Restriction Map of ADE4/YMR300C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ADE4/YMR300C on chromosome XIII from coordinates 867091 to 865559.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.8451

EMBOSS_001 AluI CviJI | SetI | BetI* | BspMII* | |HpaII | |Hpy178III* GsuI | || BccI SetI Eco57MI BsrI | || SfaNI \ \ \ \ \\ \ ATGTGTGGTATTTTAGGTATTGTATTAGCAAACCAAACCACTCCAGTAGCTCCGGAGTTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACACACCATAAAATCCATAACATAATCGTTTGGTTTGGTGAGGTCATCGAGGCCTCAAT / / / / / // / SetI Eco57MI BsrI | | || BccI GsuI | | |BspMII* | | |BetI* | | Hpy178III* | | HpaII | CviJI | AluI SetI M C G I L G I V L A N Q T T P V A P E L C V V F * V L Y * Q T K P L Q * L R S Y V W Y F R Y C I S K P N H S S S S G V M ----:----|----:----|----:----|----:----|----:----|----:----| X H P I K P I T N A F W V V G T A G S N X T H Y K L Y Q I L L G F W E L L E P T H T T N * T N Y * C V L G S W Y S R L * TseI CviRI* |BisI ||BlsI |||AluI |||CviJI |||PvuII |||NspBII* |||| SetI |||| | MwoI |||| | | AluI CviRI* |||| | | BbvI | BseGI |||| | | CviJI | EcoT22I SfaNI |||| | | | SetI | | FokI | Hpy166II |||| | | | | SetI \ \ \ \ \ \\\\ \ \ \ \ \ TGTGATGGATGCATTTTTCTACAACATCGTGGACAAGATGCAGCTGGTATAGCTACCTGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ACACTACCTACGTAAAAAGATGTTGTAGCACCTGTTCTACGTCGACCATATCGATGGACA / / / / / //// / / / / / SfaNI | CviRI* FokI Hpy166II |||| | | | | BbvI | BseGI SfaNI |||| | | | SetI EcoT22I |||| | | CviJI |||| | | AluI |||| | SetI |||| MwoI |||NspBII* |||PvuII |||CviJI |||TseI |||AluI ||BisI |BlsI |SetI CviRI* C D G C I F L Q H R G Q D A A G I A T C V M D A F F Y N I V D K M Q L V * L P V * W M H F S T T S W T R C S W Y S Y L W ----:----|----:----|----:----|----:----|----:----|----:----| H S P H M K R C C R P C S A A P I A V Q I H H I C K E V V D H V L H L Q Y L * R T I S A N K * L M T S L I C S T Y S G T CviJI |BsiI* || MaeIII || Tsp45I || Hpy178III* || | MaeII TfiI || | | SetI BsiI* HinfI SetI || | | TaiI \ \ \ \\ \ \ \ GGTTCTCGTGGTAGAATCTACCAATGTAAAGGTAATGGTATGGCTCGTGACGTATTTACC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAGAGCACCATCTTAGATGGTTACATTTCCATTACCATACCGAGCACTGCATAAATGG / / / / // // BsiI* HinfI SetI | || |MaeII TfiI | || Tsp45I | || MaeIII | |TaiI | |SetI | Hpy178III* | BsiI* CviJI G S R G R I Y Q C K G N G M A R D V F T V L V V E S T N V K V M V W L V T Y L P F S W * N L P M * R * W Y G S * R I Y P ----:----|----:----|----:----|----:----|----:----|----:----| P E R P L I * W H L P L P I A R S T N V H N E H Y F R G I Y L Y H Y P E H R I * T R T T S D V L T F T I T H S T V Y K G NlaIV | FatI MaeII | NcoI AflIII | StyI | SetI | SecI* EcoRV | TaiI | DsaI* | SfeI* | | BetI* | |CviAII | | MboII | | |HpaII | || NlaIII SmlI | | BbvII* \ \ \\ \ \\ \ \ \ \ \ CAACAACGTGTTTCCGGTCTTGCTGGTTCCATGGGTATTGCCCACTTGAGATATCCTACA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTTGCACAAAGGCCAGAACGACCAAGGTACCCATAACGGGTGAACTCTATAGGATGT / / / // / / // / / / / | | | |BetI* | | |DsaI* | EcoRV | SfeI* | | | HpaII | | |SecI* SmlI BsiYI* | | AflIII | | |StyI MboII | MaeII | | |NcoI TaiI | | |FatI SetI | | CviAII | NlaIII NlaIV Q Q R V S G L A G S M G I A H L R Y P T N N V F P V L L V P W V L P T * D I L Q T T C F R S C W F H G Y C P L E I S Y S ----:----|----:----|----:----|----:----|----:----|----:----| W C R T E P R A P E M P I A W K L Y G V G V V H K R D Q Q N W P Y Q G S S I D * L L T N G T K S T G H T N G V Q S I R C BssKI CviJI BsiYI* |HpaII ||ScrFI ||CauII* Hpy188I ||| Bce83I* | Hin6I MaeII ||| | CviJI | |GlaI | SetI Tsp4CI* ||| | | TspEI | ||HhaI | TaiI | MseI \\\ \ \ \ \ \\\ \ \ \ \ GCCGGGTCTTCGGCTAATTCAGAAGCGCAACCATTTTACGTCAATAGTCCTTACGGTATT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCCCAGAAGCCGATTAAGTCTTCGCGTTGGTAAAATGCAGTTATCAGGAATGCCATAA / // / / // /// / / / | || BssKI CviJI || ||Hin6I | MaeII Tsp4CI* | |Bce83I* || |GlaI TaiI | |CauII* || HhaI SetI | |HpaII |Hpy188I | |ScrFI TspEI | BbvII* CviJI A G S S A N S E A Q P F Y V N S P Y G I P G L R L I Q K R N H F T S I V L T V L R V F G * F R S A T I L R Q * S L R Y * ----:----|----:----|----:----|----:----|----:----|----:----| A P D E A L E S A C G N * T L L G * P I L R T K P * N L L A V M K R * Y D K R Y G P R R S I * F R L W K V D I T R V T N CviRI* | HphI | |Ksp632I* | || SfaNI MboII MaeIII | || | BdaI |TspDTI Tsp4CI* | || | BdaI || BseGI \ \ \\ \ \ \\ \ AACTTGGCACATAACGGTAACTTGGTGAATACTGCATCATTGAAGAGATATATGGATGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAACCGTGTATTGCCATTGAACCACTTATGACGTAGTAACTTCTCTATATACCTACTT / / / // / / / / / MseI | MaeIII |HphI | | SfaNI | BseGI Tsp4CI* | | BdaI TspDTI | | BdaI MboII | Ksp632I* CviRI* N L A H N G N L V N T A S L K R Y M D E T W H I T V T W * I L H H * R D I W M K L G T * R * L G E Y C I I E E I Y G * R ----:----|----:----|----:----|----:----|----:----|----:----| L K A C L P L K T F V A D N F L Y I S S * S P V Y R Y S P S Y Q M M S S I Y P H V Q C M V T V Q H I S C * Q L S I H I F XmnI MaeII | SetI | TaiI Tsp4CI* | BbvII* | TfiI | | FokI | HinfI | | | MboII | EcoP15I | | | |TspDTI | | TspRI | | | || MseI | | | Hpy188I TseI | | | || | BdaI | | | |TspGWI |BisI | | | || | BdaI | | | ||MaeIII BbvI SspI ||BlsI \ \ \ \\ \ \ \ \ \ \\\ \ \ \\\ GACGTTCATAGACATATTAACACGGACAGTGATTCGGAGTTACTATTGAATATTTTTGCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCAAGTATCTGTATAATTGTGCCTGTCACTAAGCCTCAATGATAACTTATAAAAACGA // / / / // / / /// / / / // || | | FokI |MseI | | ||Hpy188I | | SspI |BisI || | TspDTI BdaI | | ||TspGWI | BbvI BlsI || | BbvII* BdaI | | |HinfI MaeIII || | MboII | | |TfiI || MaeII | | EcoP15I |XmnI | Tsp4CI* TaiI TspRI SetI D V H R H I N T D S D S E L L L N I F A T F I D I L T R T V I R S Y Y * I F L L R S * T Y * H G Q * F G V T I E Y F C C ----:----|----:----|----:----|----:----|----:----|----:----| S T * L C I L V S L S E S N S N F I K A L R E Y V Y * C P C H N P T V I S Y K Q V N M S M N V R V T I R L * * Q I N K S MboII |MluI MseI |AflIII TatI |HpaI |TspDTI |Csp6I |HindII || Hin4II* BsrI ||RsaI |Hpy166II || FnuDII* \ \\\ \\ \\ \ GCTGAACTGGAAAAACATAACAAGTACAGAGTTAACAATGAAGATGTTTTCCACGCGTTA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTTGACCTTTTTGTATTGTTCATGTCTCAATTGTTACTTCTACAAAAGGTGCGCAAT / / /// // / // / TseI BsrI ||TatI |MseI | || AflIII |Csp6I Hpy166II | || MluI RsaI HindII | |FnuDII* HpaI | Hin4II* TspDTI MboII A E L E K H N K Y R V N N E D V F H A L L N W K N I T S T E L T M K M F S T R * * T G K T * Q V Q S * Q * R C F P R V R ----:----|----:----|----:----|----:----|----:----|----:----| A S S S F C L L Y L T L L S S T K W A N Q Q V P F V Y C T C L * C H L H K G R T S F Q F F M V L V S N V I F I N E V R * BceAI Hpy166II |SetI SecI* | Cfr10I || Hpy166II DsaI* | |HpaII || | Tsp4CI* | AciI Cac8I | || MwoI \\ \ \ \ \ \ \ \\ \ GAAGGTGTTTACCGTTTATGCCGTGGCGGTTATGCTTGCGTTGGTTTACTTGCCGGTTTT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCCACAAATGGCAAATACGGCACCGCCAATACGAACGCAACCAAATGAACGGCCAAAA / / / / / / / / // SetI | | Tsp4CI* | AciI Cac8I Hpy166II |Cfr10I | Hpy166II DsaI* HpaII BceAI SecI* MwoI E G V Y R L C R G G Y A C V G L L A G F K V F T V Y A V A V M L A L V Y L P V L R C L P F M P W R L C L R W F T C R F C ----:----|----:----|----:----|----:----|----:----|----:----| S P T * R K H R P P * A Q T P K S A P K L L H K G N I G H R N H K R Q N V Q R N F T N V T * A T A T I S A N T * K G T K BinI* | Hpy188I | | MboI | | XhoII | | | DpnI CviJI CviRI* | | | |BstKTI HaeIII \ \ \ \ \\ \ GCATTATTTGGTTTCAGAGATCCAAATGGTATTAGGCCATTATTGTTCGGTGAAAGAGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAATAAACCAAAGTCTCTAGGTTTACCATAATCCGGTAATAACAAGCCACTTTCTCTT / // // / / / CviRI* || || XhoII HaeIII HphI || || MboI CviJI || |DpnI || BstKTI |Hpy188I BinI* A L F G F R D P N G I R P L L F G E R E H Y L V S E I Q M V L G H Y C S V K E K I I W F Q R S K W Y * A I I V R * K R K ----:----|----:----|----:----|----:----|----:----|----:----| A N N P K L S G F P I L G N N N P S L S Q M I Q N * L D L H Y * A M I T R H F L C * K T E S I W I T N P W * Q E T F S F HphI | BetI* | BspMII* | |HpaII | |Hpy178III* | || DdeI AluI | || | Eco57I CviJI AluI | || | Eco57MI | SetI CviJI | || | | BceAI | | Hpy188I | SetI \ \\ \ \ \ \ \ \ \ \ AATCCGGACGGCACTAAGGACTATATGTTAGCTTCAGAAAGTGTTGTTTTCAAAGCTCAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGGCCTGCCGTGATTCCTGATATACAATCGAAGTCTTTCACAACAAAAGTTTCGAGTG // / / / / / / / / |BspMII* | DdeI | | | Hpy188I | CviJI |BetI* Eco57MI | | CviJI | AluI | Eco57I | | AluI SetI Hpy178III* | SetI HpaII BceAI N P D G T K D Y M L A S E S V V F K A H I R T A L R T I C * L Q K V L F S K L T S G R H * G L Y V S F R K C C F Q S S Q ----:----|----:----|----:----|----:----|----:----|----:----| F G S P V L S * I N A E S L T T K L A * F D P R C * P S Y T L K L F H Q K * L E I R V A S L V I H * S * F T N N E F S V MnlI BssKI CviJI MaeIII EcoRII Tsp45I | ScrFI Hpy178III* | BseBI SfeI* | MseI | | FokI BseGI DdeI |Tsp4CI* \ \ \ \ \ \ \ \\ AACTTTACTAAATATCGTGACTTAAAGCCTGGCGAGGCAGTTATCATCCCTAAGAACTGT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAAATGATTTATAGCACTGAATTTCGGACCGCTCCGTCAATAGTAGGGATTCTTGACA / / / // / / / / / / | | | || | | FokI BseGI | Tsp4CI* | | | || | EcoRII DdeI | | | || | BssKI | | | || BseBI | | | || ScrFI | | | |CviJI | | | MnlI | | MseI | Tsp45I | MaeIII Hpy178III* N F T K Y R D L K P G E A V I I P K N C T L L N I V T * S L A R Q L S S L R T V L Y * I S * L K A W R G S Y H P * E L * ----:----|----:----|----:----|----:----|----:----|----:----| L K V L Y R S K F G P S A T I M G L F Q C S * * I D H S L A Q R P L * * G * S S V K S F I T V * L R A L C N D D R L V T BseMII |BspCNI || SetI || |Hpy166II || || DdeI || || |SetI || || || HphI NlaIV MseI SetI \\ \\ \\ \ \ \ \ AGCAAAGGTGAACCTGAGTTCAAACAAGTGGTTCCTATTAACTCTTATAGACCTGATTTA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTTTCCACTTGGACTCAAGTTTGTTCACCAAGGATAATTGAGAATATCTGGACTAAAT / /// // // / / / | ||SetI |SetI |HphI NlaIV MseI SetI | || | DdeI | || Hpy166II | |BspCNI | BseMII SfeI* S K G E P E F K Q V V P I N S Y R P D L A K V N L S S N K W F L L T L I D L I Y Q R * T * V Q T S G S Y * L L * T * F I ----:----|----:----|----:----|----:----|----:----|----:----| L L P S G S N L C T T G I L E * L G S K Y C L H V Q T * V L P E * * S K Y V Q N A F T F R L E F L H N R N V R I S R I * Hin4I MaeII Hin4I |BsaAI Tsp4CI* |SnaBI Tth111I || SetI BetI* | BccI || TaiI |HpaII | | TspRI BseGI FokI TsoI \\ \ \\ \ \ \ \ \ \ TTTGAATACGTATATTTCGCCAGACCGGACAGTGTCTTGGATGGAATATCAGTTTATCAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTTATGCATATAAAGCGGTCTGGCCTGTCACAGAACCTACCTTATAGTCAAATAGTG / // /// / / / / / / | |MaeII ||| | | BccI BseGI | Hin4I | SnaBI ||| | Tth111I | Hin4I | BsaAI ||| Tsp4CI* FokI TaiI ||BetI* TsoI SetI |HpaII |TspRI Hin4I Hin4I F E Y V Y F A R P D S V L D G I S V Y H L N T Y I S P D R T V S W M E Y Q F I T * I R I F R Q T G Q C L G W N I S L S H ----:----|----:----|----:----|----:----|----:----|----:----| N S Y T Y K A L G S L T K S P I D T * * I Q I R I N R W V P C H R P H F I L K D K F V Y I E G S R V T D Q I S Y * N I V Hin4I XmnI MwoI Hin4I CviJI TspEI AciI |SspI | CviJI \ \ \ \ \\ \ \ ACAAGATTGGCTATGGGTTCTAAATTAGCGGAAAATATTCTAAAGCAACTGAAGCCAGAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTCTAACCGATACCCAAGATTTAATCGCCTTTTATAAGATTTCGTTGACTTCGGTCTT / / / // / / CviJI | AciI |SspI MwoI CviJI TspEI XmnI T R L A M G S K L A E N I L K Q L K P E Q D W L W V L N * R K I F * S N * S Q K K I G Y G F * I S G K Y S K A T E A R R ----:----|----:----|----:----|----:----|----:----|----:----| V