATTTATTAAAATGATTATTGAAAAGGAGTTAACAGTC 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTTATGAGAAAGGTTCATTTTAAATAATTTTACTAATAACTTTTCCTCAATTGTCAG / / / / // / BplI | MseI | || Tsp4CI* BplI TspEI | |MseI ApoI | Hpy166II | HindII | HpaI HphI E K Y S F Q V K F I K M I I E K E L T V R N T L S K * N L L K * L L K R S * Q S E I L F P S K I Y * N D Y * K G V N S H ----:----|----:----|----:----|----:----|----:----|----:----| S F Y E K W T F N I L I I I S F S N V T L S I S K G L L I * * F S * Q F P T L L L F V R E L Y F K N F H N N F L L * C D CviJI |StyI |AvrII |SecI* ApoI Bce83I* ||MaeI SmlI TspEI NlaIV | MseI \\\ \ \ \ \ \ ACCAATAAGCCTAGGAACGCTATTATCCAAGAACTTGAGAATTTAGGGTTCCCCAGATTT 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTATTCGGATCCTTGCGATAATAGGTTCTTGAACTCTTAAATCCCAAGGGGTCTAAA / / // / / / / / Tsp45I | |SecI* SmlI TspEI | | Hin4II* MaeIII | |AvrII ApoI | Bce83I* | |StyI NlaIV | MaeI CviJI T N K P R N A I I Q E L E N L G F P R F P I S L G T L L S K N L R I * G S P D L Q * A * E R Y Y P R T * E F R V P Q I * ----:----|----:----|----:----|----:----|----:----|----:----| V L L G L F A I I W S S S F K P N G L N * W Y A * S R * * G L V Q S N L T G W I G I L R P V S N D L F K L I * P E G S K AluI SetI PflMI CviJI TspEI Hin4II* |Hpy166II BsiYI* | SetI | MseI \ \\ \ \ \ \ \ AATAAGGAAGGTAAACCATATTATGGAAGTCCTAACGATGAGATAGCTGAACAAATTAAC 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTCCTTCCATTTGGTATAATACCTTCAGGATTGCTACTCTATCGACTTGTTTAATTG / / / / / / /// MseI SetI | BsiYI* | CviJI ||Hpy99I | PflMI | AluI |MseI Hpy166II SetI TspEI N K E G K P Y Y G S P N D E I A E Q I N I R K V N H I M E V L T M R * L N K L T * G R * T I L W K S * R * D S * T N * R ----:----|----:----|----:----|----:----|----:----|----:----| L L S P L G Y * P L G L S S I A S C I L * Y P L Y V M N H F D * R H S L Q V F * I L F T F W I I S T R V I L Y S F L N V MboII |TspDTI MaeII || MboII | Hpy99I Hin6I || | Hpy166II | |SetI |GlaI || | | MboII | |TaiI ||HhaI Hpy188I || | | |TspDTI \ \\ \\\ \ \\ \ \ \\ GACGTAAAAGGCGCAACTTCTGATGAAGAAGATGAAGAAAGTTCACACGAAGATACTGAA 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCATTTTCCGCGTTGAAGACTACTTCTTCTACTTCTTTCAAGTGTGCTTCTATGACTT / / /// / / / / / / | MaeII ||Hin6I Hpy188I | | | TspDTI MboII TaiI |GlaI | | | MboII SetI HhaI | | Hpy166II | MboII TspDTI MboII D V K G A T S D E E D E E S S H E D T E T * K A Q L L M K K M K K V H T K I L K R K R R N F * * R R * R K F T R R Y * K ----:----|----:----|----:----|----:----|----:----|----:----| S T F P A V E S S S S S S L E C S S V S R R L L R L K Q H L L H L F N V R L Y Q V Y F A C S R I F F I F F T * V F I S F MboII AsuI* | NdeI AvaII | | Eco57I |BmgT120I | | Eco57MI MboII PsiI || Hpy178III* | | | SspI TspDTI \ \ \\ \ \ \ \ \ \ AATGTTATAAATGGTCCTGAAGAACTATATGGCACATATGAATATTTATTAGGAATGAGA 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAATATTTACCAGGACTTCTTGATATACCGTGTATACTTATAAATAATCCTTACTCT / // / / / / / / PsiI || Hpy178III* MboII | NdeI