Restriction Map of SAP30/YMR263W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SAP30/YMR263W on chromosome XIII from coordinates 794919 to 795524.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.25917

CviJI MnlI |MaeI TfiI || CviJI HinfI || HaeIII | TaqI TsoI || |BsrI | |Hpy178III* DdeI || || MseI | || TspGWI | BsiYI* \\ \\ \ \ \\ \ \ \ ATGGCTAGGCCAGTTAATACAAACGCTGAAACGGAATCGAGAGGCAGACCCACTCAGGGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGATCCGGTCAATTATGTTTGCGACTTTGCCTTAGCTCTCCGTCTGGGTGAGTCCCA / /// / / / // / // / | ||HaeIII MseI | | || TspGWI || DdeI | ||CviJI | | |Hpy178III* |BsiYI* | |BsrI | | TaqI TsoI | MaeI | HinfI CviJI | TfiI MnlI M A R P V N T N A E T E S R G R P T Q G W L G Q L I Q T L K R N R E A D P L R V G * A S * Y K R * N G I E R Q T H S G W ----:----|----:----|----:----|----:----|----:----|----:----| X A L G T L V F A S V S D L P L G V * P X P * A L * Y L R Q F P I S L C V W E P H S P W N I C V S F R F R S A S G S L T TseI |BisI ||BlsI |||AluI |||CviJI MaeIII |||PvuII | BspCNI |||NspBII* TseI | |BseMII |||| SetI |BisI | || MaeIII |||| MaeIII BbvI ||BlsI BbvI \ \\ \ \\\\ \ \ \\\ \ GGTGGTTACGCAAGTAACAACAATGGCAGCTGTAACAACAACAATGGCAGCAATAATAAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCAATGCGTTCATTGTTGTTACCGTCGACATTGTTGTTGTTACCGTCGTTATTATTG // / / /// / / /// || MaeIII MaeIII ||| | BbvI ||TseI |BseMII ||| MaeIII |BisI BspCNI ||NspBII* BlsI ||PvuII ||CviJI ||TseI ||AluI |BisI BlsI SetI G G Y A S N N N G S C N N N N G S N N N V V T Q V T T M A A V T T T M A A I I T W L R K * Q Q W Q L * Q Q Q W Q Q * * Q ----:----|----:----|----:----|----:----|----:----|----:----| P P * A L L L L P L Q L L L L P L L L L H H N R L Y C C H C S Y C C C H C C Y Y T T V C T V V I A A T V V V I A A I I V GsuI Eco57MI | AsuI* | |BmgT120I | ||CviJI MwoI | ||HaeIII \ \ \\\ AATAATAACAATAATAATAATAATAATAACAGCAATAACAGCAATAACAATAACGGGCCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTATTGTTATTATTATTATTATTATTGTCGTTATTGTCGTTATTGTTATTGCCCGGA / / / // / BbvI MwoI Eco57MI || SetI GsuI |AsuI* BmgT120I HaeIII CviJI N N N N N N N N N N S N N S N N N N G P I I T I I I I I I T A I T A I T I T G L * * Q * * * * * * Q Q * Q Q * Q * R A Y ----:----|----:----|----:----|----:----|----:----|----:----| L L L L L L L L L L L L L L L L L L P G C Y Y C Y Y Y Y Y Y C C Y C C Y C Y R A I I V I I I I I I V A I V A I V I V P R TseI AluI CviJI FauI PvuII | SetI NspBII* | | AciI BsgI |BisI TatI | | BsiYI* MlyI ||BlsI |Csp6I | | NspBII* PleI ||SetI ||RsaI | | | MnlI |BbvI HinfI |||CviRI* ||| MseI \ \ \ \ \\ \ \\\\ \\\ \ ACCTCCAGCGGGAGAACCAATGGGAAGCAAAGACTCACAGCTGCACAACAGCAGTACATT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAGGTCGCCCTCTTGGTTACCCTTCGTTTCTGAGTGTCGACGTGTTGTCGTCATGTAA / / / // / // / / / //// /// | | | |MnlI | || | | | |||CviRI* ||TatI | | | AciI | || | | | |||TseI |Csp6I | | NspBII* | || | | | ||BisI RsaI | BsiYI* | || | | | |BlsI FauI | || | | | NspBII* | || | | | PvuII | || | | | CviJI | || | | | AluI | || | | SetI | || | HinfI | || BbvI | |PleI | MlyI BsgI T S S G R T N G K Q R L T A A Q Q Q Y I P P A G E P M G S K D S Q L H N S S T L L Q R E N Q W E A K T H S C T T A V H * ----:----|----:----|----:----|----:----|----:----|----:----| V E L P L V L P F C L S V A A C C C Y M * R W R S F W H S A F V * L Q V V A T C G G A P S G I P L L S E C S C L L L V N MboI | DpnI | |BstKTI | || Hin6I TfiI | || |GlaI HinfI HinfI HphI | || ||HhaI |MaeIII | BsmAI | EcoP15I | || ||| HphI |Tsp45I \ \ \ \ \ \\ \\\ \ \\ AAGAATCTCATAGAGACACATATCACCGACAACCACCCTGATCTGCGCCCCAAGAGTCAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTAGAGTATCTCTGTGTATAGTGGCTGTTGGTGGGACTAGACGCGGGGTTCTCAGTG / / / / / // / //// / / MseI | | HphI EcoP15I || | |||HphI | Tsp45I | BsmAI || | ||Hin6I | MaeIII HinfI || | |GlaI HinfI TfiI || | HhaI || MboI |DpnI BstKTI K N L I E T H I T D N H P D L R P K S H R I S * R H I S P T T T L I C A P R V T E S H R D T Y H R Q P P * S A P Q E S P ----:----|----:----|----:----|----:----|----:----|----:----| L F R M S V C I V S L W G S R R G L L * * S D * L S V Y * R C G G Q D A G W S D L I E Y L C M D G V V V R I Q A G L T V Ksp632I* | TaqI | AsuII | | TaqII | | |SfaNI | | || AccI | | || |BssNAI | | || |Hpy166II | | || || MboII | | || || BseMII | | || || |BspCNI | | || || || BseGI | | || || || | Hin4II* | | || || || | |Hpy178III* | | || || || | ||DdeI | | || || || | ||| FokI PleI | | || || || | ||| TspGWI MfeI |MlyI | | || || || | ||| | SetI TspEI \\ \ \ \\ \\ \\ \ \\\ \ \ \ CCAATGGATTTCGAAGAGTATACGGATGCGTTCCTGAGAAGGTATAAAGACCACTTTCAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTACCTAAAGCTTCTCATATGCCTACGCAAGGACTCTTCCATATTTCTGGTGAAAGTT / /// /// // / / / / / / PleI ||AsuII ||| || | | | | | FokI MlyI ||TaqI ||| || | | | | SetI |TaqII ||| || | | | DdeI | ||| || | | Hpy178III* | ||| || | | TspGWI | ||| || | Hin4II* | ||| || BseGI | ||| |BspCNI | ||| |MboII | ||| BseMII | ||AccI | |Hpy166II | |BssNAI | SfaNI Ksp632I* P M D F E E Y T D A F L R R Y K D H F Q Q W I S K S I R M R S * E G I K T T F N N G F R R V Y G C V P E K V * R P L S I ----:----|----:----|----:----|----:----|----:----|----:----| G I S K S S Y V S A N R L L Y L S W K * G L P N R L T Y P H T G S F T Y L G S E W H I E F L I R I R E Q S P I F V V K L SetI MaeII | TseI | Csp6I | |BisI | |RsaI | |BciVI | |SetI | |SfeI* Hin6I | |TaiI | ||BlsI |GlaI | ||BetI* | |||CviRI* ||HhaI | |||HpaII | |||| PstI NlaIV ||FnuDII* | ||||BbvI | |||| |HgaI | TspEI |||TspDTI \ \\\\\ \ \\\\ \\ \ \ \\\\ TTGGACGTACCGGACAACCTGACGCTGCAGGGATACTTATTGGGTTCCAAATTGGGCGCG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTGCATGGCCTGTTGGACTGCGACGTCCCTATGAATAACCCAAGGTTTAACCCGCGC / / /// // // //// / / / / /// | | ||| || |SetI |||| SfeI* HgaI NlaIV | ||FnuDII* | | ||| || BbvI |||CviRI* | ||Hin6I | | ||| |BetI* |||TseI | |TspDTI | | ||| HpaII ||BisI | |GlaI | | ||Csp6I |BlsI | HhaI | | |RsaI |PstI TspEI | | MaeII BciVI | TaiI | SetI TspEI MfeI L D V P D N L T L Q G Y L L G S K L G A W T Y R T T * R C R D T Y W V P N W A R G R T G Q P D A A G I L I G F Q I G R E ----:----|----:----|----:----|----:----|----:----|----:----| N S T G S L R V S C P Y K N P E L N P A I P R V P C G S A A P I S I P N W I P R Q V Y R V V Q R Q L S V * Q T G F Q A R BbvII* TseI | MnlI |BisI BciVI BsmAI | |MboII ||BlsI | BbvI Eco31I \ \\ \\\ \ \ \ AAGACTTATTCATACAAGAGGAACACACAGGGGCAGCACGATAAAAGGATACATAAGAGA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTGAATAAGTATGTTCTCCTTGTGTGTCCCCGTCGTGCTATTTTCCTATGTATTCTCT // /// / / / |BbvII* ||| BciVI BbvI Eco31I |MboII ||TseI BsmAI MnlI |BisI BlsI K T Y S Y K R N T Q G Q H D K R I H K R R L I H T R G T H R G S T I K G Y I R E D L F I Q E E H T G A A R * K D T * E R ----:----|----:----|----:----|----:----|----:----|----:----| F V * E Y L L F V C P C C S L L I C L L S S K N M C S S C V P A A R Y F S V Y S L S I * V L P V C L P L V I F P Y M L S BssKI EcoRII | ScrFI | BseBI | |CfrI | |SetI | || BalI | || CviJI | || HaeIII | || | MaeII | || | | SetI HphI | || | | TaiI | TaqI BsmAI | || | | Hin4II* | MslI BsmI |MseI CviRI* \ \\ \ \ \ \ \ \ \\ \ GACCTGGCCAACGTGGTGAGAAGGCATTTCGATGAGCATTCCATTAAAGAGACAGATTGC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGACCGGTTGCACCACTCTTCCGTAAAGCTACTCGTAAGGTAATTTCTCTGTCTAACG / / / // / / / / / // / | | | || Hin4II* | | | BsmI |BsmAI CviRI* | | | || MaeII | | TaqI MseI | | | |TaiI | MslI | | | |SetI HphI | | | CfrI | | EcoRII | | HaeIII | | BssKI | | CviJI | | BalI | BseBI | ScrFI SetI D L A N V V R R H F D E H S I K E T D C T W P T W * E G I S M S I P L K R Q I A P G Q R G E K A F R * A F H * R D R L H ----:----|----:----|----:----|----:----|----:----|----:----| S R A L T T L L C K S S C E M L S V S Q L G P W R P S F A N R H A N W * L S L N V Q G V H H S P M E I L M G N F L C I A ApoI XmnI TspEI | BccI | | MboII | | Hpy178III* | | | MboII AciI | | | | ApoI | TspEI SetI | | | | TspEI \ \ \ \ \ \ \ \ ATACCGCAATTTATATACAAGGTAAAAAACCAGAAGAAGAAATTCAAGATGGAATTTCGG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TATGGCGTTAAATATATGTTCCATTTTTTGGTCTTCTTCTTTAAGTTCTACCTTAAAGCC / / / / // / / AciI TspEI SetI | || | TspEI | || | ApoI | || Hpy178III* | || MboII | |MboII | |TspEI | |ApoI | BccI XmnI I P Q F I Y K V K N Q K K K F K M E F R Y R N L Y T R * K T R R R N S R W N F G T A I Y I Q G K K P E E E I Q D G I S G ----:----|----:----|----:----|----:----|----:----|----:----| M G C N I Y L T F F W F F F N L I S N R C V A I * I C P L F G S S S I * S P I E Y R L K Y V L Y F V L L L F E L H F K P GGTTGA ----:- CCAACT G * V X L X ----:- P Q P N T S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 2 BspACI,SsiI AluI 2 AluBI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 1 BciVI 2 BfuI BetI* 1 BsaWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmgT120I 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 2 BsgI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 3 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 2 BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 1 CfrI 1 AcoI,EaeI Csp6I 2 CviQI,RsaNI CviJI 6 CviKI-1 CviRI* 3 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 1 MalI Eco31I 1 Bso31I,BspTNI,BsaI Eco57MI 1 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GlaI 2 GsuI 1 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HhaI 2 BstHHI,CfoI,AspLEI Hin4II* 2 HpyAV Hin6I 2 HinP1I,HspAI HinfI 4 HpaII 1 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 3 Hpy188III Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 4 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MfeI 1 MunI MlyI 2 SchI MnlI 3 MseI 3 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 3 MspA1I PleI 2 PpsI PstI 1 PvuII 2 RsaI 2 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SetI 9 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI TaiI 2 TaqI 3 TaqII 1 TatI 1 TfiI 2 PfeI TseI 5 ApeKI TsoI 1 Tsp45I 1 NmuCI TspDTI 1 TspEI 5 TasI,Tsp509I,Sse9I TspGWI 2 XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvaII AvrII BaeI BamHI BarI BbvCI Bce83I* BceAI BcgI BclI BdaI BfiI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseRI BseSI BseYI BsiI* BslFI BsmFI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BstAPI BstEII BstXI BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I ClaI CspCI CviAII DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III Eco57I EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FatI FseI FspAI GsaI HaeII HgiAI* HgiCI* HgiJII* Hin4I HindII HindIII HpaI Hpy188I Hpy99I KasI KpnI MauBI McrI* MluI MmeI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SecI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TauI Tsp4CI* TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769