Restriction Map of END3/YNL084C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

END3/YNL084C on chromosome XIV from coordinates 471102 to 470053.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.27228

EMBOSS_001 MboII AvaI TspEI | BsrI |BmeT110I \ \ \ \\ ATGCCCAAGTTGGAACAATTTGAAATAAAAAAATACTGGCAAATCTTCTCGGGTTTGAAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGGTTCAACCTTGTTAAACTTTATTTTTTTATGACCGTTTAGAAGAGCCCAAACTTT / / / // TspEI | BsrI |AvaI MboII BmeT110I M P K L E Q F E I K K Y W Q I F S G L K C P S W N N L K * K N T G K S S R V * N A Q V G T I * N K K I L A N L L G F E T ----:----|----:----|----:----|----:----|----:----|----:----| X G L N S C N S I F F Y Q C I K E P K F X A W T P V I Q F L F I S A F R R P N S H G L Q F L K F Y F F V P L D E R T Q F SetI |Hpy166II || FatI || |CviAII || || NlaIII || || |BssKI || || |SexAI || || |EcoRII || || ||BsiYI* PsiI || || |||ScrFI |TspEI || || |||BseBI || TspDTI || || |||| SetI TspEI || | TspEI \\ \\ \\\\ \ \ \\ \ \ CCAATAGAGAATAAGGTAAACCATGACCAGGTTTTACCAATTCTTTATAATTCCAAATTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTATCTCTTATTCCATTTGGTACTGGTCCAAAATGGTTAAGAAATATTAAGGTTTAAT / / / // // / / / // / SetI | | || || EcoRII | | |TspEI TspEI | | || || SexAI | | TspDTI | | || || BssKI | PsiI | | || |BseBI TspEI | | || |ScrFI | | || SetI | | |FatI | | BsiYI* | | CviAII | NlaIII Hpy166II P I E N K V N H D Q V L P I L Y N S K L Q * R I R * T M T R F Y Q F F I I P N * N R E * G K P * P G F T N S L * F Q I R ----:----|----:----|----:----|----:----|----:----|----:----| G I S F L T F W S W T K G I R * L E L N V L L S Y P L G H G P K V L E K Y N W I W Y L I L Y V M V L N * W N K I I G F * AluI TfiI CviJI Hpy99I HinfI | SetI | TspEI MnlI \ \ \ \ \ \ GATTCATCGGTTCTAAACAAGATTTGGTTTTTAGCTGATATTGATGACGACGACAATTTA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGTAGCCAAGATTTGTTCTAAACCAAAAATCGACTATAACTACTGCTGCTGTTAAAT / / / / // HinfI | CviJI Hpy99I |MnlI TfiI | AluI TspEI SetI D S S V L N K I W F L A D I D D D D N L I H R F * T R F G F * L I L M T T T I * F I G S K Q D L V F S * Y * * R R Q F R ----:----|----:----|----:----|----:----|----:----|----:----| S E D T R F L I Q N K A S I S S S S L K L N M P E L C S K T K L Q Y Q H R R C N I * R N * V L N P K * S I N I V V V I * FatI CviRI* |CviAII || NlaIII || | MseI || | VspI ApoI || | | TsoI TspEI TspEI || | | |SspI MseI \ \ \\ \ \ \\ \ GACTTTGAGGAATTTGTAATTTGCATGAGATTAATATTTGATATGGTTAATAAAAACATT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAACTCCTTAAACATTAAACGTACTCTAATTATAAACTATACCAATTATTTTTGTAA / / / // // / / / TspEI | | |FatI || SspI MseI SetI ApoI | | | |VspI | | | |MseI | | | TsoI | | CviAII | CviRI* | NlaIII TspEI D F E E F V I C M R L I F D M V N K N I T L R N L * F A * D * Y L I W L I K T L L * G I C N L H E I N I * Y G * * K H * ----:----|----:----|----:----|----:----|----:----|----:----| S K S S N T I Q M L N I N S I T L L F M L S Q P I Q L K C S I L I Q Y P * Y F C V K L F K Y N A H S * Y K I H N I F V N TspDTI | TfiI | HinfI | | BssKI | | EcoRII | | |SecI* | | ||ScrFI AluI | | ||BseBI SetI CviJI