SspI TspDTI |AvaII Eco57MI |AsuI* Eco57I BmgT120I N V I N G P E E L Y G T Y E Y L L G M R M L * M V L K N Y M A H M N I Y * E * E C Y K W S * R T I W H I * I F I R N E N ----:----|----:----|----:----|----:----|----:----|----:----| F T I F P G S S S Y P V Y S Y K N P I L F H * L H D Q L V I H C M H I N I L F S I N Y I T R F F * I A C I F I * * S H S AluI MmeI StyI CviJI | BsaXI SecI* EcoRV | SetI | | BsmAI \ \ \ \ \ \ \ ATATGGTCATTGACCAAGGAAAGATATCAAAAGCTGTTGAAACAAAAACAAGAAAAGGAG 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| TATACCAGTAACTGGTTCCTTTCTATAGTTTTCGACAACTTTGTTTTTGTTCTTTTCCTC / / / / // / SecI* EcoRV | CviJI |BsaXI BsmAI StyI | AluI MmeI SetI I W S L T K E R Y Q K L L K Q K Q E K E Y G H * P R K D I K S C * N K N K K R R M V I D Q G K I S K A V E T K T R K G D ----:----|----:----|----:----|----:----|----:----|----:----| I H D N V L S L Y * F S N F C F C S F S F I T M S W P F I D F A T S V F V L F P Y P * Q G L F S I L L Q Q F L F L F L L MseI AciI Hin4II* BsaXI | FnuDII* | TspRI MnlI \ \ \ \ \ \ ACAGAGTTGGAAAACTTGTTAAAACTTTCCGCGAAAGATATATGGAACACTGACTTGAAG 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTCAACCTTTTGAACAATTTTGAAAGGCGCTTTCTATATACCTTGTGACTGAACTTC / / / / / / | MseI FnuDII* | Hin4II* MnlI BsaXI AciI TspRI T E L E N L L K L S A K D I W N T D L K Q S W K T C * N F P R K I Y G T L T * R R V G K L V K T F R E R Y M E H * L E G ----:----|----:----|----:----|----:----|----:----|----:----| V S N S F K N F S E A F S I H F V S K F S L T P F S T L V K R S L Y I S C Q S S C L Q F V Q * F K G R F I Y P V S V Q L CviRI* EcoRV | AluI | AlfI | CviJI | AlfI | | SetI | Hpy178III* | | Cac8I | | ApoI | | | AciI | | TspEI | | | FnuDII* | | | SfaNI | | | | AlfI CviJI SetI | | | | CviRI* | | | | AlfI \ \ \ \ \ \ \ \ \ \ \ \ GCTTTTGAGGTGGGATATCAAGAATTTTTGCAACGAGATGCAGAAGCTCGCGGTGGTAAT 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAAACTCCACCCTATAGTTCTTAAAAACGTTGCTCTACGTCTTCGAGCGCCACCATTA / / // / / // / / / / /// CviJI SetI || | | |SfaNI | | | | ||AciI || | | CviRI* | | | | |AlfI || | TspEI | | | | |AlfI || | ApoI | | | | FnuDII* || Hpy178III* | | | Cac8I |AlfI | | CviJI |AlfI | | AluI EcoRV | SetI CviRI* A F E V G Y Q E F L Q R D A E A R G G N L L R W D I K N F C N E M Q K L A V V M F * G G I S R I F A T R C R S S R W * C ----:----|----:----|----:----|----:----|----:----|----:----| A K S T P Y * S N K C R S A S A R P P L P K Q P P I D L I K A V L H L L E R H Y S K L H S I L F K Q L S I C F S A T T I HindIII | AluI | CviJI | | SetI | | | HindII BsiYI* | | | Hpy166II |BsiYI* SetI | | | | Hpy99I \\ \ \ \ \ \ \ GTTCCCAATAAAGGGAGCAAAACGAAAGGTAAAGGAAAAAGAAAGCTTGTTGACGACGAA 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGGGTTATTTCCCTCGTTTTGCTTTCCATTTCCTTTTTCTTTCGAACAACTGCTGCTT // / / / / / / |BsiYI* SetI | | | | Hpy99I BsiYI* | | | Hpy166II | | | HindII | | HindIII | CviJI | AluI SetI V P N K G S K T K G K G K R K L V D D E F P I K G A K R K V K E K E S L L T T K S Q * R E Q