Restriction Map of YNL058C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

YNL058C on chromosome XIV from coordinates 516713 to 515763.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 Ksp632I* SetI | BsmAI | MboII | Eco31I | | Hin4II* MseI FalI | | Hpy188I | | | MaeIII \ \ \ \ \ \ \ \ \ ATGGTTAAGAAAAACTTTATCCCGTCTGTATCGCTGGTCAGAAGAGACCTTCCTACTTTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAATTCTTTTTGAAATAGGGCAGACATAGCGACCAGTCTTCTCTGGAAGGATGAAAT / / / / / / / MseI FalI | | SetI | Hin4II* | Eco31I MboII | BsmAI Ksp632I* Hpy188I M V K K N F I P S V S L V R R D L P T L W L R K T L S R L Y R W S E E T F L L * G * E K L Y P V C I A G Q K R P S Y F S ----:----|----:----|----:----|----:----|----:----|----:----| X T L F F K I G D T D S T L L S R G V K X P * S F S * G T Q I A P * F L G E * K H N L F V K D R R Y R Q D S S V K R S * CviJI | MaeII | |BtrI SpeI | || SetI BslFI |MaeI AciI | || TaiI Hpy188I \\ \ \ \\ \ \ GTTACTACTACAACTAGTTCAACCGCCCTGTCAAAGCCCACGTCAAGTGTAGTGTCCGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGATGATGTTGATCAAGTTGGCGGGACAGTTTCGGGTGCAGTTCACATCACAGGCTT / // / / / // / MaeIII |SpeI AciI | | |MaeII Hpy188I MaeI | | BtrI | TaiI | SetI CviJI V T T T T S S T A L S K P T S S V V S E L L L Q L V Q P P C Q S P R Q V * C P K Y Y Y N * F N R P V K A H V K C S V R N ----:----|----:----|----:----|----:----|----:----|----:----| T V V V V L E V A R D F G V D L T T D S L * * * L * N L R G T L A W T L H L T R N S S C S T * G G Q * L G R * T Y H G F MboII | MseI | Hin4II* | |HpaI | |HindII | |Hpy166II FokI BseRI | ||BccI CviJI | BsrI TspRI \ \\\ \ \ \ \ ACGAGTTCCAAGTCCCTTCCATCGTTAACATCTTCGGCTTTCTCAACTTCCAGTGGAGCA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTCAAGGTTCAGGGAAGGTAGCAATTGTAGAAGCCGAAAGAGTTGAAGGTCACCTCGT / / / /// / / / / / BslFI | | ||BccI CviJI | | | BseGI | | |MseI | | BseRI | | Hpy166II | FokI | | HindII TspRI | | HpaI BsrI | Hin4II* MboII T S S K S L P S L T S S A F S T S S G A R V P S P F H R * H L R L S Q L P V E Q E F Q V P S I V N I F G F L N F Q W S N ----:----|----:----|----:----|----:----|----:----|----:----| V L E L D R G D N V D E A K E V E L P A F S N W T G E M T L M K P K R L K W H L R T G L G K W R * C R R S E * S G T S C MnlI SfeI* | TspEI | EcoP15I BseGI | |MnlI | | BccI BbvI \ \ \\ \ \ \ \ ACATCCTCCTCATCACTAATTGTCGCAAGTATAACACCCCCATCTACAGCAGGAAACCCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAGGAGGAGTAGTGATTAACAGCGTTCATATTGTGGGGGTAGATGTCGTCCTTTGGGT / / / // | | TspEI |BccI | MnlI EcoP15I MnlI SfeI* T S S S S L I V A S I T P P S T A G N P H P P H H * L S Q V * H P H L Q Q E T H I L L I T N C R K Y N T P I Y S R K P I ----:----|----:----|----:----|----:----|----:----|----:----| V D E E D S I T A L I V G G D V A P F G L M R R M V L Q R L Y L V G M * L L F G C G G * * * N D C T Y C G W R C C S V W Tsp4CI* MseI | AccI |AhaIII* | |BssNAI || TseI | |Hpy166II || |BisI | ||TaqII || ||BlsI | |||BsrDI || ||| EcoP15I | |||| MslI MwoI \\ \\\ \ \ \\\\ \ \ TTTATTTTAAATGCTGCTGATAAACCAAATGGAACTGTATACATTGCTGTGGGTGCTGTC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAATAAAATTTACGACGACTATTTGGTTTACCTTGACATATGTAACGACACCCACGACAG / // /// / / /// / / | |MseI ||| EcoP15I | ||AccI | MwoI | | ||TseI | || MslI | | |BisI | |Hpy166II | | BlsI | |BssNAI | AhaIII* | |BsrDI BbvI | TaqII Tsp4CI* F I L N A A D K P N G T V Y I A V G A V L F * M L L I N Q M E L Y T L L W V L S Y F K C C * * T K W N C I H C C G C C H ----:----|----:----|----:----|----:----|----:----|----:----| N I K F A A S L G F P V T Y M A T P A T M * K L H Q Q Y V L H F Q I C Q Q P H Q K N * I S S I F W I S S Y V N S H T S D HgiCI* | SetI | NlaIV TsoI BsrI BsmAI \ \ \ \ \ ATAGGTGCCATTTTTATCAGTATTCTTATATGGTGGTTAGTGTCCAGTTATTTGTCTCGT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TATCCACGGTAAAAATAGTCATAAGAATATACCACCAATCACAGGTCAATAAACAGAGCA / / / / / / | | HgiCI* TsoI BsrI Hpy99I | NlaIV SetI I G A I F I S I L I W W L V S S Y L S R * V P F L S V F L Y G G * C P V I C L V R C H F Y Q Y S Y M V V S V Q L F V S S ----:----|----:----|----:----|----:----|----:----|----:----| M P A M K I L I R I H H N T D L * K D R * L H W K * * Y E * I T T L T W N N T E Y T G N K D T N K Y P P * H G T I Q R T ApoI TspEI | TatI | Bsp1407I ApoI | |Csp6I Hpy99I TspEI CviRI* | ||RsaI \ \ \ \ \\\ CGTTTCACAATGACAAATTCTTATGCAAATGATAGTAAAAATTTGTACAGGGGACACCAC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GCAAAGTGTTACTGTTTAAGAATACGTTTACTATCATTTTTAAACATGTCCCCTGTGGTG / / / / /// BsmAI TspEI CviRI* | ||Bsp1407I ApoI | ||TatI | |Csp6I | RsaI TspEI ApoI R F T M T N S Y A N D S K N L Y R G H H V S Q * Q I L M Q M I V K I C T G D T T F H N D K F L C K * * * K F V Q G T P Q ----:----|----:----|----:----|----:----|----:----|----:----| R K V I V F E * A F S L L F K Y L P C W D N * L S L N K H L H Y Y F N T C P V G T E C H C I R I C I I T F I Q V P S V V MboII Hin4I | BslFI Hin4I CviRI* \ \ \ \ AAGCATAGTTCTTCTTTACAAAGCAATCCCTTTGACATCAATGATGAGAAATCATATATG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGTATCAAGAAGAAATGTTTCGTTAGGGAAACTGTAGTTACTACTCTTTAGTATATAC / / / / MboII BslFI Hin4I CviRI* Hin4I K H S S S L Q S N P F D I N D E K S Y M S I V L L Y K A I P L T S M M R N H I C A * F F F T K Q S L * H Q * * E I I Y A ----:----|----:----|----:----|----:----|----:----|----:----| L C L E E K C L L G K S M L S S F D Y I C A Y N K K V F C D R Q C * H H S I M Y L M T R R * L A I G K V D I I L F * I H TfiI HinfI | BcgI | |MaeI | || CviJI | || |BbvI | || |MnlI | || |SfaNI | || ||Hin4I | || ||| BsiYI* Hin4I | || ||| | HphI Hin4I | || ||| | | TseI | BseGI | || ||| | | TsoI | | TfiI | || ||| | | |BisI | | HinfI CviJI | || ||| | | ||BlsI | | | FokI | TspEI | || ||| | | ||BseGI \ \ \ \ \ \ \ \\ \\\ \ \ \\\ CAGGATGATTGGGATTCTATGAGCCAATTAGAATCTAGCCAATACGAGGATGCTGCCTCA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCTACTAACCCTAAGATACTCGGTTAATCTTAGATCGGTTATGCTCCTACGACGGAGT / / / / / / / // // // // //// Hin4I BseGI | | CviJI | | || || |SfaNI || |||TseI Hin4I | FokI | | || || |BbvI || ||BisI HinfI | | || || BsiYI* || |BlsI TfiI | | || |CviJI || BseGI | | || |MnlI |TsoI | | || MaeI HphI | | |Hin4I | | HinfI | | TfiI | BcgI TspEI Q D D W D S M S Q L E S S Q Y E D A A S R M I G I L * A N * N L A N T R M L P H G * L G F Y E P I R I * P I R G C C L T ----:----|----:----|----:----|----:----|----:----|----:----| C S S Q S E I L W N S D L W Y S S A A E A P H N P N * S G I L I * G I R P H Q R L I I P I R H A L * F R A L V L I S G * MnlI | BcgI | | TspEI | | TspGWI | | |Hin4I | | ||BinI* | | ||| BsiYI* | | ||| |Hpy178III* | | ||| || MboI | | ||| || BamHI | | ||| || XhoII | | ||| || | DpnI BinI* | | ||| || | NlaIV | MboI | | ||| || | |BstKTI | XhoII | | ||| || | || BinI* | | DpnI FokI | | ||| || | || Hpy166II | | |BstKTI MboII \ \ \ \\\ \\ \ \\ \ \ \ \\ \ CCATTCAACCCAATTCAGGATCCGTTCACAGACAACAGAAGATCCTTATTTATATCTCCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAAGTTGGGTTAAGTCCTAGGCAAGTGTCTGTTGTCTTCTAGGAATAAATATAGAGGA /// / / // /// / // / // / / ||| | | || ||| | |BinI* | || | MboII ||| | | || ||| | Hpy166II | || XhoII ||| | | || ||| XhoII | || MboI ||| | | || ||| BamHI | |DpnI ||| | | || ||| MboI | BstKTI ||| | | || ||NlaIV BinI* ||| | | || ||DpnI ||| | | || |BstKTI ||| | | || Hpy178III* ||| | | |TspEI ||| | | BinI* ||| | BsiYI* ||| TspGWI ||Hin4I |BcgI FokI MnlI P F N P I Q D P F T D N R R S L F I S P H S T Q F R I R S Q T T E D P Y L Y L L I Q P N S G S V H R Q Q K I L I Y I S Y ----:----|----:----|----:----|----:----|----:----|----:----| G N L G I * S G N V S L L L D K N I D G V M * G L E P D T * L C C F I R I * I E W E V W N L I R E C V V S S G * K Y R R CviJI TspDTI BdaI |AciI BdaI |BisI BdaI |MaeIII ||BlsI BdaI |Tsp45I |||TauI | BccI \\ \\\\ \ \ ACTTTACAAGTGTCACAATATGAAAAAAGTCATAGCCGCCATCAATCAAAAGACACTAAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAATGTTCACAGTGTTATACTTTTTTCAGTATCGGCGGTAGTTAGTTTTCTGTGATTG / / / //// / / BdaI Tsp45I | |||| BdaI BccI BdaI MaeIII | |||| BdaI | |||AciI | ||BisI | |BlsI | CviJI | TauI TspDTI T L Q V S Q Y E K S H S R H Q S K D T N L Y K C H N M K K V I A A I N Q K T L T F T S V T I * K K S * P P S I K R H * H ----:----|----:----|----:----|----:----|----:----|----:----| V K C T D C Y S F L * L R W * D F S V L * K V L T V I H F F D Y G G D I L L C * S * L H * L I F F T M A A M L * F V S V MaeII |BsaAI |SnaBI || SetI || TaiI || | Acc65I || | HgiCI* || | |Csp6I || | ||RsaI || | ||SetI || | ||NlaIV || | ||| KpnI BinI* || | ||| | SetI | MboI || | ||| | | XbaI | | DpnI || | ||| | | |MaeI MboII | | |BaeI || | ||| | | |Hpy178III* | MboII | | |BstKTI || | ||| | | || BaeI | |Ksp632I* \ \ \\ \\ \ \\\ \ \ \\ \ \ \\ ATTTTTATTGACGATCCATTTTTATACGTAGGTACCTATCTAGAAGAAGAAGAAGAAGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAATAACTGCTAGGTAAAAATATGCATCCATGGATAGATCTTCTTCTTCTTCTTCTT / / // / / /// / /// // / / / | | || MboI | ||| | ||HgiCI* |BaeI | | MboII | | |DpnI | ||| | ||Acc65I |XbaI | MboII | | BstKTI | ||| | |Csp6I Hpy178III* MboII | BaeI | ||| | NlaIV MaeI