L N A I P E L N A S F I R F C S F G S C L I P * P N * I L P F Y E L A V S A L C S Q S H T R F * R F I N * L L Q L W F AlwNI | CviRI* | | FatI | | AflIII | | BspLU11I* | | |CviAII | | || NspI | | || ApaLI | | || NlaIII | | || | CviRI* | | || | Hpy166II | | || | | SduI BslFI | | || | | BseSI | MboII | | || | | HgiAI* | Eco57I | | || | | |MaeI | Eco57MI | | || | | || MslI \ \ \ \ \\ \ \ \\ \ GATATTGATGTTGTTATTCCCGTCCCAGATACTGCAAGAACATGTGCACTAGAATGTGCT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAACTACAACAATAAGGGCAGGGTCTATGACGTTCTTGTACACGTGATCTTACACGA // / / / / // / / / || BslFI AlwNI | | || | | MslI |MboII | | || | | MaeI Eco57MI | | || | ApaLI Eco57I | | || Hpy166II | | || CviRI* | | |BspLU11I* | | |AflIII | | |HgiAI* | | |BseSI | | |FatI | | |SduI | | CviAII | NlaIII | NspI CviRI* D I D V V I P V P D T A R T C A L E C A I L M L L F P S Q I L Q E H V H * N V L Y * C C Y S R P R Y C K N M C T R M C * ----:----|----:----|----:----|----:----|----:----|----:----| S I S T T I G T G S V A L V H A S S H A L Y Q H Q * E R G L Y Q L F M H V L I H I N I N N N G D W I S C S C T C * F T S MaeII |BsaAI CviJI || SetI | MnlI CviJI MseI || TaiI \ \ \ \ \\ \ AATGTGTTAGGGAAGCCTTATAGAGAGGGCTTTGTTAAAAACAGATACGTGGGCAGGACA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTACACAATCCCTTCGGAATATCTCTCCCGAAACAATTTTTGTCTATGCACCCGTCCTGT / / / / / // | MnlI CviJI MseI | |MaeII CviJI | BsaAI TaiI SetI N V L G K P Y R E G F V K N R Y V G R T M C * G S L I E R A L L K T D T W A G H C V R E A L * R G L C * K Q I R G Q D I ----:----|----:----|----:----|----:----|----:----|----:----| L T N P F G * L S P K T L F L Y T P L V * H T L S A K Y L P S Q * F C I R P C S I H * P L R I S L A K N F V S V H A P C FatI |CviAII || NlaIII HindIII || | MnlI |FalI || | | FalI |FalI || | | FalI ||AluI || | | | Eco57I ||CviJI || | | | Eco57MI ||| MseI || | | | | MboII MnlI ||| SetI \\ \ \ \ \ \ \ \\\ \ TTTATCATGCCAAACCAGAGGGAAAGGGTTTCTTCAGTAAGGAGGAAGCTTAACCCTATG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AAATAGTACGGTTTGGTCTCCCTTTCCCAAAGAAGTCATTCCTCCTTCGAATTGGGATAC / /// / / / / / / / / | ||MnlI | MboII MnlI | | | | MseI | ||FalI Eco57MI | | | HindIII | ||FalI Eco57I | | CviJI | |FatI | | AluI | CviAII | SetI NlaIII FalI FalI F I M P N Q R E R V S S V R R K L N P M L S C Q T R G K G F L Q * G G S L T L W Y H A K P E G K G F F S K E E A * P Y G ----:----|----:----|----:----|----:----|----:----|----:----| N I M G F W L S L T E E T L L F S L G I M * * A L G S P F P K K L L S S A * G * K D H W V L P F P N R * Y P P L K V R H TfiI HinfI HinfI | Hpy188I | BseGI | |ApoI | | MnlI | |TspEI | | | FokI | || PleI | | | | Hpy188I | || |MlyI | | | | | Csp6I | || ||MseI SetI | | | | | |RsaI | || ||| Hin4II* | Hpy188I | | | | | |SetI \ \\ \\\ \ \ \ \ \ \ \ \ \\ GAGTCTGAATTTAAGGGTAAGAAGGTTCTGATAGTGGATGATTCTATTGTCAGAGGTACT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAGACTTAAATTCCCATTCTTCCAAGACTATCACCTACTAAGATAACAGTCTCCATGA // // // / / / / / / / // || || |Hin4II* SetI Hpy188I | | MnlI | | |Csp6I || || MseI | HinfI | | RsaI || |TspEI | TfiI | FokI || |ApoI BseGI | SetI || PleI Hpy188I || MlyI |Hpy188I HinfI E S E F K G K K V L I V D D S I V R G T S L N L R V R R F * * W M I L L S E V L V * I * G * E G S D S G * F Y C Q R Y Y ----:----|----:----|----:----|----:----|----:----|----:----| S D S N L P L F T R I T S S E I T L P V P T Q I * P Y S P E S L P H N * Q * L Y L R F K L T L L N Q Y H I I R N D S T S MseI |HpaI |HindII |Hpy166II || FatI || |CviAII || || CfrI || || |NlaIII || || ||BalI || || ||CviJI || || ||HaeIII || || |||StyI || || |||SecI* || || |||| TfiI || || |||| HinfI || || |||| | BetI* || || |||| | |HpaII || || |||| | || FalI || || |||| | || FalI || || |||| | || | CviRI* || || |||| | || | | Eco57I || || |||| | || | | Eco57MI || || |||| | || | | | SetI || || |||| | || | | | |BbvI || || |||| | || | | | |Hpy166II \\ \\ \\\\ \ \\ \ \ \ \\ ACTTCAAAAGAGATTGTTAACATGGCCAAGGAATCCGGTGCAACAAAGGTTTACTTCGCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGTTTTCTCTAACAATTGTACCGGTTCCTTAGGCCACGTTGTTTCCAAATGAAGCGA /// /// / / / / // / / / / / ||| ||| | | | | || | | SetI | BbvI ||| ||| | | | | || | Eco57MI Hpy166II ||| ||| | | | | || | Eco57I ||| ||| | | | | || CviRI* ||| ||| | | | | |BetI* ||| ||| | | | | HpaII ||| ||| | | | HinfI ||| ||| | | | TfiI ||| ||| | | FalI ||| ||| | | FalI ||| ||| | SecI* ||| ||| | StyI ||| ||| CfrI ||| ||HaeIII ||| ||CviJI ||| ||BalI ||| |FatI ||| CviAII ||NlaIII |MseI Hpy166II HindII HpaI T S K E I V N M A K E S G A T K V Y F A L Q K R L L T W P R N P V Q Q R F T S L F K R D C * H G Q G I R C N K G L L R F ----:----|----:----|----:----|----:----|----:----|----:----| V E F S I T L M A L S D P A V F T * K A * K L L S Q * C P W P I R H L L P K S R S * F L N N V H G L F G T C C L N V E S TseI AluI MwoI CviJI PvuII NspBII* |BisI ||BlsI ||SetI ||| FalI ||| FalI ||| BseYI ||| |MwoI ||| || GsaI MslI ||| || CviJI MaeIII | BstXI MseI \\\ \\ \ \ \ \ \ TCAGCTGCCCCAGCCATTCGTTACAACCATATTTATGGTATTGACTTAACAGACACAAAG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCGACGGGGTCGGTAAGCAATGTTGGTATAAATACCATAACTGAATTGTCTGTGTTTC // //// / / / / / / || |||| | BseYI | | MslI MseI || |||| | CviJI | BstXI || |||| GsaI MaeIII || |||MwoI || |||TseI || ||BisI || |BlsI || NspBII* || PvuII || CviJI || FalI || FalI || AluI |SetI MwoI S A A P A I R Y N H I Y G I D L T D T K Q L P Q P F V T T I F M V L T * Q T Q R S C P S H S L Q P Y L W Y * L N R H K E ----:----|----:----|----:----|----:----|----:----|----:----| E A A G A M R * L W I * P I S K V S V F K L Q G L W E N C G Y K H Y Q S L L C L * S G W G N T V V M N I T N V * C V C L AciI | MboII PsiI | |TspDTI EciI HinfI \ \ \\ \ \ AACTTGATTGCTTATAACAGAACCGATGAAGAAGTGGCGGAAGTAATCGGTTGTGAAAGA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAACTAACGAATATTGTCTTGGCTACTTCTTCACCGCCTTCATTAGCCAACACTTTCT / / / PsiI TspDTI EciI MboII AciI N L I A Y N R T D E E V A E V I G C E R T * L L I T E P M K K W R K * S V V K E L D C L * Q N R * R S G G S N R L * K S ----:----|----:----|----:----|----:----|----:----|----:----| F K I A * L L V S S S T A S T I P Q S L S S S Q K Y C F R H L L P P L L R N H F V Q N S I V S G I F F H R F Y D T T F S PleI PflMI ApoI |MlyI BsiYI* MboII TspEI \\ \ \ \ GTCATTTACCAATCATTGGAAGATTTGATTGATTGTTGTAAAACTGATAAAATAACCAAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTAAATGGTTAGTAACCTTCTAAACTAACTAACAACATTTTGACTATTTTATTGGTTT / / / / HinfI | BsiYI* MboII | PflMI PleI MlyI V I Y Q S L E D L I D C C K T D K I T K S F T N H W K I * L I V V K L I K * P N H L P I I G R F D * L L * N * * N N Q I ----:----|----:----|----:----|----:----|----:----|----:----| T M * W D N S S K I S Q Q L V S L I V L L * K G I M P L N S Q N N Y F Q Y F L W D N V L * Q F I Q N I T T F S I F Y G F MboII Tsp4CI* BccI | BetI* |BbvII* |TaqI | |HpaII MaeIII BsrI || MboII |AsuII TsoI | || TspEI Tsp45I TspRI || | Hpy178III* \\ \ \ \\ \ \ \ \\ \ \ TTCGAAGATGGTGTATTTACCGGAAATTATGTCACTGGTGTTGAAGACGGTTATATTCAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTTCTACCACATAAATGGCCTTTAATACAGTGACCACAACTTCTGCCAATATAAGTT / / / / // / / / / / / / | | TsoI MboII || | | | BsrI | | Hpy178III* | AsuII || | | Tsp45I | BbvII* | TaqI || | | MaeIII | MboII TspEI || | TspRI Tsp4CI* ApoI || TspEI BccI |BetI* HpaII F E D G V F T G N Y V T G V E D G Y I Q S K M V Y L P E I M S L V L K T V I F K R R W C I Y R K L C H W C * R R L Y S R ----:----|----:----|----:----|----:----|----:----|----:----| N S S P T N V P F * T V P T S S P * I * I R L H H I * R F N H * Q H Q L R N Y E E F I T Y K G S I I D S T N F V T I N L MaeII | SetI | TaiI | |TfiI | |HinfI | |MboII | || TaqI | || ClaI | || |MboI | || || DpnI | || || |PvuI | || || |McrI* | || || |TspDTI Hin4II* TspEI | || || |BstKTI TspEI Hpy188I CviJI TaqI \ \ \\ \\ \\ \ \ \ \ GAATTGGAAGAAAAACGTGAATCGATCGCAAATAATTCATCAGATATGAAGGCTGAAGTC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAACCTTCTTTTTGCACTTAGCTAGCGTTTATTAAGTAGTCTATACTTCCGACTTCAG / / // / // / / / / / TspEI | || | || MboI | Hpy188I CviJI TspDTI | || | |DpnI | Hin4II* | || | BstKTI TspEI | || | TspDTI | || | McrI* | || | ClaI | || | TaqI | || | PvuI | || HinfI | || TfiI | |MboII | MaeII TaiI SetI E L E E K R E S I A N N S S D M K A E V N W K K N V N R S Q I I H Q I * R L K S I G R K T * I D R K * F I R Y E G * S R ----:----|----:----|----:----|----:----|----:----|----:----| S N S S F R S D I A F L E D S I F A S T L I P L F V H I S R L Y N M L Y S P Q L F Q F F F T F R D C I I * * I H L S F D TspDTI | EcoRV | | Hpy188I | | | Eco57I | | | Eco57MI | | | |TspEI CviRI* \ \ \ \\ \ GATATCGGATTATATAATTGTGCAGATTATTGA 1510 1520 1530 ----:----|----:----|----:----|--- CTATAGCCTAATATATTAACACGTCTAATAACT / / / / / / | | | | | CviRI* | | | | TspEI | | | Eco57MI | | | Eco57I | | Hpy188I | EcoRV TaqI D I G L Y N C A D Y * I S D Y I I V Q I I X Y R I I * L C R L L X ----:----|----:----|----:----|--- S I P N Y L Q A S * Q R Y R I I Y N H L N N I D S * I I T C I I S # Enzymes that cut Frequency Isoschizomers AciI 3 BspACI,SsiI AflIII 3 AluI 7 AluBI AlwNI 1 CaiI ApaLI 1 Alw44I,VneI ApoI 2 AcsI,XapI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 1 BpuEI BceAI 2 BdaI 2 BetI* 6 BsaWI BinI* 1 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BsaAI 2 BstBAI,Ppu21I BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 1 BseSI 1 BaeGI,BstSLI BseYI 1 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BspCNI 1 BspLU11I* 1 PscI,PciI BspMII* 2 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 3 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 2 BstXI 1 Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CviAII 4 CviJI 19 CviKI-1 CviRI* 8 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 2 MalI DsaI* 2 BtgI,BstDSI EciI 1 Eco57I 5 AcuI Eco57MI 6 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 2 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 4 FatI 4 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 GlaI 1 GsaI 1 GsuI 1 BpmI HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 3 HpyAV Hin6I 1 HinP1I,HspAI HindII 2 HincII HindIII 1 HinfI 7 HpaI 2 KspAI HpaII 8 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 9 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 6 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 11 McrI* 1 BsiEI,BstMCI,Bsh1285I MluI 1 MlyI 2 SchI MnlI 5 MseI 10 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 2 PpsI PsiI 1 AanI PvuI 1 MvrI,Ple19I,BpvUI PvuII 2 RsaI 2 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 24 SfaNI 3 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI SnaBI 1 Eco105I,BstSNI SspI 2 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 7 TaqI 3 TatI 1 TfiI 5 PfeI TseI 3 ApeKI TsoI 2 Tsp45I 3 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 6 TspEI 8 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI Tth111I 1 PflFI,PsyI,AspI XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AgeI AhaIII* AjuI AlfI AloI ApaI AscI Asp718I AsuI* AvaI AvaII AvrII BaeI BamHI BarI BbvCI BcgI BciVI BclI BfiI BglI BglII BmeT110I BmgT120I BmtI BplI Bpu10I BsaBI BsaXI BsePI BseRI BsgI BsmAI BsmI Bsp120I Bsp1407I BspHI BspMI BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtrI BtsI Cfr9I CspCI DinI DraII DraIII DrdI Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EgeI EheI Esp3I EspI* FauI FseI FspAI HaeII HgaI HgiCI* HgiJII* Hpy99I KasI KpnI MauBI MfeI MmeI MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TauI TspMI TstI VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769