Hpy178III* | | |||BdaI |TfiI | SetI | TspEI | | |||BdaI |HinfI HphI \ \ \ \ \ \ \\\\ \\ \ AGCTCTGTTCCAGATGAATTGCCTGATTGGTTGATTCCAGGGAGTAAGGTGAATCTAATC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAGACAAGGTCTACTTAACGGACTAACCAACTAAGGTCCCTCATTCCACTTAGATTAG / / / / // / / / / / CviJI | TspEI TspDTI || | | SetI | HphI AluI Hpy178III* || | EcoRII HinfI || | BssKI TfiI || | SecI* || BseBI || ScrFI |BdaI |BdaI HinfI TfiI S S V P D E L P D W L I P G S K V N L I A L F Q M N C L I G * F Q G V R * I * S L C S R * I A * L V D S R E * G E S N Q ----:----|----:----|----:----|----:----|----:----|----:----| L E T G S S N G S Q N I G P L L T F R I * S Q E L H I A Q N T S E L S Y P S D L A R N W I F Q R I P Q N W P T L H I * D BdaI BdaI | Hin6I | |GlaI | ||HhaI | ||| Cac8I Hin4II* MnlI \ \\\ \ \ \ AAAGAAAGAAAGAAGCGCAAGCAAATAGAAAACGCAGACTTGCCTCCAAAGAAGGAAATC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTTCTTTCTTCGCGTTCGTTTATCTTTTGCGTCTGAACGGAGGTTTCTTCCTTTAG / /// / / / | ||| Cac8I Hin4II* MnlI | ||Hin6I | |GlaI | HhaI BdaI BdaI K E R K K R K Q I E N A D L P P K K E I K K E R S A S K * K T Q T C L Q R R K S R K K E A Q A N R K R R L A S K E G N Q ----:----|----:----|----:----|----:----|----:----|----:----| L S L F F R L C I S F A S K G G F F S I * L F F S A C A F L F R L S A E L S P F F F S L L A L L Y F V C V Q R W L L F D GsuI Eco57MI | Csp6I | |RsaI | ||FatI | ||AflIII | ||BspLU11I* | |||CviAII | ||||BdaI ApoI | ||||BdaI TspEI | ||||| NspI | BdaI | ||||| NlaIII | BdaI | ||||| | Hpy178III* | | PsiI | ||||| | | BsaBI | | | TspDTI | ||||| | | |TfiI | | | | AluI | ||||| | |BsmAI |HinfI | | | | CviJI \ \\\\\ \ \\ \\ \ \ \ \ \ AAAGTAGATTGGTACATGTCTCCAGATGATTTGAATCAATATGAAAAAATTTATAATAGC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCATCTAACCATGTACAGAGGTCTACTAAACTTAGTTATACTTTTTTAAATATTATCG / // // / / / / / / // / / Eco57MI || || | | | HinfI | | || | CviJI GsuI || || | | | TfiI | | || | AluI || || | | BsaBI | | || SetI || || | BsmAI | | |TspDTI || || Hpy178III* | | PsiI || |BspLU11I* | TspEI || |AflIII | ApoI || |FatI BdaI || CviAII BdaI |NlaIII |Csp6I |NspI |BdaI |BdaI RsaI K V D W Y M S P D D L N Q Y E K I Y N S K * I G T C L Q M I * I N M K K F I I A S R L V H V S R * F E S I * K N L * * L ----:----|----:----|----:----|----:----|----:----|----:----| L T S Q Y M D G S S K F * Y S F I * L L * L L N T C T E L H N S D I H F F K Y Y F Y I P V H R W I I Q I L I F F N I I A SetI Tsp4CI* | CviRI* Csp6I | HindII | | BccI |RsaI | Hpy166II \ \ \ \\ \ \ TGTGCAAAACTAACCGATGGTACTATTACATTCAACGAACTGTCAACAAAACTTTCCACA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ACACGTTTTGATTGGCTACCATGATAATGTAAGTTGCTTGACAGTTGTTTTGAAAGGTGT / / // / / CviRI* BccI |Csp6I | Hpy166II RsaI | HindII Tsp4CI* C A K L T D G T I T F N E L S T K L S T V Q N * P M V L L H S T N C Q Q N F P Q C K T N R W Y Y Y I Q R T V N K T F H K ----:----|----:----|----:----|----:----|----:----|----:----| Q A F S V S P V I V N L S S D V F S E V S H L V L R H Y * * M * R V T L L V K W T C F * G I T S N C E V F Q * C F K G C CspCI | MseI MseI | |TspEI ApoI |SwaI | || MseI