N E R * R K K K A C * R R R ----:----|----:----|----:----|----:----|----:----|----:----| T G L L P L L V F P L P F L F S T S S S H E W Y L S C F S L Y L F F F A Q Q R R N G I F P A F R F T F S F S L K N V V F TatI |Csp6I TspEI BbvII* ||RsaI | MseI | MboII BccI ||ScaI MaeI | |MnlI \ \ \ \\\ \ \ \\ GACTACGACCCATCAAAAAAAAACAAGAAAAGTACTGCTAGAAAGGGCAAAAAAATTAAG 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| CTGATGCTGGGTAGTTTTTTTTTGTTCTTTTCATGACGATCTTTCCCGTTTTTTTAATTC / / /// / /// BbvII* BccI ||TatI MaeI ||MseI MboII |Csp6I |TspEI ScaI MnlI RsaI D Y D P S K K N K K S T A R K G K K I K T T T H Q K K T R K V L L E R A K K L S L R P I K K K Q E K Y C * K G Q K N * V ----:----|----:----|----:----|----:----|----:----|----:----| S * S G D F F F L F L V A L F P L F I L L S R G M L F F C S F Y Q * F P C F F * V V V W * F F V L F T S S S L A F F N L SpeI ApoI |MaeI KasI TspEI || MaeIII HgiCI* \ \\ \ \ TTAGAGGATAAGAATTTTGAAAGGATTTTGTTAGAACAAAAACTAGTAACCAAAAGCAAG 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTCCTATTCTTAAAACTTTCCTAAAACAATCTTGTTTTTGATCATTGGTTTTCGTTC / // / / TspEI || MaeIII HaeII ApoI |SpeI MaeI L E D K N F E R I L L E Q K L V T K S K * R I R I L K G F C * N K N * * P K A R R G * E F * K D F V R T K T S N Q K Q G ----:----|----:----|----:----|----:----|----:----|----:----| N S S L F K S L I K N S C F S T V L L L T L P Y S N Q F S K T L V F V L L W F C * L I L I K F P N Q * F L F * Y G F A L AcyI NarI Hin6I |GlaI |DinI |NlaIV ||HhaI ||TsoI Hin4II* |||HaeII MseI |Hpy188I Ksp632I* \\\\ \ \\ \ GCGCCTACAAAGATTAAAAAAGAGAAAACGCCTTCTGTTTCAGAAACAAAAACAGAAGAA 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| CGCGGATGTTTCTAATTTTTTCTCTTTTGCGGAAGACAAAGTCTTTGTTTTTGTCTTCTT //// / // / |||HgiCI* MseI |Hpy188I Ksp632I* |||KasI Hin4II* ||Hin6I ||NarI ||AcyI |NlaIV |DinI |GlaI TsoI HhaI A P T K I K K E K T P S V S E T K T E E R L Q R L K K R K R L L F Q K Q K Q K K A Y K D * K R E N A F C F R N K N R R R ----:----|----:----|----:----|----:----|----:----|----:----| A G V F I L F S F V G E T E S V F V S S P A * L S * F L S F A K Q K L F L F L L R R C L N F F L F R R R N * F C F C F F MboII |MboII MboII || MboII |BsiI* || | BsmI || MboII || | |MboII || Hin4II* TaqI MnlI \\ \ \\ \\ \ \ \ GAAGAGAATGCTCCTTCTTCCACGAGTTCTTCTTCTATTTTCGACATAAAGAAAGAAGAT 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTCTTACGAGGAAGAAGGTGCTCAAGAAGAAGATAAAAGCTGTATTTCTTTCTTCTA // // / / / / / / || || MboII | | BsiI* TaqI MnlI || |BsmI | Hin4II* || MboII | MboII |MboII MboII MboII E E N A P S S T S S S S I F D I K K E D K R M L L L P R V L L L F S T * R K K I R E C S F F H E F F F Y F R H K E R R * ----:----|----:----|----:----|----:----|----:----|----:----| S S F A G E E V L E E E I K S M F F S S L L S H E K K W S N K K * K R C L S L L F L I S R R G R T R R R N E V Y L F F I MboII MseI BseMII TaqI |AhaIII* |BspCNI DdeI AsuII || TspEI \\ \ \ \\ \ AAAGATGAGGGCGAACTGAGTAAGATTTCGAACAAGTTTAAAAAAATTAGCACGATTTTT 