Restriction Map of KSH1/YNL024C-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

KSH1/YNL024C-A on chromosome XIV from coordinates 586820 to 586602.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.26670

EMBOSS_001 MseI |TspEI Ksp632I* MaeIII FatI CviRI* || MboII |CviRI* | TspDTI |CviAII \ \\ \ \\ \ \ \\ ATGTCTGCATTATTTAATTTTCGTTCTCTTCTGCAAGTGATATTGTTACTGATTTGTTCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGACGTAATAAATTAAAAGCAAGAGAAGACGTTCACTATAACAATGACTAAACAAGT / / // / / / / // CviRI* | |TspEI | Ksp632I* | MaeIII |TspDTI | MboII CviRI* TspDTI NlaIII MseI M S A L F N F R S L L Q V I L L L I C S C L H Y L I F V L F C K * Y C Y * F V H V C I I * F S F S S A S D I V T D L F M ----:----|----:----|----:----|----:----|----:----|----:----| X D A N N L K R E R R C T I N N S I Q E X T Q M I * N E N E E A L S I T V S K N H R C * K I K T R K Q L H Y Q * Q N T * BceAI | FatI | |CviAII BsmAI MnlI | || NlaIII Esp3I | FatI | || | CfrI | MaeI | BspHI | || | | CviJI | | MboI | |CviAII | || | | HaeIII | | | DpnI | |Hpy178III* TspDTI | || | | |BtsI | | | |BstKTI | || NlaIII |NlaIII | || | | |TspRI | | | ||MaeIII | || | SetI \\ \ \\ \ \ \\ \ \ \ \\\ \ \\ \ \ TGTTCTTATGTTCATGGGCAGTGGCCGTCTCTCCTAGATCGTTACAAAAATCATGAGGTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAGAATACAAGTACCCGTCACCGGCAGAGAGGATCTAGCAATGTTTTTAGTACTCCAA // // // // / /// / / / / // |FatI || |TspRI || CfrI ||| MboI | | | |BspHI CviAII || |FatI |HaeIII ||DpnI | | | |FatI || CviAII |CviJI |BstKTI | | | |SetI |NlaIII BtsI Esp3I | | | Hpy178III* BceAI BsmAI | | | CviAII MaeI | | NlaIII | MnlI MaeIII C S Y V H G Q W P S L L D R Y K N H E V V L M F M G S G R L S * I V T K I M R F F L C S W A V A V S P R S L Q K S * G F ----:----|----:----|----:----|----:----|----:----|----:----| H E * T * P C H G D R R S R * L F * S T M N K H E H A T A T E G L D N C F D H P T R I N M P L P R R E * I T V F I M L N AsuI* DraII |NlaIV |BmgT120I ||CviJI ||HaeIII ||| Hpy178III* ||| | Hin4II* ||| | | MaeII AsuI* ||| | | AflIII |BmgT120I ||| | | |PmaCI ||CviJI ||| | | |BsaAI ||HaeIII ||| | | || SetI |||BsrI BdaI ||| | | || TaiI |||| HphI NdeI BdaI \\\ \ \ \\ \ \\\\ \ \ \ TTGGGGGCCTTCTGGAAAATGGCACGTGTTGGTGAAAGGGCCAGTCCATATGTTAGTTTA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCCCGGAAGACCTTTTACCGTGCACAACCACTTTCCCGGTCAGGTATACAATCAAAT /// / / / // / //// / / ||DraII | | | || AflIII |||HphI NdeI BdaI ||AsuI* | | | |MaeII ||AsuI* BdaI || | | | BsaAI |BmgT120I || | | | PmaCI |HaeIII || | | TaiI |CviJI || | | SetI BsrI || | Hin4II* || Hpy178III* |BmgT120I |HaeIII |CviJI NlaIV L G A F W K M A R V G E R A S P Y V S L W G P S G K W H V L V K G P V H M L V * G G L L E N G T C W * K G Q S I C * F S ----:----|----:----|----:----|----:----|----:----|----:----| K P A K Q F I A R T P S L A L G Y T L K K P P R R S F P V H Q H F P W D M H * N Q P G E P F H C T N T F P G T W I N T * BdaI BdaI FatI CfrI |AluI |CviAII | BalI |CviJI || NspI | CviJI BccI |PvuII || NlaIII | BsaBI TspEI |NspBII* || |BccI | HaeIII | MseI || SetI \\ \\ \ \ \ \ \\ \ GCATGTATTTTGATGGCCATCAGTCAATTTAACAGCTGA 190 200 210 ----:----|----:----|----:----|----:---- CGTACATAAAACTACCGGTAGTCAGTTAAATTGTCGACT / // / / / / / /// / | || BccI | CfrI | | ||| NspBII* | |FatI HaeIII | | ||| PvuII | CviAII BsaBI | | ||| CviJI NlaIII CviJI | | ||| AluI NspI BalI | | ||SetI | | |BdaI | | |BdaI | | MseI | TspEI BccI A C I L M A I S Q F N S * H V F * W P S V N L T A X M Y F D G H Q S I * Q L X ----:----|----:----|----:----|----:---- A H I K I A M L * N L L Q L M Y K S P W * D I * C S C T N Q H G D T L K V A S # Enzymes that cut Frequency Isoschizomers AflIII 1 AluI 1 AluBI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I BalI 1 MlsI,MluNI,MscI,Msp20I BccI 2 BceAI 1 BdaI 2 BmgT120I 2 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsmAI 1 Alw26I,BstMAI BspHI 1 CciI,PagI,RcaI BsrI 1 BseNI,Bse1I,BsrSI BstKTI 1 BtsI 1 CfrI 2 AcoI,EaeI CviAII 4 CviJI 5 CviKI-1 CviRI* 2 HpyCH4V DpnI 1 MalI DraII 1 EcoO109I Esp3I 1 BsmBI FatI 4 HaeIII 4 BsnI,BsuRI,BshFI,PhoI Hin4II* 1 HpyAV HphI 1 AsuHPI Hpy178III* 2 Hpy188III Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 2 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 1 MnlI 1 MseI 2 Tru1I,Tru9I NdeI 1 FauNDI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 1 BstNSI,XceI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PvuII 1 SetI 3 TaiI 1 TspDTI 2 TspEI 2 TasI,Tsp509I,Sse9I TspRI 1 TscAI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BamHI BarI BbvCI BbvI BbvII* Bce83I* BcgI BciVI BclI BetI* BfiI BglI BglII BinI* BisI BlsI BmeT110I BmtI BplI Bpu10I BsaXI BseBI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI Cac8I CauII* Cfr10I Cfr9I ClaI Csp6I CspCI CviQI DdeI DinI DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI EspI* FalI FaqI FauI Fnu4HI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin6I HindII HindIII HinfI HinP1I HpaI HpaII Hpy166II Hpy188I Hpy8I Hpy99I HspAI KasI KpnI MauBI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PflMI PfoI PleI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaqI TaqII TatI TauI TfiI TseI TsoI Tsp45I Tsp4CI* TspGWI TspMI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769