BinI* | ||| | RsaI | ||| | SetI | ||| KpnI | ||SetI | |MaeII | SnaBI | BsaAI TaiI SetI I F I D D P F L Y V G T Y L E E E E E E F L L T I H F Y T * V P I * K K K K K K F Y * R S I F I R R Y L S R R R R R R R ----:----|----:----|----:----|----:----|----:----|----:----| M K I S S G N K Y T P V * R S S S S S S C K * Q R D M K I R L Y R D L L L L L L N K N V I W K * V Y T G I * F F F F F F MboII | MboII | | MboII | | | MboII HphI | | | | MboII | TseI | | | | | AluI | |BisI | | | | | CviJI | ||BlsI | | | | | |MboII MnlI | ||| MaeIII SetI | | | | | ||SetI SetI |HgaI | ||| Tsp45I |BbvI \ \ \ \ \ \\\ \ \\ \ \\\ \ \\ GAAGAAGAGAGAAAGCTGAACCTCAATAGACCACAAAGAGCAGCGTCACCTGAAAGAAAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTCTCTCTTTCGACTTGGAGTTATCTGGTGTTTCTCGTCGCAGTGGACTTTCTTTC // / / // / / / / /// / / / || | | || | SetI MnlI | ||| | Tsp45I BbvI || | | || MboII | ||| | MaeIII || | | || CviJI | ||| SetI || | | || AluI | ||TseI || | | |SetI | |BisI || | | MboII | BlsI || | MboII HgaI || MboII HphI |MboII Ksp632I* E E E R K L N L N R P Q R A A S P E R K K K R E S * T S I D H K E Q R H L K E R R R E K A E P Q * T T K S S V T * K K G ----:----|----:----|----:----|----:----|----:----|----:----| S S S L F S F R L L G C L A A D G S L F L L L S F A S G * Y V V F L L T V Q F F F F L S L Q V E I S W L S C R * R F S L StyI SecI* | AsuI* | |BmgT120I | ||CviJI TspEI CviJI | ||HaeIII | MseI Hin4II* | BsaXI | |||MnlI \ \ \ \ \ \ \\\\ GAAAAGAAAATTAACTCAATGGAAGGCTACCATAAGAGAAACCAATCCTCCTTGGGCCTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTCTTTTAATTGAGTTACCTTCCGATGGTATTCTCTTTGGTTAGGAGGAACCCGGAG // / / / / /// || Hin4II* | BsaXI | ||BsaXI |MseI CviJI | |AsuI* TspEI | BmgT120I | HaeIII | CviJI | MnlI SecI* StyI E K K I N S M E G Y H K R N Q S S L G L K R K L T Q W K A T I R E T N P P W A S K E N * L N G R L P * E K P I L L G P H ----:----|----:----|----:----|----:----|----:----|----:----| S F F I L E I S P * W L L F W D E K P R P F S F * S L P L S G Y S F G I R R P G F L F N V * H F A V M L S V L G G Q A E MaeI |MnlI BsaXI || AluI | BsrI BsaXI || CviJI CviJI KasI | | MnlI | SetI || | SetI | BsaXI HgiCI* \ \ \ \ \ \\ \ \ \ \ \ ATACCAGTCGCTTCTGCTACCTCAAATACTAGCTCTCCTAAAAAGGCTCATAAAAGACAG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TATGGTCAGCGAAGACGATGGAGTTTATGATCGAGAGGATTTTTCCGAGTATTTTCTGTC / / / / //// // / | MnlI | SetI |||CviJI |CviJI HaeII BsrI BsaXI |||AluI BsaXI ||MaeI |SetI MnlI I P V A S A T S N T S S P K K A H K R Q Y Q S L L L P Q I L A L L K R L I K D R T S R F C Y L K Y * L S * K G S * K T G ----:----|----:----|----:----|----:----|----:----|----:----| M G T A E A V E F V L E G L F A * L L C * V L R K Q * R L Y * S E * F P E Y F V Y W D S R S G * I S A R R F L S M F S L AcyI NarI Hin6I |GlaI |DinI |NlaIV ||HhaI |||HaeII BseGI |||| TaqI | Hpy178III* MaeI |||| ClaI BccI | | FokI |FalI \\\\ \ \ \ \ \ \\ GCGCCATCGATGTTTTTGGATGATGTCCTGAATGGTAGAGAAATAATCTAG 910 920 930 940 950 ----:----|----:----|----:----|----:----|----:----|- CGCGGTAGCTACAAAAACCTACTACAGGACTTACCATCTCTTTATTAGATC //// / / / / / / / |||| | BccI BseGI | FokI FalI MaeI |||| ClaI Hpy178III* |||| TaqI |||HgiCI* |||KasI ||Hin6I ||NarI ||AcyI |NlaIV |DinI |GlaI HhaI A P S M F L D D V L N G R E I I * R H R C F W M M S * M V E K * S X A I D V F G * C P E W * R N N L X ----:----|----:----|----:----|----:----|----:----|- A G D I N K S S T R F P L S I I * P A M S T K P H H G S H Y L F L R R W R H K Q I I D Q I T S F Y D L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 2 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 1 DraI AluI 2 AluBI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BaeI 1 BamHI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BccI 4 BcgI 1 BdaI 2 BinI* 4 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmgT120I 1 BsaAI 1 BstBAI,Ppu21I BsaXI 2 BseGI 4 BstF5I,BtsCI BseRI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BsrDI 1 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssNAI 1 Bst1107I,BstZ17I BstKTI 3 BtrI 1 BmgBI,AjiI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CviJI 10 CviKI-1 CviRI* 2 HpyCH4V DinI 1 EgeI,EheI,SfoI DpnI 3 MalI Eco31I 1 Bso31I,BspTNI,BsaI EcoP15I 2 FalI 1 FokI 4 GlaI 1 HaeII 1 BstH2I HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 3 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 3 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 2 HpaI 1 KspAI HphI 2 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 2 Hpy99I 1 KasI 1 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 3 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 12 MnlI 8 MseI 4 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NarI 1 Mly113I NlaIV 4 BspLI,BmiI,PspN4I RsaI 2 AfaI SecI* 1 BseDI,BssECI,BsaJI SetI 11 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SnaBI 1 Eco105I,BstSNI SpeI 1 BcuI,AhlI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 1 TaqII 1 TatI 1 TauI 1 TfiI 2 PfeI TseI 3 ApeKI TsoI 2 Tsp45I 2 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 6 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI XbaI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvaI AvaII AvrII BalI BarI BbvCI BbvII* Bce83I* BceAI BciVI BclI BetI* BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaBI BseBI BseMII BsePI BseSI BseYI BsgI BsiI* BsmI Bsp120I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssKI Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BtgZI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI CspCI CviAII DdeI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRI EcoRII EcoRV EcoT22I Esp3I EspI* FatI FauI FnuDII* FseI FspAI GsaI GsuI HgiAI* HgiJII* HindIII HpaII MauBI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MstI* MvaI NaeI NcoI NdeI NgoMIV NheI NlaIII NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SexAI SfiI SgfI SgrAI SgrDI SmaI SmlI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I SwaI TspMI TstI Tth111I VspI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769