ApoI TspEI MseI |AhaIII* SetI | || PacI TspEI \ \ \\ \ \ \\ \ \ AAATTTTTTAACATCAGTAAGACAGATTTAAATAAGGTTTGGAGTTTAATTAACCCACAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAAAAATTGTAGTCATTCTGTCTAAATTTATTCCAAACCTCAAATTAATTGGGTGTT / / // / / / // | MseI || SetI CspCI | |MseI TspEI |MseI | TspEI ApoI AhaIII* PacI SwaI MseI K F F N I S K T D L N K V W S L I N P Q N F L T S V R Q I * I R F G V * L T H K I F * H Q * D R F K * G L E F N * P T K ----:----|----:----|----:----|----:----|----:----|----:----| F N K L M L L V S K F L T Q L K I L G C L I K * C * Y S L N L Y P K S N L * G V F K K V D T L C I * I L N P T * N V W L MfeI TspEI | BccI | |BinI* | || CspCI | || |BsaBI | || ||MboI | || ||XhoII Tsp4CI* | || ||| DpnI | MseI | || ||| |BstKTI | TspRI TaqII \ \\ \\\ \\ \ \ \ AATTTGCCATCAATTGATAGAGATCCTACTTTTTATTTTATTCACTGTTTAAGACAAAGA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAACGGTAGTTAACTATCTCTAGGATGAAAAATAAAATAAGTGACAAATTCTGTTTCT / /// / // / / / / / TspEI ||| | || XhoII | | MseI TaqII ApoI ||| | || MboI | Tsp4CI* ||| | |DpnI TspRI ||| | BstKTI ||| BsaBI ||CspCI ||BinI* |BccI TspEI MfeI N L P S I D R D P T F Y F I H C L R Q R I C H Q L I E I L L F I L F T V * D K E F A I N * * R S Y F L F Y S L F K T K K ----:----|----:----|----:----|----:----|----:----|----:----| F K G D I S L S G V K * K I * Q K L C L F N A M L Q Y L D * K K N * E S N L V F I Q W * N I S I R S K I K N V T * S L S Hpy166II ApoI | ApoI MnlI SetI TspEI | TspEI | AciI | CviRI* \ \ \ \ \ \ \ AATGATTTGGGTGCTGAAATTCCAGCAAGTTTACCAAATTCTCTGGCGGAGGTGTGCAAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTAAACCCACGACTTTAAGGTCGTTCAAATGGTTTAAGAGACCGCCTCCACACGTTA / / // // / // TspEI Hpy166II |MnlI |SetI | |BspCNI ApoI TspEI AciI | BseMII ApoI | EciI CviRI* N D L G A E I P A S L P N S L A E V C N M I W V L K F Q Q V Y Q I L W R R C A I * F G C * N S S K F T K F S G G G V Q * ----:----|----:----|----:----|----:----|----:----|----:----| F S K P A S I G A L K G F E R A S T H L F H N P H Q F E L L N V L N E P P P T C I I Q T S F N W C T * W I R Q R L H A I DdeI Hin4I SetI Hin4I AsuI* MnlI EciI | AluI AvaII | Hin4I BseMII | CviJI Tsp4CI* | Hin4I |BspCNI | | SetI |BmgT120I | | MnlI \\ \ \ \ \\ \ \ \ AAAAAACAACTGAGCTATGATTTACGGTCCTCTCAACCTCCTACAAAGAGAAAAGAAGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTGTTGACTCGATACTAAATGCCAGGAGAGTTGGAGGATGTTTCTCTTTTCTTCTT / /// / // / // / / Hin4I ||CviJI | |AvaII | |MnlI MnlI SetI Hin4I ||AluI | |AsuI* | Hin4I |DdeI | | | Hin4I SetI | | SetI | BmgT120I Tsp4CI* K K Q L S Y D L R S S Q P P T K R K E E K N N * A M I Y G P L N L L Q R E K K K K T T E L * F T V L S T S Y K E K R R S ----:----|----:----|----:----|----:----|----:----|----:----| L F C S L * S K R D E * G G V F L F S S Y F V V S S H N V T R E V E * L S F L L F F L Q A I I * P G R L R R C L S F F F AvaI XhoI SmlI AluI PspXI CviJI |TaqI | SetI MaeIII |BmeT110I BtsI | | MboII Tsp45I || AlfI AloI | | | Hpy166II | AloI || Hpy188I TspRI \ \ \ \ \ \ \\ \ \ GCTAACGAAGTGGACAATCTGCGTGACAATGGGCAGAACTCGAGTTCCGATAGCAGTGGC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTGCTTCACCTGTTAGACGCACTGTTACCCGTCTTGAGCTCAAGGCTATCGTCACCG / / / / / // // / / / | MboII Hpy166II | Tsp45I || || | | BtsI CviJI | MaeIII || || | AloI AluI AloI || || TspRI || |Hpy188I || AlfI |PspXI |SmlI |XhoI |AvaI BmeT110I TaqI A N E V D N L R D N G Q N S S S D S S G L T K W T I C V T M G R T R V P I A V A * R S G Q S A * Q W A E L E F R * Q W Q ----:----|----:----|----:----|----:----|----:----|----:----| A L S T S L R R S L P C F E L E S L L P L * R L P C D A H C H A S S S N R Y C H S V F H V I Q T V I P L V R T G I A T A AlfI Hpy188I AlfI | AlfI AlfI | AlfI MaeIII | Tsp4CI* | |MboI | MaeII | |BbvII* | |BclI | | SetI | || MboII Hin4I | || DpnI | | TaiI | || |TspDTI Hin4I | || |BstKTI \ \ \ \ \\ \\ \ \ \\ \\ AGTAACGTGCTTTCAAATGAAGACAGTATAAAGCAAAAATATGCTTCTCTGACAGATGAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTGCACGAAAGTTTACTTCTGTCATATTTCGTTTTTATACGAAGAGACTGTCTACTA / // / / / / / / // | |MaeII | | TspDTI Hin4I | | |DpnI | MaeIII | | BbvII* Hin4I | | BstKTI TaiI | | MboII | AlfI SetI | Tsp4CI* | AlfI AlfI Hpy188I AlfI AlfI S N V L S N E D S I K Q K Y A S L T D D V T C F Q M K T V * S K N M L L * Q M I * R A F K * R Q Y K A K I C F S D R * S ----:----|----:----|----:----|----:----|----:----|----:----| L L T S E F S S L I F C F Y A E R V S S C Y R A K L H L C Y L A F I H K E S L H T V H K * I F V T Y L L F I S R Q C I I FatI |CviAII || Hin4I StuI BdaI || Hin4I TspEI CviJI BdaI || |NlaIII Hin4II* HaeIII | Bce83I* \\ \\ \ \ \ \ CAAGTTGCGAACATGAGAGAACAATTAGAAGGCCTTTTGAACTACAAAAAGAGTGAAAAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCAACGCTTGTACTCTCTTGTTAATCTTCCGGAAAACTTGATGTTTTTCTCACTTTTT / / / // / / / / / / BclI | | |FatI | TspEI HaeIII | Bce83I* MnlI MboI | | CviAII Hin4II* CviJI BdaI | NlaIII StuI BdaI Hin4I Hin4I Q V A N M R E Q L E G L L N Y K K S E K K L R T * E N N * K A F * T T K R V K K S C E H E R T I R R P F E L Q K E * K N ----:----|----:----|----:----|----:----|----:----|----:----| * T A F M L S C N S P R K F * L F L S F D L Q S C S L V I L L G K S S C F S H F L N R V H S F L * F A K Q V V F L T F F MnlI BdaI DdeI MseI TaqI |SmlI CviJI BdaI | AciI | BsaBI SetI \\ \ \ \ \ \ \ \ ACTCAAGGAGGCTCAAAACTTTCTAAGCGGATTAACATCAGGTCGATAACTGATGACTTG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGTTCCTCCGAGTTTTGAAAGATTCGCCTAATTGTAGTCCAGCTATTGACTACTGAAC / / / / / / / / SmlI | BdaI | AciI | SetI TaqI | BdaI DdeI BsaBI CviJI MseI T Q G G S K L S K R I N I R S I T D D L L K E A Q N F L S G L T S G R * L M T W S R R L K T F * A D * H Q V D N * * L G ----:----|----:----|----:----|----:----|----:----|----:----| V * P P E F S E L R I L M L D I V S S K F E L L S L V K * A S * C * T S L Q H S S L S A * F K R L P N V D P R Y S I V Q EcoP15I BspMI SetI TspEI | BsmAI TspEI \ \ \ \ \ \ GATAACATTGAACAGCAGGTTGAAGTATTGGAGAATTACTTGAACAATAAGAGACACGAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTGTAACTTGTCGTCCAACTTCATAACCTCTTAATGAACTTGTTATTCTCTGTGCTT / / / / / BspMI SetI TspEI | BsmAI EcoP15I D N I E Q Q V E V L E N Y L N N K R H E I T L N S R L K Y W R I T * T I R D T N * H * T A G * S I G E L L E