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTACTCCCGCTTGACTCATTCTAAAGCTTGTTCAAATTTTTTTAATCGTGCTAAAAA // / / // / |BspCNI DdeI AsuII |MseI TspEI |MboII TaqI AhaIII* BseMII K D E G E L S K I S N K F K K I S T I F K M R A N * V R F R T S L K K L A R F L R * G R T E * D F E Q V * K N * H D F * ----:----|----:----|----:----|----:----|----:----|----:----| L S S P S S L L I E F L N L F I L V I K Y L H P R V S Y S K S C T * F F * C S K F I L A F Q T L N R V L K F F N A R N K AciI | Hin4II* | | TaqI \ \ \ GACAAAATGGGTTCTACTTCCGCTACATCGAAGGAAAATACACCAGAACAGGACGATGTA 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTTTACCCAAGATGAAGGCGATGTAGCTTCCTTTTATGTGGTCTTGTCCTGCTACAT // / || TaqI |Hin4II* AciI D K M G S T S A T S K E N T P E Q D D V T K W V L L P L H R R K I H Q N R T M * Q N G F Y F R Y I E G K Y T R T G R C S ----:----|----:----|----:----|----:----|----:----|----:----| S L I P E V E A V D F S F V G S C S S T Q C F P N * K R * M S P F Y V L V P R H V F H T R S G S C R L F I C W F L V I Y SetI AluI |TspEI CviJI || CfrI PvuII || | BalI NspBII* || | CviJI CviJI TsoI AciI | SetI || | HaeIII \ \ \ \ \ \\ \ \ GCCACTAAAAAAAATCAAACAACCGCTAAAAAAACAGCTGTAAAACCTAAATTGGCCAAG 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTGATTTTTTTTAGTTTGTTGGCGATTTTTTTGTCGACATTTTGGATTTAACCGGTTC / / / / / / / / / CviJI TsoI AciI | | SetI | | CfrI | NspBII* | HaeIII | PvuII | CviJI | CviJI | BalI | AluI TspEI SetI A T K K N Q T T A K K T A V K P K L A K P L K K I K Q P L K K Q L * N L N W P R H * K K S N N R * K N S C K T * I G Q E ----:----|----:----|----:----|----:----|----:----|----:----| A V L F F * V V A L F V A T F G L N A L L W * F F D F L R * F F L Q L V * I P W G S F F I L C G S F F C S Y F R F Q G L MaeI HphI |SetI || ApoI CviJI || TspEI |BsrI Hpy178III* || TspDTI \\ \ \\ \ AAGCCAGTCAGGAAACAACAAAAAGTTGTGGAACTATCTGGTGAAAGCGACCTAGAAATT 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGGTCAGTCCTTTGTTGTTTTTCAACACCTTGATAGACCACTTTCGCTGGATCTTTAA // / / / / / |CviJI Hpy178III* | | | TspEI BsrI | | | ApoI | | TspDTI | | MaeI | HphI SetI K P V R K Q Q K V V E L S G E S D L E I S Q S G N N K K L W N Y L V K A T * K F A S Q E T T K S C G T I W * K R P R N F ----:----|----:----|----:----|----:----|----:----|----:----| F G T L F C C F T T S S D P S L S R S I S A L * S V V F L Q P V I Q H F R G L F L W D P F L L F N H F * R T F A V * F N MboI | DpnI | |TspRI TfiI | |BstKTI MboII MboII HinfI | ||Hpy178III* | SfaNI |TspDTI \ \ \\\ \ \ \\ TTAGATTCATACACTGATCGGGAAGATAGCAATAAAGATGAAGATGATGCTATACCACAA 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTAAGTATGTGACTAGCCCTTCTATCGTTATTTCTACTTCTACTACGATATGGTGTT / / // / / / / / | TspRI || | Hpy178III* MboII SfaNI TspDTI HinfI || MboI MboII TfiI |DpnI BstKTI L D S Y T D R E D S N K D E D D A I P Q * I H T L I G K I A I K M K M M L Y H N R F I H * S G R * Q * R * R * C Y T T T ----:----|----:----|----:----|----:----|----:----|----:----| K S E Y V S R S S L L L S S S S A I G C K L N M