Restriction Map of PFK2/YMR205C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

PFK2/YMR205C on chromosome XIII from coordinates 674766 to 671887.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 Csp6I |RsaI || MaeIII || Tsp45I || Tsp4CI* || | BtsI || | |TspGWI MaeIII Csp6I || | || CviRI* Tsp4CI* |RsaI || | || | TspRI \ \\ \\ \ \\ \ \ ATGACTGTTACTACTCCTTTTGTGAATGGTACTTCTTATTGTACCGTCACTGCATATTCC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGACAATGATGAGGAAAACACTTACCATGAAGAATAACATGGCAGTGACGTATAAGG / / // ///// / / | MaeIII |Csp6I ||||| | CviRI* Tsp4CI* RsaI ||||| Tsp45I ||||| MaeIII ||||TspGWI |||TspRI |||BtsI ||Tsp4CI* |Csp6I RsaI M T V T T P F V N G T S Y C T V T A Y S * L L L L L L * M V L L I V P S L H I P D C Y Y S F C E W Y F L L Y R H C I F R ----:----|----:----|----:----|----:----|----:----|----:----| X V T V V G K T F P V E * Q V T V A Y E X S Q * * E K Q S H Y K K N Y R * Q M N H S N S S R K H I T S R I T G D S C I G TseI AluI GsuI CviJI Eco57MI |BisI | MboII ||BlsI | | AciI BbvI PsiI ||SetI | | | BsrBI \ \ \\\ \ \ \ \ GTTCAATCTTATAAAGCTGCCATAGATTTTTACACCAAGTTTTTGTCATTAGAAAACCGC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGTTAGAATATTTCGACGGTATCTAAAAATGTGGTTCAAAAACAGTAATCTTTTGGCG / / / //// / / / / | | | |||TseI | | | BsrBI | | | ||BisI | | | AciI | | | |BlsI | | Hin4I | | | CviJI | MboII | | | AluI Eco57MI | | SetI GsuI | PsiI BbvI V Q S Y K A A I D F Y T K F L S L E N R F N L I K L P * I F T P S F C H * K T A S I L * S C H R F L H Q V F V I R K P L ----:----|----:----|----:----|----:----|----:----|----:----| T * D * L A A M S K * V L N K D N S F R R E I K Y L Q W L N K C W T K T M L F G N L R I F S G Y I K V G L K Q * * F V A BinI* |BccI TspDTI || MboI Hin4I | Hin4I || XhoII | SapI | | Hin4I || | DpnI | Ksp632I* | | | TfiI || | |BstKTI | |Hpy178III* | | | HinfI || | || Hin4I \ \\ \ \ \ \ \\ \ \\ \ TCTTCTCCAGATGAAAACTCCACTTTATTGTCTAACGATTCCATCTCTTTGAAGATCCTT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGAGGTCTACTTTTGAGGTGAAATAACAGATTGCTAAGGTAGAGAAACTTCTAGGAA / // / / // // / Hpy178III* || Hin4I HinfI || || XhoII Ksp632I* |TspDTI TfiI || || MboI SapI Hin4I || |Hin4I || |DpnI || BstKTI |BccI BinI* S S P D E N S T L L S N D S I S L K I L L L Q M K T P L Y C L T I P S L * R S F F S R * K L H F I V * R F H L F E D P S ----:----|----:----|----:----|----:----|----:----|----:----| E E G S S F E V K N D L S E M E K F I R S K E L H F S W K I T * R N W R K S S G R R W I F V G S * Q R V I G D R Q L D K MaeII MboII | SetI | TaiI | |Hin4II* TspDTI CviJI Bce83I* | |Hpy178III* |MnlI | Hin4II* TspEI | Tsp4CI* \ \\ \\ \ \ \ \ \ CTACGTCCTGATGAAAAAATCAATAAAAATGTTGAGGCTCATTTGAAGGAATTGAACAGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GATGCAGGACTACTTTTTTAGTTATTTTTACAACTCCGAGTAAACTTCCTTAACTTGTCA / // / / / // // / | || Hpy178III* | MnlI |Hin4II* || Tsp4CI* | |Hin4II* TspDTI CviJI |Bce83I* | MaeII TspEI MboII TaiI SetI L R P D E K I N K N V E A H L K E L N S Y V L M K K S I K M L R L I * R N * T V T S * * K N Q * K C * G S F E G I E Q Y ----:----|----:----|----:----|----:----|----:----|----:----| R R G S S F I L L F T S A * K F S N F L E V D Q H F F * Y F H Q P E N S P I S C * T R I F F D I F I N L S M Q L F Q V T MlyI PleI | Hin4I | Hin4I | | HinfI | | | SmlI | | | | Hpy178III* XcmI | | | | | MboI GsuI | | | | | BsrI Hin4I | | | | | | DpnI Hin4I | | | | | | |BstKTI Eco57MI | | | | | | || FatI | StyI | | | | | | || |CviAII | SecI* | | | | | | || || NspI | |PflMI TaqII | | | | | | || || NlaIII | |BsiYI* |MseI Hpy188I \ \ \ \ \ \ \\ \\ \ \ \\ \\ \ ATTACCAAGACTCAAGACTGGAGATCACATGCCACCCAATCCTTGGTATTTAACACTTCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGGTTCTGAGTTCTGACCTCTAGTGTACGGTGGGTTAGGAACCATAAATTGTGAAGG /// / / / // // // / /// / / / / ||PleI | | | || || || | ||| | | MseI Hpy188I |MlyI | | | || || || | ||| | TaqII Hin4I | | | || || || | ||| SecI* Hin4I | | | || || || | ||| StyI | | | || || || | ||BsiYI* | | | || || || | ||PflMI | | | || || || | |XcmI | | | || || || | Eco57MI | | | || || || | GsuI | | | || || || Hin4I | | | || || || Hin4I | | | || || |FatI | | | || || CviAII | | | || |NlaIII | | | || |NspI | | | || MboI | | | |DpnI | | | BstKTI | | BsrI | Hpy178III* | SmlI HinfI I T K T Q D W R S H A T Q S L V F N T S L P R L K T G D H M P P N P W Y L T L P Y Q D S R L E I T C H P I L G I * H F R ----:----|----:----|----:----|----:----|----:----|----:----| I V L V * S Q L D C A V W D K T N L V E Y * W S E L S S I V H W G I R P I * C K N G L S L V P S * M G G L G Q Y K V S G EcoNI | BsiYI* | TspDTI BseRI | |Ksp632I* | MwoI | || MnlI MmeI | MboII | || CviJI \ \ \ \ \\ \ GACATCTTGGCAGTCAAGGACACTCTAAATGCTATGAACGCTCCTCTTCAAGGCTACCCA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTAGAACCGTCAGTTCCTGTGAGATTTACGATACTTGCGAGGAGAAGTTCCGATGGGT / / / / /// // MmeI | | MboII ||| |Ksp632I* | MwoI ||| |CviJI BseRI ||| MnlI ||EcoNI |TspDTI BsiYI* D I L A V K D T L N A M N A P L Q G Y P T S W Q S R T L * M L * T L L F K A T Q H L G S Q G H S K C Y E R S S S R L P N ----:----|----:----|----:----|----:----|----:----|----:----| S M K A T L S V R F A I F A G R * P * G R C R P L * P C E L H * S R E E E L S G V D Q C D L V S * I S H V S R K L A V W CviRI* | TatI | Bsp1407I | |Csp6I | ||RsaI MaeIII | |||Hpy166II | SetI | |||| AsuI* | | AclI | |||| AvaII | | MaeII | |||| |BmgT120I | | | SetI XmnI | |||| ||NlaIV | | | TaiI MaeIII \ \ \\\\ \\\ \ \ \ \ \ ACAGAACTATTTCCAATGCAGTTGTACACTTTGGACCCATTAGGTAACGTTGTTGGTGTT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTTGATAAAGGTTACGTCAACATGTGAAACCTGGGTAATCCATTGCAACAACCACAA / / /// // / / // XmnI CviRI* ||| || SetI | |MaeII ||| |AvaII | |AclI ||| |AsuI* | MaeIII ||| BmgT120I TaiI ||| NlaIV SetI ||Bsp1407I ||TatI |Hpy166II |Csp6I RsaI T E L F P M Q L Y T L D P L G N V V G V Q N Y F Q C S C T L W T H * V T L L V L R T I S N A V V H F G P I R * R C W C Y ----:----|----:----|----:----|----:----|----:----|----:----| V S S N G I C N Y V K S G N P L T T P T L L V I E L A T T C K P G M L Y R Q Q H C F * K W H L Q V S Q V W * T V N N T N MwoI |BseMII |HindIII ||BspCNI |||AluI CviJI |||CviJI DdeI |EcoP15I |||| SetI \ \\ \\\\ \ ACTTCTACTAAGAACGCAGTTTCAACCAAGCCAACTCCACCACCAGCACCAGAAGCTTCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGATGATTCTTGCGTCAAAGTTGGTTCGGTTGAGGTGGTGGTCGTGGTCTTCGAAGA / / / / / /// / / MaeIII DdeI | EcoP15I | ||| | HindIII CviJI | ||| CviJI | ||| AluI | ||SetI | |BspCNI | BseMII MwoI T S T K N A V S T K P T P P P A P E A S L L L R T Q F Q P S Q L H H Q H Q K L L F Y * E R S F N Q A N S T T S T R S F C ----:----|----:----|----:----|----:----|----:----|----:----| V E V L F A T E V L G V G G G A G S A E * K * * S R L K L W A L E V V L V L L K S R S L V C N * G L W S W W W C W F S R DdeI PleI MnlI TspRI | HinfI |MlyI Hpy166II | CviJI Tsp4CI* \ \ \\ \ \ \ \ GCTGAGTCTGGTCTTTCCTCTAAAGTTCACTCTTACACTGATTTGGCTTACCGTATGAAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTCAGACCAGAAAGGAGATTTCAAGTGAGAATGTGACTAAACCGAATGGCATACTTT / / / // / / / | HinfI PleI || TspRI | Tsp4CI* DdeI MlyI |Hpy166II CviJI MnlI A E S G L S S K V H S Y T D L A Y R M K L S L V F P L K F T L T L I W L T V * K * V W S F L * S S L L H * F G L P Y E N ----:----|----:----|----:----|----:----|----:----|----:----| A S D P R E E L T * E * V S K A * R I F Q Q T Q D K R * L E S K C Q N P K G Y S S L R T K G R F N V R V S I Q S V T H F StuI CviJI MfeI TspDTI HaeIII MnlI | SetI BccI CviJI |BceAI TspEI \ \ \ \ \\ \ ACCACCGACACCTATCCATCTCTGCCAAAGCCATTGAACAGGCCTCAAAAGGCAATTGCC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTGGCTGTGGATAGGTAGAGACGGTTTCGGTAACTTGTCCGGAGTTTTCCGTTAACGG // / / / / / / |SetI BccI CviJI | BceAI MnlI TspEI TspDTI HaeIII MfeI CviJI StuI T T D T Y P S L P K P L N R P Q K A I A P P T P I H L C Q S H * T G L K R Q L P H R H L S I S A K A I E Q A S K G N C R ----:----|----:----|----:----|----:----|----:----|----:----| V V S V * G D R G F G N F L G * F A I A F W R C R D M E A L A M S C A E F P L Q G G V G I W R Q W L W Q V P R L L C N G FatI BspHI |CviAII |Hpy178III* || NlaIII BssKI AclI || | GsuI EcoRII MaeII || | Eco57MI | ScrFI | SetI || | |SfaNI | BseBI | TaiI || | ||BetI* | | HphI | | TspDTI BccI || | |||HpaII | | | SetI | | | CviJI | MboII \\ \ \\\\ \ \ \ \ \ \ \ \ \ \ GTCATGACTTCCGGTGGTGATGCTCCAGGTATGAACTCTAACGTTAGAGCCATCGTGCGT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTACTGAAGGCCACCACTACGAGGTCCATACTTGAGATTGCAATCTCGGTAGCACGCA / // // // / / // / / | || |BetI* || EcoRII | || CviJI MboII | || HpaII || BssKI | |TspDTI BccI | || SfaNI |BseBI | MaeII | |Eco57MI |ScrFI | AclI | |BspHI |HphI TaiI | |FatI SetI SetI | |GsuI | Hpy178III* | CviAII NlaIII V M T S G G D A P G M N S N V R A I V R S * L P V V M L Q V * T L T L E P S C V H D F R W * C S R Y E L * R * S H R A F ----:----|----:----|----:----|----:----|----:----|----:----| T M V E P P S A G P I F E L T L A M T R R * S K R H H H E L Y S S * R * L W R A D H S G T T I S W T H V R V N S G D H T Hin4II* |FatI ||CviAII ||| NlaIII ||| | Hin4II* AciI SetI ||| | | SetI SetI \ \ \\\ \ \ \ \ TCCGCTATCTTCAAAGGTTGTCGTGCCTTTGTTGTCATGGAAGGTTATGAAGGTTTGGTT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCGATAGAAGTTTCCAACAGCACGGAAACAACAGTACCTTCCAATACTTCCAAACCAA / / / / // // / / AciI SetI | | || |Hin4II* SetI TspDTI | | || SetI | | |FatI | | CviAII | NlaIII Hin4II* S A I F K G C R A F V V M E G Y E G L V P L S S K V V V P L L S W K V M K V W F R Y L Q R L S C L C C H G R L * R F G S ----:----|----:----|----:----|----:----|----:----|----:----| E A I K L P Q R A K T T M S P * S P K T N R * R * L N D H R Q Q * P L N H L N P G S D E F T T T G K N D H F T I F T Q N ApoI TspEI EcoRI | EcoP15I | | TspGWI | | | BsrI | | | TspRI | | | | AcyI | | | | MaeII | | | | |ZraI | | | | |BfiI | | | | || SetI | | | | || TaiI TspDTI | | | | || AatII | AsuI* | | | | || BbvII* | AvaII | | | | || |SecI* | |BmgT120I | | | | || |DsaI* | || Hpy178III* | | | | || || MboII Hin4II* \ \\ \ \ \ \ \ \\ \\ \ \ CGTGGTGGTCCAGAATACATCAAGGAATTCCACTGGGAAGACGTCCGTGGTTGGTCTGCT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GCACCACCAGGTCTTATGTAGTTCCTTAAGGTGACCCTTCTGCAGGCACCAACCAGACGA // / /// / / //// // / || Hpy178III* ||| | BsrI |||| || Hin4II* |AvaII ||| TspGWI |||| |DsaI* |AsuI* ||EcoP15I |||| |SecI* BmgT120I |EcoRI |||| BbvII* |TspEI |||| MboII |ApoI |||MaeII TspRI |||AcyI ||ZraI |BfiI AatII TaiI SetI R G G P E Y I K E F H W E D V R G W S A V V V Q N T S R N S T G K T S