Q * E T R I ----:----|----:----|----:----|----:----|----:----|----:----| S L M S C C T S T N S F * K F L L L C S P Y C Q V A P Q L I P S N S S C Y S V R I V N F L L N F Y Q L I V Q V I L S V F CviRI* MfeI | Cac8I MwoI TspEI \ \ \ \ TTGCAAGCATTACAAGCAGAAATCAATTGA 1030 1040 1050 ----:----|----:----|----:----| AACGTTCGTAATGTTCGTCTTTAGTTAACT // / / / || | MwoI TspEI || Cac8I MfeI |CviRI* TspEI L Q A L Q A E I N * C K H Y K Q K S I X A S I T S R N Q L X ----:----|----:----|----:----| N C A N C A S I L Q I A L M V L L F * N Q L C * L C F D I S # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AflIII 1 AhaIII* 1 DraI AlfI 3 AloI 1 AluI 5 AluBI ApoI 6 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaI 2 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 2 Bce83I* 1 BpuEI BclI 1 FbaI,Ksp22I BdaI 6 BinI* 1 AlwI,BspPI,AclWI BmeT110I 2 BmgT120I 1 BsaBI 3 Bse8I,BseJI BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseMII 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 2 Alw26I,BstMAI BspCNI 1 BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrI 1 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 2 BtsI 1 Cac8I 2 BstC8I Csp6I 2 CviQI,RsaNI CspCI 1 CviAII 4 CviJI 7 CviKI-1 CviRI* 4 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 2 MalI EciI 1 Eco57MI 1 EcoP15I 1 EcoRII 2 AjnI,Psp6I,PspGI FatI 4 GlaI 1 GsuI 1 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HhaI 1 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 2 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 4 HphI 1 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 2 Hpy99I 1 MaeII 1 HpyCH4IV MaeIII 2 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MfeI 2 MunI MnlI 6 MseI 8 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NlaIII 4 Hin1II,Hsp92II,FaeI NspI 1 BstNSI,XceI PacI 1 PsiI 2 AanI PspXI 1 RsaI 2 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SecI* 1 BseDI,BssECI,BsaJI SetI 14 SexAI 1 MabI SmlI 2 SmoI SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI SwaI 1 SmiI TaiI 1 TaqI 2 TaqII 1 TfiI 4 PfeI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 19 TasI,Tsp509I,Sse9I TspRI 2 TscAI VspI 1 PshBI,AseI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AgeI AjuI AlwNI ApaI ApaLI AscI Asp718I AsuII AvrII BaeI BalI BamHI BarI BbvCI BbvI BceAI BcgI BciVI BetI* BfiI BglI BglII BisI BlsI BmtI BplI Bpu10I BsaAI BsaXI BseGI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstF5I BstXI BstZ17I BtgZI BtrI BtsCI CauII* Cfr10I Cfr9I CfrI ClaI DinI DraII DraIII DrdI DsaI* Eam1105I Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI Fnu4HI FnuDII* FokI FseI FspAI GsaI HaeII HgaI HgiAI* HgiCI* HgiJII* HindIII HpaI HpaII KasI KpnI Ksp632I* MaeI MauBI McrI* MluI MlyI MmeI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* OliI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PspOMI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SduI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StyI TatI TauI TseI TspGWI TspMI TstI Tth111I XbaI XcmI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769