C Q D P L Y C Y L H L H H * V V * I * V S I P F I A I F I F I I S Y W L BbvI |MboI || DpnI || |BstKTI || ||HgaI || ||| TaqI || ||| |Hpy178III* || ||| ||Hpy99I || ||| ||| TseI || ||| ||| AluI MboI || ||| ||| CviJI | DpnI || ||| ||| |BisI Hpy99I MaeII | BsmAI || ||| ||| ||BlsI | NlaIV | SetI | |BstKTI || ||| ||| ||SetI | | DdeI | TaiI \ \\ \\ \\\ \\\ \\\ \ \ \ \ \ CGATCAAGGAGACAAAGATCGTCGAGAGCTGCGTCGGTTCCTAAGAAATCTTACGTTGAA 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| GCTAGTTCCTCTGTTTCTAGCAGCTCTCGACGCAGCCAAGGATTCTTTAGAATGCAACTT // / / //// /// //// / / / / || | BsmAI |||| ||| |||Hpy99I NlaIV DdeI | MaeII || MboI |||| ||| |||TseI TaiI |DpnI |||| ||| ||BisI SetI BstKTI |||| ||| |BlsI |||| ||| CviJI |||| ||| AluI |||| ||SetI |||| |Hpy178III* |||| |HgaI |||| TaqI |||MboI ||Hpy99I ||BbvI |DpnI BstKTI R S R R Q R S S R A A S V P K K S Y V E D Q G D K D R R E L R R F L R N L T L K I K E T K I V E S C V G S * E I L R * N ----:----|----:----|----:----|----:----|----:----|----:----| R D L L C L D D L A A D T G L F D * T S V I L S V F I T S L Q T P E * S I K R Q S * P S L S R R S S R R N R L F R V N F StyI SecI* |MboII ||TspDTI TspDTI ||| MboI Hpy188I ||| | DpnI | Tsp4CI* Ksp632I* ||| | |BstKTI TspEI | | TaqI |MnlI MboII ||| | || Hpy188I \ \ \ \ \\ \ \\\ \ \\ \ ACTTTAGAATTATCTGACGACAGTTTCATCGAAGATGATGAAGAGGAAAACCAAGGATCA 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAATCTTAATAGACTGCTGTCAAAGTAGCTTCTACTACTTCTCCTTTTGGTTCCTAGT / // / / / / / / /// / | || Tsp4CI* | | | MboII | ||| Hpy188I | |Hpy188I | | Ksp632I* | ||| MboI | TspDTI | MnlI | ||DpnI TspEI TaqI | |BstKTI | SecI* | StyI TspDTI MboII T L E L S D D S F I E D D E E E N Q G S L * N Y L T T V S S K M M K R K T K D Q F R I I * R Q F H R R * * R G K P R I R ----:----|----:----|----:----|----:----|----:----|----:----| V K S N D S S L K M S S S S S S F W P D F K L I I Q R C N * R L H H L P F G L I S * F * R V V T E D F I I F L F V L S * Ksp632I* BinI* |MnlI \ \\ GATGTTTCGTTCAATGAAGAGGATTGA 4270 4280 ----:----|----:----|----:-- CTACAAAGCAAGTTACTTCTCCTAACT / / / BinI* | Ksp632I* MnlI D V S F N E E D * M F R S M K R I X C F V Q * R G L X ----:----|----:----|----:-- S T E N L S S S Q L H K T * H L P N I N R E I F L I S # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AciI 11 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AgeI 2 AsiGI,BshTI,CspAI,PinAI AhaIII* 5 DraI AjuI 3 AlfI 2 AluI 16 AluBI ApoI 18 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 5 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BaeI 2 BalI 3 MlsI,MluNI,MscI,Msp20I BbvCI 2 BbvI 6 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 10 Bce83I* 3 BpuEI BceAI 1 BclI 2 FbaI,Ksp22I BdaI 2 BetI* 2 BsaWI BglII 1 BinI* 5 AlwI,BspPI,AclWI BisI 9 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 9 BmgT120I 5 BmtI 1 BspOI BplI 2 Bpu10I 2 BsaAI 1 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BsaXI 3 BseBI 5 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 