V V G L L W W S R I H Q G I P L G R R P W L V C * ----:----|----:----|----:----|----:----|----:----|----:----| R P P G S Y M L S N W Q S S T R P Q D A E H H D L I C * P I G S P L R G H N T Q T T T W F V D L F E V P F V D T T P R S BsiYI* | ApoI | TspEI | EcoRI | | Hpy178III* SetI | | | Hin4II* |Acc65I | | | | Hin6I |HgiCI* | | | | |GlaI ||Csp6I Csp6I | | | | ||HhaI |||RsaI Eco57I | | | | ||FnuDII* |||NlaIV Eco57MI | | | | ||| TaqII |||| KpnI |RsaI | | | | ||| | SetI \\\\ \ \\ \ \ \ \ \\\ \ \ GAAGGTGGTACCAACATTGGTACTGCCCGTTGTATGGAATTCAAGAAGCGCGAAGGTAGA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCCACCATGGTTGTAACCATGACGGGCAACATACCTTAAGTTCTTCGCGCTTCCATCT / / /// / // / / // /// / SetI | ||HgiCI* | |Csp6I BsiYI* | || ||| TaqII | ||Acc65I | RsaI | || ||| SetI | |Csp6I Eco57MI | || ||FnuDII* | NlaIV Eco57I | || ||Hin6I | RsaI | || |GlaI KpnI | || HhaI | |Hin4II* | Hpy178III* EcoRI TspEI ApoI E G G T N I G T A R C M E F K K R E G R K V V P T L V L P V V W N S R S A K V D R W Y Q H W Y C P L Y G I Q E A R R * I ----:----|----:----|----:----|----:----|----:----|----:----| S P P V L M P V A R Q I S N L F R S P L Q L H Y W C Q Y Q G N Y P I * S A R L Y F T T G V N T S G T T H F E L L A F T S SfaNI HgiCI* |CviJI | NlaIV |Cfr10I MboI | | SduI |HaeIII | DpnI MaeIII | | BseSI MnlI ||HpaII TaqI | |BstKTI Tsp45I \ \ \ \ \\\ \ \ \\ \ TTATTGGGTGCCCAACATTTGATTGAGGCCGGTGTCGATGCTTTGATCGTTTGTGGTGGT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AATAACCCACGGGTTGTAAACTAACTCCGGCCACAGCTACGAAACTAGCAAACACCACCA // / / / // / // / || | MnlI | || TaqI || MboI || HgiCI* | |Cfr10I |DpnI |NlaIV | HpaII BstKTI BseSI | SfaNI SduI HaeIII CviJI L L G A Q H L I E A G V D A L I V C G G Y W V P N I * L R P V S M L * S F V V V I G C P T F D * G R C R C F D R L W W * ----:----|----:----|----:----|----:----|----:----|----:----| N N P A W C K I S A P T S A K I T Q P P I I P H G V N S Q P R H R H K S R K H H * Q T G L M Q N L G T D I S Q D N T T T MboI | DpnI | |BstKTI | || Hpy188I | || | CviJI | || | HaeIII | || | | MnlI | || | | | MboI | || | | | | DpnI BsrI | || | | | | |TaqI | MboI | || | | | | |BstKTI Tsp4CI* | | DpnI | || | | | | |Hin4II* | HphI | | |BstKTI | || | | | | || TspEI \ \ \ \ \\ \ \\ \ \ \ \ \\ \ GACGGTTCTTTGACTGGTGCTGATCTGTTTAGATCAGAATGGCCTTCTTTGATCGAGGAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCCAAGAAACTGACCACGACTAGACAAATCTAGTCTTACCGGAAGAAACTAGCTCCTT / / / // / // / / / // // | HphI BsrI || MboI || | | | || |TaqI Tsp4CI* |DpnI || | | | || MboI Tsp45I BstKTI || | | | |Hin4II* MaeIII || | | | |DpnI || | | | BstKTI || | | MnlI || | HaeIII || | CviJI || Hpy188I || MboI |DpnI BstKTI D G S L T G A D L F R S E W P S L I E E T V L * L V L I C L D Q N G L L * S R N R F F D W C * S V * I R M A F F D R G I ----:----|----:----|----:----|----:----|----:----|----:----| S P E K V P A S R N L D S H G E K I S S H R N K S Q H Q D T * I L I A K K S R P V T R Q S T S I Q K S * F P R R Q D L F PsrI ApoI SspI TspEI MmeI |TspDTI \ \ \\ TTGTTGAAAACAAACAGAATTTCCAACGAACAATACGAAAGAATGAAGCATTTGAATATT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AACAACTTTTGTTTGTCTTAAAGGTTGCTTGTTATGCTTTCTTACTTCGTAAACTTATAA / / / / // TspEI TspEI MmeI | |SspI ApoI | TspDTI PsrI L L K T N R I S N E Q Y E R M K H L N I C * K Q T E F P T N N T K E * S I * I F V E N K Q N F Q R T I R K N E A F E Y L ----:----|----:----|----:----|----:----|----:----|----:----| N N F V F L I E L S C Y S L I F C K F I I T S F L C F K W R V I R F F S A N S Y Q Q F C V S N G V F L V F S H L M Q I N PsrI AciI | SfaNI | Csp6I | | Hpy166II | |RsaI | | | SecI* FokI | || Tsp4CI* | | | DsaI* BseGI TspGWI \ \\ \ \ \ \ \ \ \ TGCGGTACTGTCGGTTCTATTGATAACGATATGTCCACCACGGATGCTACTATTGGTGCT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| ACGCCATGACAGCCAAGATAACTATTGCTATACAGGTGGTGCCTACGATGATAACCACGA / /// / / / / / / / | ||Tsp4CI* PsrI | | | BseGI | FokI | |Csp6I | | DsaI* TspGWI | RsaI | | SecI* AciI | SfaNI Hpy166II C G T V G S I D N D M S T T D A T I G A A V L S V L L I T I C P P R M L L L V L R Y C R F Y * * R Y V H H G C Y Y W C L ----:----|----:----|----:----|----:----|----:----|----:----| Q P V T P E I S L S I D V V S A V I P A K R Y Q R N * Q Y R Y T W W P H * * Q H A T S D T R N I V I H G G R I S S N T S CviJI BccI CviJI MwoI TfiI HaeIII |MaeII |BtsI | StyI HinfI | TaqI || SetI ||Bce83I* | SecI* | AlwNI | ClaI || TaiI ||| TspRI \ \ \ \ \ \ \\ \ \\\ \ TACTCTGCCTTGGACAGAATCTGTAAGGCCATCGATTACGTTGAAGCCACTGCCAACTCT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAGACGGAACCTGTCTTAGACATTCCGGTAGCTAATGCAACTTCGGTGACGGTTGAGA / / / / / / // / // MwoI | | HinfI | | || | |Bce83I* | | TfiI | | || | |CviJI | AlwNI | | || | TspRI SecI* | | || | BtsI StyI | | || MaeII | | |BccI | | TaiI | | SetI | ClaI | TaqI HaeIII CviJI Y S A L D R I C K A I D Y V E A T A N S T L P W T E S V R P S I T L K P L P T L L C L G Q N L * G H R L R * S H C Q L S ----:----|----:----|----:----|----:----|----:----|----:----| * E A K S L I Q L A M S * T S A V A L E K S Q R P C F R Y P W R N R Q L W Q W S V R G Q V S D T L G D I V N F G S G V R AluI SmlI CviJI | Hpy178III* | SetI | | AluI | | BarI | | CviJI TsoI | | |MwoI | | | SetI AjuI | Tsp4CI* | | ||AjuI \ \ \ \ \ \ \ \ \ \\\ CACTCAAGAGCTTTCGTTGTTGAAGTTATGGGTAGAAACTGTGGTTGGTTAGCTTTATTA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GTGAGTTCTCGAAAGCAACAACTTCAATACCCATCTTTGACACCAACCAATCGAAATAAT // / / / / / / // / || CviJI AjuI TsoI Tsp4CI* | | || SetI || AluI | | |MwoI |SetI | | AjuI Hpy178III* | CviJI SmlI | AluI | BarI SetI H S R A F V V E V M G R N C G W L A L L T Q E L S L L K L W V E T V V G * L Y * L K S F R C * S Y G * K L W L V S F I S ----:----|----:----|----:----|----:----|----:----|----:----| * E L A K T T S T I P L F Q P Q N A K N E S L L K R Q Q L * P Y F S H N T L K I V * S S E N N F N H T S V T T P * S * * AluI Hpy178III* CviJI MwoI | CviJI | SetI |AciI | | Cac8I | | MwoI || NspBII* BarI | | | CviJI \ \ \ \\ \ \ \ \ \ \ GCTGGTATCGCCACTTCCGCTGACTATATCTTTATTCCAGAGAAGCCAGCCACTTCCAGC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CGACCATAGCGGTGAAGGCGACTGATATAGAAATAAGGTCTCTTCGGTCGGTGAAGGTCG / / / / / / / / / / | MwoI MwoI | BarI | | | CviJI BsiYI* CviJI NspBII* | | Cac8I PflMI AluI AciI | CviJI Hpy178III* A G I A T S A D Y I F I P E K P A T S S L V S P L P L T I S L F Q R S Q P L P A W Y R H F R * L Y L Y S R E A S H F Q R ----:----|----:----|----:----|----:----|----:----|----:----| A P I A V E A S * I K I G S F G A V E L L Q Y R W K R Q S Y R * E L S A L W K W S T D G S G S V I D K N W L L W G S G A MboI MboI | DpnI | DpnI | |BsaXI | |BstKTI MaeIII | |BstKTI PflMI | ||BsaXI Tsp45I | || Hin4I BsiYI* | ||Hin4I | Tth111I BsmAI | || | CspCI \ \ \\\ \ \ \ \ \\ \ \ GAATGGCAAGATCAAATGTGTGACATTGTCTCCAAGCACAGATCAAGGGGTAAGAGAACC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTTACCGTTCTAGTTTACACACTGTAACAGAGGTTCGTGTCTAGTTCCCCATTCTCTTGG / // / / / / /// / / | || MboI | Tth111I | ||| | CspCI | |DpnI Tsp45I | ||| MboI | BstKTI MaeIII | ||DpnI | BsaXI | |BstKTI Hin4I | Hin4I | BsaXI BsmAI E W Q D Q M C D I V S K H R S R G K R T N G K I K C V T L S P S T D Q G V R E P M A R S N V * H C L Q A Q I K G * E N H ----:----|----:----|----:----|----:----|----:----|----:----| S H C S * I H S M T E L C L D L P L L V R I A L D F T H C Q R W A C I L P Y S F F P L I L H T V N D G L V S * P T L S G Hin4II* | CviRI* | | BbvI | | | MwoI TseI | | | BstAPI MwoI | | | |CspCI |BisI EcoP15I | | | ||SetI ||BlsI TspEI \ \ \ \ \\\ \\\ \ ACCATTGTTGTTGTTGCAGAAGGTGCTATCGCTGCTGACTTGACCCCAATTTCTCCAAGC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTAACAACAACAACGTCTTCCACGATAGCGACGACTGAACTGGGGTTAAAGAGGTTCG / / / //// / /// / / | | | |||BbvI | ||TseI TspEI Hpy99I | | | ||CspCI | |BisI | | | |SetI | BlsI | | | BstAPI MwoI | | | MwoI | | CviRI* | Hin4II* EcoP15I T I V V V A E G A I A A D L T P I S P S P L L L L Q K V L S L L T * P Q F L Q A H C C C C R R C Y R C * L D P N F S K R ----:----|----:----|----:----|----:----|----:----|----:----| V M T T T A S P A I A A S K V G I E G L W W Q Q Q Q L L H * R Q Q S S G L K E L G N N N N C F T S D S S V Q G W N R W A AcyI MaeII EcoP15I |ZraI | DdeI ||Hpy99I | SauI* |||SetI | |SetI |||TaiI | || MaeIII |||AatII HindII BciVI | || Tsp45I ||||Hpy166II MaeI Hpy166II | SetI TspEI | || | SetI \\\\\ \ \ \ \ \ \ \\ \ \ GACGTCCACAAAGTTCTAGTTGACAGATTAGGTTTGGATACAAGAATTACTACCTTAGGT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCAGGTGTTTCAAGATCAACTGTCTAATCCAAACCTATGTTCTTAATGATGGAATCCA / // / / / / / / / // | || Hpy166II | | BciVI | | | |SauI* | |MaeII | | SetI | | | |DdeI | |AcyI | Hpy166II | | | SetI | ZraI | HindII | | EcoP15I AatII MaeI | SetI TaiI TspEI SetI D V H K V L V D R L G L D T R I T T L G T S T K F * L T D * V W I Q E L L P * V R P Q S S S * Q I R F G Y K N Y Y L R S ----:----|----:----|----:----|----:----|----:----|----:----| S T W L T R T S L N P K S V L I V V K P R R G C L E L Q C I L N P Y L F * * R L V D V F N * N V S * T Q I C S N S G * T TsoI MaeII | McrI* | MnlI SetI | |Tsp4CI* BceAI | |SetI | Csp6I | || BaeI | BaeI | |TaiI | |RsaI | || |BsiYI* | | MnlI | || BaeI | || BaeI | || || CviJI | | | SetI \ \\ \ \ \\ \ \ \\ \\ \ \ \ \ \ CACGTTCAAAGAGGTGGTACTGCTGTTGCTTACGACCGTATCTTGGCTACTTTACAAGGT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCAAGTTTCTCCACCATGACGACAACGAATGCTGGCATAGAACCGATGAAATGTTCCA / // / / // / / / / / / / / | |MaeII SetI | |Csp6I | | | BsiYI* | BaeI | SetI | Tsp45I | RsaI | | Tsp4CI* CviJI | MnlI | MaeIII BaeI | | BaeI BceAI | MnlI | McrI* | BaeI TsoI TaiI SetI H V Q R G G T A V A Y D R I L A T L Q G T F K E V V L L L L T T V S W L L Y K V R S K R W Y C C C L R P Y L G Y F T R S ----:----|----:----|----:----|----:----|----:----|----:----| * T * L P P V A T A * S R I K A V K C P D R E F L H Y Q Q Q K R G Y R P * K V L V N L S T T S S N S V V T D Q S S * L T SmlI BceAI Hpy178III* | CviJI | HaeIII | | MseI | | | MwoI | | | | GsuI | | | | Eco57MI | | | | | Bce83I* | | | | | | TfiI | | | | | | HinfI | | | | | | | Hin4I Hpy178III* Hin4I | | | | | | | Hin4I | HphI BccI Hin4I \ \ \ \ \ \ \ \ \ \ \ \ CTTGAGGCCGTTAATGCCGTTTTGGAATCCACTCCAGACACCCCATCACCATTGATTGCT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTCCGGCAATTACGGCAAAACCTTAGGTGAGGTCTGTGGGGTAGTGGTAACTAACGA / / / / / / / / / // / / | | | | | | | | HinfI |HphI | Hin4I | | | | | | | | TfiI Hpy178III* | Hin4I | | | | | | | Hin4I BccI | | | | | | | Hin4I | | | | | | Bce83I* | | | | | Eco57MI | | | | | GsuI | | | | MseI | | | MwoI | | HaeIII | | CviJI | SmlI Hpy178III* BceAI L E A V N A V L E S T P D T P S P L I A L R P L M P F W N P L Q T P H H H * L L * G R * C R F G I H S R H P I T I D C C ----:----|----:----|----:----|----:----|----:----|----:----| R S A T L A T K S D V G S V G D G N I A D Q P R * H R K P I W E L C G M V M S Q K L G N I G N Q F G S W V G W * W Q N S MseI Hpy166II |HpaI | TspGWI |HindII | |MseI TfiI HindII |Hpy166II TspEI | |VspI HinfI Hpy166II \\ \ \ \\ \ \ GTTAACGAAAACAAAATTGTTCGTAAACCATTAATGGAATCCGTCAAGTTGACCAAAGCA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CAATTGCTTTTGTTTTAACAAGCATTTGGTAATTACCTTAGGCAGTTCAACTGGTTTCGT // / / / / / / |MseI TspEI | | VspI HinfI Hpy166II Hpy166II | | MseI TfiI HindII HindII | TspGWI HpaI Hpy166II V N E N K I V R K P L M E S V K L T K A L T K T K L F V N H * W N P S S * P K Q * R K Q N C S * T I N G I R Q V D Q S S ----:----|----:----|----:----|----:----|----:----|----:----| T L S F L I T R L G N I S D T L N V L A Q * R F C F Q E Y V M L P I R * T S W L N V F V F N N T F W * H F G D L Q G F C BsmAI MwoI | MseI | AluI | |BseMII | CviJI Hpy178III* | ||BspCNI CviRI* | |DdeI | AluI | ||| TspDTI | CviJI | |Bpu10I | CviJI | ||| | DdeI | |XmnI | ||SetI | | SetI | ||| | | TspRI \ \\ \ \\\ \ \ \ \ \\\ \ \ \ GTTGCAGAAGCCATTCAAGCTAAGGATTTCAAGAGAGCTATGTCTTTAAGAGACACTGAG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGTCTTCGGTAAGTTCGATTCCTAAAGTTCTCTCGATACAGAAATTCTCTGTGACTC / // / / / / / / / // // / / | || | | | Bpu10I | | CviJI || || TspRI DdeI | || | | | DdeI | | AluI || |TspDTI | || | | CviJI | SetI || BsmAI | || | | AluI Hpy178III* || MseI | || | SetI |BspCNI | || MwoI BseMII | |XmnI | CviJI CviRI* V A E A I Q A K D F K R A M S L R D T E L Q K P F K L R I S R E L C L * E T L S C R S H S S * G F Q E S Y V F K R H * V ----:----|----:----|----:----|----:----|----:----|----:----| T A S A M * A L S K L L A I D K L S V S L Q L L W E L * P N * S L * T K L L C Q N C F G N L S L I E L S S H R * S V S L EcoP15I | TspDTI | |MseI | ||AhaIII* | ||| TsoI | ||| | TspEI | ||| | | FatI | ||| | | |CviAII | ||| | | || NlaIII AluI | ||| | | || |CviJI PsrI CviJI \ \\\ \ \ \\ \\ \ \ TTCATTGAACATTTAAACAATTTCATGGCTATCAACTCTGCTGACCACAACGAACCAAAG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAACTTGTAAATTTGTTAAAGTACCGATAGTTGAGACGACTGGTGTTGCTTGGTTTC / / // // /// / / / | | |MseI || ||CviJI PsrI | CviJI | | AhaIII* || |FatI | AluI | | TsoI || CviAII SetI | EcoP15I |NlaIII TspDTI TspEI F I E H L N N F M A I N S A D H N E P K S L N I * T I S W L S T L L T T T N Q S H * T F K Q F H G Y Q L C * P Q R T K A ----:----|----:----|----:----|----:----|----:----|----:----| N M S C K F L K M A I L E A S W L S G F T * Q V N L C N * P * * S Q Q G C R V L E N F M * V I E H S D V R S V V V F W L SduI HgiAI* | AluI | CviJI | PvuII | NspBII* GsuI | | SetI Eco57MI | | |BceAI |MboII Eco57I | | |PflMI SetI BsmAI PsrI || MseI Eco57MI | | |BsiYI* \ \ \ \\ \ \ \ \ \\ CTACCAAAGGACAAGAGACTGAAGATTGCCATTGTTAATGTCGGTGCTCCAGCTGGTGGT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GATGGTTTCCTGTTCTCTGACTTCTAACGGTAACAATTACAGCCACGAGGTCGACCACCA / / / / // / / / / | BsmAI | | || | | | BceAI PsrI | | || | | NspBII* | | || | | BsiYI* | | || | | PflMI | | || | | PvuII | | || | | CviJI | | || | | AluI | | || | SetI | | || HgiAI* | | || SduI | | |Eco57MI | | |Eco57I | | MseI | MboII Eco57MI GsuI L P K D K R L K I A I V N V G A P A G G Y Q R T R D * R L P L L M S V L Q L V V T K G Q E T E D C H C * C R C S S W W Y ----:----|----:----|----:----|----:----|----:----|----:----| S G F S L L S F I A M T L T P A G A P P A V L P C S V S S Q W Q * H R H E L Q H * W L V L S Q L N G N N I D T S W S T T TsoI StyI |AccI SecI* ||BccI | MaeIII ||Hpy166II BslFI | Tsp45I ||| TaqI |CviJI Tsp4CI* | | SetI \\\ \ \\ \ \ \ \ ATCAACTCTGCCGTCTACTCGATGGCTACTTACTGTATGTCCCAAGGTCACAGACCATAC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTGAGACGGCAGATGAGCTACCGATGAATGACATACAGGGTTCCAGTGTCTGGTATG / // / / / / / / / | |AccI | | | Tsp4CI* | | Tsp45I | |BccI | | BslFI | | MaeIII | | | CviJI | SecI* | | TaqI | StyI | Hpy166II SetI TsoI I N S A V Y S M A T Y C M S Q G H R P Y S T L P S T R W L L T V C P K V T D H T Q L C R L L D G Y L L Y V P R S Q T I R ----:----|----:----|----:----|----:----|----:----|----:----| I L E A T * E I A V * Q I D W P * L G Y Y * S Q R R S S P * K S Y T G L D C V M D V R G D V R H S S V T H G L T V S W V FatI |CviAII || NlaIII TspDTI || |MslI | AjuI || || XmnI | | Hin4II* \\ \\ \ \ \ \ GCTATCTACAATGGTTGGTCTGGTTTGGCAAGACATGAAAGTGTTCGTTCTTTGAACTGG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CGATAGATGTTACCAACCAGACCAAACCGTTCTGTACTTTCACAAGCAAGAAACTTGACC / /// / // / / | ||| XmnI || | BsrI | ||MslI || Hin4II* | |FatI |TspDTI | CviAII AjuI NlaIII A I Y N G W S G L A R H E S V R S L N W L S T M V G L V W Q D M K V F V L * T G Y L Q W L V W F G K T * K C S F F E L E ----:----|----:----|----:----|----:----|----:----|----:----| A I * L P Q D P K A L C S L T R E K F Q R * R C H N T Q N P L V H F H E N K S S S D V I T P R T Q C S M F T N T R Q V P GsuI AjuI Csp6I HinfI SecI* Eco57MI |MaeIII BsrI DsaI* Hpy188I |RsaI |Tsp45I \ \ \ \\ \\ AAGGATATGTTGGGTTGGCAATCCCGTGGTGGTTCTGAAATCGGTACTAACAGAGTCACT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTATACAACCCAACCGTTAGGGCACCACCAAGACTTTAGCCATGATTGTCTCAGTGA / / / / // / / AjuI DsaI* | | |Csp6I | Tsp45I SecI* | | RsaI | MaeIII | Eco57MI HinfI | GsuI Hpy188I K D M L G W Q S R G G S E I G T N R V T R I C W V G N P V V V L K S V L T E S L G Y V G L A I P W W F * N R Y * Q S H S ----:----|----:----|----:----|----:----|----:----|----:----| F S I N P Q C D R P P E S I P V L L T V S P Y T P N A I G H H N Q F R Y * C L * L I H Q T P L G T T T R F D T S V S D S MboI BglII XhoII | DpnI Csp6I | |BstKTI |RsaI PleI | ||MaeI || BccI Hpy178III* | ||MboII || ApoI |MlyI | ||| SetI || TspEI \\ \ \\\ \ \\ \ CCAGAAGAAGCAGATCTAGGTATGATTGCTTACTATTTCCAAAAGTACGAATTTGATGGT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTTCTTCGTCTAGATCCATACTAACGAATGATAAAGGTTTTCATGCTTAAACTACCA // ////// // / / || |||||MaeI || | TspEI || ||||SetI || | ApoI || |||XhoII || BccI || |||BglII |Csp6I || |||MboI RsaI || ||MboII || |DpnI || BstKTI |Hpy178III* PleI MlyI P E E A D L G M I A Y Y F Q K Y E F D G Q K K Q I * V * L L T I S K S T N L M V R R S R S R Y D C L L F P K V R I * W F ----:----|----:----|----:----|----:----|----:----|----:----| G S S A S R P I I A * * K W F Y S N S P E L L L L D L Y S Q K S N G F T R I Q H W F F C I * T H N S V I E L L V F K I T TaqI AsuII | HindIII | | AluI MboI | | CviJI BclI | | | SetI | DpnI | | | | TfiI | |BstKTI | | | | HinfI TspEI \ \\ \ \ \ \ \ \ TTGATCATCGTTGGTGGTTTCGAAGCTTTTGAATCTTTACATCAATTAGAGAGAGCAAGA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAGTAGCAACCACCAAAGCTTCGAAAACTTAGAAATGTAGTTAATCTCTCTCGTTCT // / // / / / / || BclI || | | HinfI TspEI || MboI || | | TfiI |DpnI || | HindIII BstKTI || CviJI || AluI |SetI AsuII TaqI L I I V G G F E A F E S L H Q L E R A R * S S L V V S K L L N L Y I N * R E Q E D H R W W F R S F * I F T S I R E S K R ----:----|----:----|----:----|----:----|----:----|----:----| K I M T P P K S A K S D K C * N S L A L N S * R Q H N R L K Q I K V D I L S L L Q D D N T T E F S K F R * M L * L S C S AluI CviJI | SetI Hpy178III* | | Hpy188I | AluI | | |TfiI | CviJI | | |HinfI | | SetI \ \ \\ \ \ \ GAAAGTTATCCAGCTTTCAGAATCCCAATGGTCTTGATACCAGCTACTTTGTCTAACAAT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCAATAGGTCGAAAGTCTTAGGGTTACCAGAACTATGGTCGATGAAACAGATTGTTA / / / / / / / | | | HinfI | | CviJI | | | TfiI | | AluI | | Hpy188I | SetI | CviJI Hpy178III* | AluI SetI E S Y P A F R I P M V L I P A T L S N N K V I Q L S E S Q W S * Y Q L L C L T M K L S S F Q N P N G L D T S Y F V * Q C ----:----|----:----|----:----|----:----|----:----|----:----| S L * G A K L I G I T K I G A V K D L L L F N D L K * F G L P R S V L * K T * C F T I W S E S D W H D Q Y W S S Q R V I BssKI EcoRII | ScrFI | BseBI | | Csp6I | | |RsaI | | |SetI Hpy188I | | ||AlwNI | AciI MwoI BsmI \ \ \\\ \ \ \ \ GTTCCAGGTACTGAATACTCTTTGGGTTCTGATACCGCTTTGAATGCTCTAATGGAATAC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGGTCCATGACTTATGAGAAACCCAAGACTATGGCGAAACTTACGAGATTACCTTATG ////// / / / / / |||||Csp6I Hpy188I | MwoI BsmI Tsp4CI* ||||RsaI AciI |||EcoRII |||BssKI ||AlwNI |BseBI |ScrFI SetI V P G T E Y S L G S D T A L N A L M E Y F Q V L N T L W V L I P L * M L * W N T S R Y * I L F G F * Y R F E C S N G I L ----:----|----:----|----:----|----:----|----:----|----:----| T G P V S Y E K P E S V A K F A R I S Y H E L Y Q I S K P N Q Y R K S H E L P I N W T S F V R Q T R I G S Q I S * H F V MboII SetI TaqI Tsp4CI* MseI | AciI MnlI | CviJI |Hin4II* \ \ \ \ \ \ \ \\ TGTGATGTTGTTAAACAATCCGCTTCTTCAACCAGAGGTAGAGCCTTCGTTGTCGATTGT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| ACACTACAACAATTTGTTAGGCGAAGAAGTTGGTCTCCATCTCGGAAGCAACAGCTAACA / / / / / / / / | MboII AciI MnlI SetI CviJI | TaqI MseI Hin4II* C D V V K Q S A S S T R G R A F V V D C V M L L N N P L L Q P E V E P S L S I V * C C * T I R F F N Q R * S L R C R L S ----:----|----:----|----:----|----:----|----:----|----:----| Q S T T L C D A E E V L P L A K T T S Q S H H Q * V I R K K L W L Y L R R Q R N T I N N F L G S R * G S T S G E N D I T CfrI | BalI | CviJI MwoI | HaeIII | BslFI SetI | BspCNI Bce83I* | |SmlI |MaeIII | |BseMII | MwoI | ||SduI || DdeI CviJI | || MwoI | | CviJI | ||HgiAI* \\ \ \ \ \\ \ \ \ \ \ \\\ CAAGGTGGTAACTCAGGCTATTTGGCCACTTACGCTTCTTTGGCTGTTGGTGCTCAAGTC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCACCATTGAGTCCGATAAACCGGTGAATGCGAAGAAACCGACAACCACGAGTTCAG / / / / /// // // / / / // SetI | | CviJI ||| |MwoI |MwoI | | | |SmlI | DdeI ||| CfrI | | | | BslFI MaeIII ||HaeIII | | | HgiAI* ||CviJI | | | SduI ||BalI | | MwoI |BseMII | CviJI BspCNI Bce83I* Q G G N S G Y L A T Y A S L A V G A Q V K V V T Q A I W P L T L L W L L V L K S R W * L R L F G H L R F F G C W C S S L ----:----|----:----|----:----|----:----|----:----|----:----| * P P L E P * K A V * A E K A T P A * T D L H Y S L S N P W K R K K P Q Q H E L L T T V * A I Q G S V S R Q S N T S L D Hin4II* | BsiYI* | | SetI | | |Hin4I MfeI BsaXI | | |BsaXI TspEI SecI* | Hin4I BsmAI | | || MboII | MnlI |Hpy188I | | DdeI \ \ \ \\ \ \ \ \\ \ \ \ TCTTATGTCCCAGAAGAAGGTATTTCTTTGGAGCAATTGTCCGAGGATATTGAATACTTA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| AGAATACAGGGTCTTCTTCCATAAAGAAACCTCGTTAACAGGCTCCTATAACTTATGAAT / / / / / / / / / / / // | | | | | MboII | | | | BsaXI |DdeI | | | | BsaXI | | | | Hin4I SetI | | | Hin4I | | | SecI* | | | SetI | | Hpy188I | | BsiYI* | TspEI | Hin4II* | MfeI BsmAI MnlI S Y V P E E G I S L E Q L S E D I E Y L L M S Q K K V F L W S N C P R I L N T * L C P R R R Y F F G A I V R G Y * I L S ----:----|----:----|----:----|----:----|----:----|----:----| E * T G S S P I E K S C N D S S I S Y K R K H G L L L Y K K P A I T R P Y Q I S R I D W F F T N R Q L L Q G L I N F V * AluI TatI CviJI Hin4II* Ksp632I* |Csp6I | SetI | MnlI SetI SetI TspEI | BarI ||RsaI \ \ \ \ \ \ \ \ \ \\\ GCTCAATCTTTTGAAAAGGCAGAAGGTAGAGGTAGATTTGGTAAATTGATTTTGAAGAGT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGTTAGAAAACTTTTCCGTCTTCCATCTCCATCTAAACCATTTAACTAAAACTTCTCA / / / / / // / / CviJI | | SetI SetI || | RsaI AluI | MnlI || Ksp632I* Hin4II* |TspEI BarI A Q S F E K A E G R G R F G K L I L K S L N L L K R Q K V E V D L V N * F * R V S I F * K G R R * R * I W * I D F E E Y ----:----|----:----|----:----|----:----|----:----|----:----| A * D K S F A S P L P L N P L N I K F L L E I K Q F P L L Y L Y I Q Y I S K S S S L R K F L C F T S T S K T F Q N Q L T MboII MwoI BccI | DdeI EcoP15I TspEI | CviJI | | MwoI |BarI | BstXI | |Eco57I | | | CviJI || CviJI | | CviJI | |Eco57MI \ \ \ \ \\ \ \ \ \ \ \\ ACAAACGCTTCTAAGGCTTTATCAGCCACTAAATTGGCTGAAGTTATTACTGCTGAAGCC 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTGCGAAGATTCCGAAATAGTCGGTGATTTAACCGACTTCAATAATGACGACTTCGG // / / / / // // / / / /// || | | | | |MwoI || BstXI | CviJI ||CviJI || | | | | BarI |CviJI TspEI |Eco57MI || | | | CviJI EcoP15I |Eco57I || | | DdeI BccI || | MwoI || MboII |TatI Csp6I T N A S K A L S A T K L A E V I T A E A Q T L L R L Y Q P L N W L K L L L L K P K R F * G F I S H * I G * S Y Y C * S R ----:----|----:----|----:----|----:----|----:----|----:----| V F A E L A K D A V L N A S T I V A S A Y L R K * P K I L W * I P Q L * * Q Q L C V S R L S * * G S F Q S F N N S S F G Eco57I Eco57MI | DdeI | EspI* | | CviJI | | |MwoI | | |HgaI | | ||Cac8I | | ||| AluI | | ||| CviJI | | ||| | SetI | | ||| | | BssKI | | ||| | | EcoRII | | ||| | | | ScrFI | | ||| | | | BseBI | | ||| | | | | FatI | | ||| | | | | SetI | | ||| | | | | |CviAII | | ||| | | | | || TatI | | ||| | | | | || Bsp1407I | | ||| | | | | || |Csp6I | | ||| | | | | || |NlaIII | | ||| | | | | || ||RsaI SetI \ \ \\\ \ \ \ \ \\ \\\ \ GATGGCAGATTTGACGCTAAGCCAGCTTATCCAGGTCATGTACAACAAGGTGGTTTGCCA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCGTCTAAACTGCGATTCGGTCGAATAGGTCCAGTACATGTTGTTCCACCAAACGGT / /// / / / // // ///// / | ||| | | HgaI || || ||||| SetI | ||| | CviJI || || ||||Bsp1407I | ||| | AluI || || ||||TatI | ||| Cac8I || || |||Csp6I | ||| SetI || || ||RsaI | ||CviJI || || |FatI | |EspI* || || CviAII | |DdeI || |NlaIII | MwoI || EcoRII Eco57MI || BssKI Eco57I |BseBI |ScrFI SetI D G R F D A K P A Y P G H V Q Q G G L P M A D L T L S Q L I Q V M Y N K V V C H W Q I * R * A S L S R S C T T R W F A I ----:----|----:----|----:----|----:----|----:----|----:----| S P L N S A L G A * G P * T C C P P K G R H C I Q R * A L K D L D H V V L H N A I A S K V S L W S I W T M Y L L T T Q W CviJI | MaeI | | MslI | | | BstXI | | | | CfrI | | | | | BalI | | | | | CviJI | | | | | HaeIII | | | | | | MseI | | | | | | | MwoI | | | | | | | | TspDTI MfeI | | | | | | | | |AluI TspEI | | | | | | | | |CviJI |BccI | | | | | | | | || SetI CviJI BbvI \\ \ \ \ \ \ \ \ \ \\ \ \ \ TCTCCAATTGATAGAACAAGAGCCACTAGAATGGCCATTAAAGCTGTCGGCTTCATCAAA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGGTTAACTATCTTGTTCTCGGTGATCTTACCGGTAATTTCGACAGCCGAAGTAGTTT / / / / / / // // / / | TspEI | | MslI | || || CviJI CviJI | MfeI | | MaeI | || || AluI BccI | BstXI | || |SetI CviJI | || TspDTI | || MseI | |MwoI | CfrI HaeIII CviJI BalI S P I D R T R A T R M A I K A V G F I K L Q L I E Q E P L E W P L K L S A S S K S N * * N K S H * N G H * S C R L H Q R ----:----|----:----|----:----|----:----|----:----|----:----| D G I S L V L A V L I A M L A T P K M L M E L Q Y F L L W * F P W * L Q R S * * R W N I S C S G S S H G N F S D A E D F TseI AluI AluI CviJI CviJI |BisI |BsiI* ||BlsI ||SetI ||SetI ||| TseI ||| BsrDI ||| MwoI MboII ||| | MwoI ||| |BisI Eco57I EcoP15I ||| | | BbvI ||| ||BlsI Eco57MI | EcoP15I \\\ \ \ \ \\\ \\\ \ \ \ GACAACCAAGCTGCCATTGCTGAAGCTCGTGCTGCCGAAGAAAACTTCAACGCTGATGAC 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTGGTTCGACGGTAACGACTTCGAGCACGACGGCTTCTTTTGAAGTTGCGACTACTG / / //// // / / / /// / / / / BbvI | |||MwoI || | | | ||TseI Eco57MI | | EcoP15I | |||TseI || | | | |BisI Eco57I | EcoP15I | ||BsrDI || | | | BlsI MboII | ||BisI || | | BsiI* | |BlsI || | MwoI | CviJI || CviJI | AluI || AluI SetI |SetI BbvI D N Q A A I A E A R A A E E N F N A D D T T K L P L L K L V L P K K T S T L M T Q P S C H C * S S C C R R K L Q R * * Q ----:----|----:----|----:----|----:----|----:----|----:----| S L W A A M A S A R A A S S F K L A S S L C G L Q W Q Q L E H Q R L F S * R Q H V V L S G N S F S T S G F F V E V S I V Hpy166II | FatI | AflIII Hpy188I | BspLU11I* | TseI | |CviAII | |BisI | || NspI | ||BlsI | || NlaIII BbvI | BtsI ||TspRI MseI | || | Hpy166II \ \ \ \\\ \ \ \\ \ \ AAGACCATTTCTGACACTGCTGCTGTCGTTGGTGTTAAGGGTTCACATGTCGTTTACAAC 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTGGTAAAGACTGTGACGACGACAGCAACCACAATTCCCAAGTGTACAGCAAATGTTG /// /// / / / // / ||TspRI ||TseI MseI | | || Hpy166II ||BtsI |BisI | | |BspLU11I* |Hpy188I BlsI | | |AflIII BbvI | | |FatI | | CviAII | NlaIII | NspI Hpy166II K T I S D T A A V V G V K G S H V V Y N R P F L T L L L S L V L R V H M S F T T D H F * H C C C R W C * G F T C R L Q L ----:----|----:----|----:----|----:----|----:----|----:----| L V M E S V A A T T P T L P E C T T * L C S W K Q C Q Q Q R Q H * P N V H R K C L G N R V S S S D N T N L T * M D N V V FatI TspDTI BsmI |CviAII Eco57I MfeI || NlaIII Eco57MI TspEI || |MslI | SetI \ \\ \\ \ \ TCCATTAGACAATTGTATGACTATGAAACTGAAGTTTCCATGAGAATGCCAAAGGTCATT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTAATCTGTTAACATACTGATACTTTGACTTCAAAGGTACTCTTACGGTTTCCAGTAA / / / /// / / / TspEI | | ||MslI | SetI TspRI MfeI | | |FatI Eco57MI | | CviAII Eco57I | NlaIII BsmI TspDTI S I R Q L Y D Y E T E V S M R M P K V I P L D N C M T M K L K F P * E C Q R S F H * T I V * L * N * S F H E N A K G H S ----:----|----:----|----:----|----:----|----:----|----:----| E M L C N Y S * S V S T E M L I G F T M S W * V I T H S H F Q L K W S F A L P * G N S L Q I V I F S F N G H S H W L D N BsrI TspRI |Cac8I || AluI || CviJI || |MlyI HinfI || |PleI |MmeI MboII || ||SetI || BsrDI BstXI | MseI \\ \\\ \\ \ \ \ \ CACTGGCAAGCTACCAGACTCATTGCTGACCATTTGGTTGGAAGAAAGAGAGTTGATTAA 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| GTGACCGTTCGATGGTCTGAGTAACGACTGGTAAACCAACCTTCTTTCTCTCAACTAATT / / /// / / / / / / | | ||| | | HinfI BstXI MboII MseI | | ||| | BsrDI | | ||| MmeI | | ||PleI | | |MlyI | | CviJI | | AluI | Cac8I | SetI BsrI H W Q A T R L I A D H L V G R K R V D * T G K L P D S L L T I W L E E R E L I X L A S Y Q T H C * P F G W K K E S * L X ----:----|----:----|----:----|----:----|----:----|----:----| * Q C A V L S M A S W K T P L F L T S * E S A L * W V * Q Q G N P Q F F S L Q N V P L S G S E N S V M Q N S S L S N I L # Enzymes that cut Frequency Isoschizomers AatII 2 Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 6 BspACI,SsiI AclI 2 Psp1406I AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AhaIII* 1 DraI AjuI 2 AluI 18 AluBI AlwNI 2 CaiI ApoI 4 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 2 BalI 2 MlsI,MluNI,MscI,Msp20I BarI 2 BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 9 Bce83I* 4 BpuEI BceAI 4 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmgT120I 2 Bpu10I 1 BsaXI 2 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 3 BseRI 1 BseSI 1 BaeGI,BstSLI BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 7 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 4 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp1407I 2 BsrGI,BstAUI BspCNI 3 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BsrBI 1 AccBSI,MbiI BsrDI 2 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstAPI 1 BstKTI 10 BstXI 3 BtsI 3 Cac8I 3 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 12 CviQI,RsaNI CspCI 1 CviAII 8 CviJI 48 CviKI-1 CviRI* 4 HpyCH4V DdeI 9 BstDEI,HpyF3I DpnI 10 MalI DsaI* 3 BtgI,BstDSI Eco57I 6 AcuI Eco57MI 12 EcoNI 1 BstENI,XagI EcoP15I 8 EcoRI 2 EcoRII 3 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 8 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GlaI 1 GsuI 6 BpmI HaeIII 7 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 8 Hin4II* 12 HpyAV Hin6I 1 HinP1I,HspAI HindII 3 HincII HindIII 2 HinfI 10 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 11 Hpy8I Hpy178III* 13 Hpy188III Hpy188I 7 Hpy99I 1 KpnI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 10 MboI 10 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 12 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 4 MunI MlyI 4 SchI MmeI 3 MnlI 11 MseI 11 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 20 HpyF10VI,BstMWI NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 2 BstNSI,XceI PflMI 3 BasI,AccB7I,Van91I PleI 4 PpsI PsiI 1 AanI PsrI 2 PvuII 1 RsaI 12 AfaI SapI 1 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 7 BseDI,BssECI,BsaJI SetI 50 SfaNI 3 LweI SmlI 4 SmoI SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 7 TaqI 6 TaqII 2 TatI 3 TfiI 6 PfeI TseI 5 ApeKI TsoI 4 Tsp45I 6 NmuCI Tsp4CI* 10 HpyCH4III,TaaI,Bst4CI TspDTI 12 TspEI 17 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 7 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI XcmI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I ZraI 2 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI AflII AgeI AlfI AloI ApaI ApaLI AscI AvaI AvrII BamHI BbvCI BcgI BdaI BglI BmeT110I BmtI BplI BsaAI BsaBI BsePI BseYI BsgI Bsp120I BspMI BspMII* BspOI BssNAI Bst1107I BstEII BstZ17I BtgZI BtrI CauII* Cfr9I DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoRV EcoT22I EgeI EheI Esp3I FalI FauI FseI FspAI GsaI HaeII HgiJII* KasI MauBI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PstI PvuI RsrII SacI SacII SalI SanDI ScaI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TauI TspMI TstI XbaI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769