Restriction Map of YMR242W-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YMR242W-A on chromosome XIII from coordinates 754297 to 754386.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.22678

TspDTI | SetI | | SecI* | | DsaI* | | |BsiYI* | | || Tsp4CI* MseI | | || | Hpy188I |AhaIII* | | || | | MnlI || ApoI | | || | | |Csp6I || TspEI | | || | | ||RsaI \\ \ \ \ \\ \ \ \\\ ATGTTTAAAATGAAATTTGGCGATACCTTGCCACGGTCAGATTTTGGTACAGGAGGGAAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAATTTTACTTTAAACCGCTATGGAACGGTGCCAGTCTAAAACCATGTCCTCCCTTG // / // / // / / // |MseI TspEI |SetI | || | | |Csp6I AhaIII* ApoI | | || | | RsaI | | || | MnlI | | || Hpy188I | | |DsaI* | | |SecI* | | Tsp4CI* | BsiYI* TspDTI M F K M K F G D T L P R S D F G T G G N C L K * N L A I P C H G Q I L V Q E G T V * N E I W R Y L A T V R F W Y R R E Q ----:----|----:----|----:----|----:----|----:----|----:----| X N L I F N P S V K G R D S K P V P P F X T * F S I Q R Y R A V T L N Q Y L L S H K F H F K A I G Q W P * I K T C S P V Cac8I |KasI |HgiCI* ||AcyI ||NarI ||Hin6I |||GlaI |||DinI |||NlaIV ||||HhaI ||||BssKI |||||HaeII ||||||HpaII ||||||ScrFI ||||||CauII* ||||||| CviJI ||||||| |DdeI CviJI \\\\\\\ \\ \ AAGCAGGCGCCCGGCTTAGAGTTGGGCTAA 70 80 90 ----:----|----:----|----:----| TTCGTCCGCGGGCCGAATCTCAACCCGATT ////// /// / / |||||| ||| DdeI CviJI |||||| ||BssKI |||||| ||CviJI |||||| |HpaII |||||| CauII* |||||| ScrFI |||||HgiCI* |||||KasI ||||Hin6I ||||NarI ||||AcyI |||NlaIV |||DinI |||GlaI ||HhaI |HaeII Cac8I K Q A P G L E L G * S R R P A * S W A X A G A R L R V G L X ----:----|----:----|----:----| L C A G P K S N P * C A P A R S L T P S L L R G A * L Q A L # Enzymes that cut Frequency Isoschizomers AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 1 DraI ApoI 1 AcsI,XapI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BssKI 1 BstSCI,StyD4I Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Csp6I 1 CviQI,RsaNI CviJI 2 CviKI-1 DdeI 1 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DsaI* 1 BtgI,BstDSI GlaI 1 HaeII 1 BstH2I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin6I 1 HinP1I,HspAI HpaII 1 HapII,BsiSI,MspI Hpy188I 1 KasI 1 MnlI 1 MseI 1 Tru1I,Tru9I NarI 1 Mly113I NlaIV 1 BspLI,BmiI,PspN4I RsaI 1 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 1 BseDI,BssECI,BsaJI SetI 1 Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 1 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AflII AflIII AgeI AjuI AlfI AloI AluI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BisI BlsI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstKTI BstNI BstOI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cfr10I Cfr9I CfrI ClaI CspCI CviAII CviRI* DpnI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I Esp3I EspI* FalI FaqI FatI FauI Fnu4HI FnuDII* FokI FseI FspAI GsaI GsuI HaeIII HgaI HgiAI* HgiJII* Hin4I Hin4II* HindII HindIII HinfI HpaI HphI Hpy166II Hpy178III*Hpy8I Hpy99I KpnI Ksp632I* MaeI MaeII MaeIII MauBI MboI MboII McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NcoI NdeI NgoMIV NheI NlaIII NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SduI SexAI SfaNI SfeI* SfiI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaiI TaqI TaqII TatI TauI TfiI TseI TsoI Tsp45I TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769