6 BseRI 2 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 6 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 4 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 6 BspHI 2 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrDI 2 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BstKTI 14 BtgZI 1 Cac8I 3 BstC8I Cfr10I 3 BsrFI,BssAI,Bse118I CfrI 4 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 14 CviQI,RsaNI CviAII 8 CviJI 38 CviKI-1 CviRI* 13 HpyCH4V DdeI 12 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 14 MalI DraII 1 EcoO109I DraIII 1 AdeI DrdI 1 AasI,DseDI DsaI* 3 BtgI,BstDSI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 2 EcoP15I 1 EcoRI 3 EcoRII 5 AjnI,Psp6I,PspGI EcoRV 7 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 8 FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 4 GsuI 1 BpmI HaeII 2 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiCI* 3 BanI,BshNI,BspT107I,AccB1I HhaI 4 BstHHI,CfoI,AspLEI Hin4I 10 Hin4II* 8 HpyAV Hin6I 4 HinP1I,HspAI HindII 5 HincII HindIII 2 HinfI 12 HpaI 2 KspAI HpaII 5 HapII,BsiSI,MspI HphI 8 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 15 Hpy188III Hpy188I 19 Hpy99I 6 KasI 1 KpnI 1 Ksp632I* 5 Eam1104I,EarI,Bst6I MaeI 10 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 10 MboI 14 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 30 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 1 SchI MmeI 3 MnlI 19 MseI 31 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NarI 1 Mly113I NcoI 2 Bsp19I NdeI 2 FauNDI NheI 1 AsuNHI NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 10 BspLI,BmiI,PspN4I NspBII* 3 MspA1I NspI 1 BstNSI,XceI OliI 1 AleI PflMI 3 BasI,AccB7I,Van91I PleI 1 PpsI PpuMI 1 Psp5II,PspPPI PsiI 4 AanI PstI 1 PvuII 2 RsaI 14 AfaI SanDI 1 SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 3 BmcAI,AssI,ZrmI ScrFI 5 BmrFI,MspR9I,Bme1390I SecI* 9 BseDI,BssECI,BsaJI SetI 40 SexAI 1 MabI SfaNI 7 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 3 SmoI SpeI 1 BcuI,AhlI SspI 6 StyI 6 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 11 TaqII 3 TatI 5 TauI 3 TfiI 11 PfeI TseI 6 ApeKI TsoI 5 Tsp45I 5 NmuCI Tsp4CI* 13 HpyCH4III,TaaI,Bst4CI TspDTI 26 TspEI 44 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 8 TscAI TstI 2 VspI 5 PshBI,AseI XcmI 2 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AccI AclI AflII AflIII AloI AlwNI ApaI ApaLI AscI AvaI BamHI BarI BcgI BciVI BfiI BglI BmeT110I BsePI BseSI BseYI BsgI Bsp120I Bsp1407I BspLU11I* BspMII* BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtrI BtsI CauII* Cfr9I CspCI Eam1105I Ecl136II Eco47III EcoICRI EcoNI Esp3I FauI FseI FspAI GsaI HgiAI* HgiJII* MauBI MluI MroNI MstI* NaeI NgoMIV NmeAIII NotI NruI PacI PasI PfoI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SapI SduI SfiI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI Tth111I XbaI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769