Restriction Map of TOM40/YMR203W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

TOM40/YMR203W on chromosome XIII from coordinates 668492 to 669655.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.10495

BssKI | HpaII | ScrFI | CauII* | | AsuI* StuI ApoI | | |CviJI CviJI TspEI | | |HaeIII CviRI* MnlI HaeIII | MnlI | | |BmgT120I \ \ \ \ \ \ \ \\ ATGTCTGCACCAACTCCATTAGCAGAGGCCTCTCAAATTCCCACTATCCCGGCCCTTTCT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGACGTGGTTGAGGTAATCGTCTCCGGAGAGTTTAAGGGTGATAGGGCCGGGAAAGA / / / // ///// CviRI* MnlI HaeIII |TspEI ||||AsuI* CviJI |ApoI |||BmgT120I StuI MnlI ||HaeIII ||BssKI ||CviJI |HpaII CauII* ScrFI M S A P T P L A E A S Q I P T I P A L S C L H Q L H * Q R P L K F P L S R P F L V C T N S I S R G L S N S H Y P G P F S ----:----|----:----|----:----|----:----|----:----|----:----| X D A G V G N A S A E * I G V I G A R E X T Q V L E M L L P R E F E W * G P G K H R C W S W * C L G R L N G S D R G K R StyI SecI* | MboII MaeI | | ApoI | AluI | | BseRI | CviJI | | TspEI AjuI | | SetI AjuI | | | XmnI | MnlI | | | BciVI \ \ \ \ \ \ \ \ \ \ \ CCTTTGACTGCGAAGCAATCCAAGGGGAATTTCTTCTCCTCAAACCCAATATCTAGCTTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAACTGACGCTTCGTTAGGTTCCCCTTAAAGAAGAGGAGTTTGGGTTATAGATCGAAA / /// / / / /// / AjuI ||BseRI TspEI AjuI MnlI ||| BciVI |SecI* XmnI ||CviJI |StyI ApoI ||AluI MboII |MaeI SetI P L T A K Q S K G N F F S S N P I S S F L * L R S N P R G I S S P Q T Q Y L A L F D C E A I Q G E F L L L K P N I * L C ----:----|----:----|----:----|----:----|----:----|----:----| G K V A F C D L P F K K E E F G I D L K E K S Q S A I W P S N R R R L G L I * S R Q S R L L G L P I E E G * V W Y R A K MaeII |BsaAI |SnaBI ||Csp6I MfeI BssKI |||RsaI TspEI AluI | HpaII |||SetI | BsmI CviJI | ScrFI |||TaiI | CviRI* | SetI | CauII* \\\\ \ \ \ \ \ \ GTTGTGGATACGTACAAACAATTGCATTCTCACAGACAATCTTTGGAGCTGGTCAATCCC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CAACACCTATGCATGTTTGTTAACGTAAGAGTGTCTGTTAGAAACCTCGACCAGTTAGGG / //// /// / / / | |||Csp6I ||CviRI* | CviJI CauII* | ||RsaI |TspEI | AluI ScrFI | |MaeII |MfeI SetI | SnaBI BsmI | BsaAI TaiI SetI V V D T Y K Q L H S H R Q S L E L V N P L W I R T N N C I L T D N L W S W S I P C G Y V Q T I A F S Q T I F G A G Q S R ----:----|----:----|----:----|----:----|----:----|----:----| T T S V Y L C N C E * L C D K S S T L G Q Q P Y T C V I A N E C V I K P A P * D N H I R V F L Q M R V S L R Q L Q D I G Acc65I HgiCI* BsmAI |Csp6I |MaeIII ||RsaI |Tsp45I ||NlaIV || MaeII ||| KpnI || AflIII ||| SecI* SetI || |BtrI DdeI ||| DsaI* | EcoNI || || SetI | BsmAI ||| |Tsp4CI* | | BsiYI* || || TaiI | |HphI \\\ \\ \ \ \ \\ \\ \ \ \\ GGTACCGTGGAAAACCTGAATAAGGAAGTCTCCCGTGACGTGTTTTTGTCTCAGTATTTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGGCACCTTTTGGACTTATTCCTTCAGAGGGCACTGCACAAAAACAGAGTCATAAAA ///// / / / / / // / / / ||||| | SetI | EcoNI | || AflIII | BsmAI ||||| DsaI* BsiYI* | |MaeII DdeI ||||| SecI* | Tsp45I HphI ||||Tsp4CI* | MaeIII ||||HgiCI* | BtrI ||||Acc65I BsmAI |||Csp6I TaiI ||NlaIV SetI ||RsaI |BssKI HpaII KpnI G T V E N L N K E V S R D V F L S Q Y F V P W K T * I R K S P V T C F C L S I F Y R G K P E * G S L P * R V F V S V F F ----:----|----:----|----:----|----:----|----:----|----:----| P V T S F R F L S T E R S T N K D * Y K R Y R P F G S Y P L R G H R T K T E T N T G H F V Q I L F D G T V H K Q R L I K BspCNI |BssKI |BseMII ||HpaII FatI |||ScrFI |CviAII |||CauII* AluI || TfiI |||| CviJI CviJI || HinfI |||| |DdeI | SetI || NlaIII TspDTI \\\\ \\ \ \ \\ \ \ TTCACCGGGCTAAGAGCTGATTTGAATAAGGCATTTTCCATGAATCCTGCTTTTCAAACC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTGGCCCGATTCTCGACTAAACTTATTCCGTAAAAGGTACTTAGGACGAAAAGTTTGG // / / // / / // / / / || | | || CviJI | || HinfI | SetI || | | || AluI | || TfiI TspDTI || | | |SetI | |FatI || | | DdeI | CviAII || | BssKI NlaIII || | CviJI || CauII* || HpaII || ScrFI |BseMII BspCNI F T G L R A D L N K A F S M N P A F Q T S P G * E L I * I R H F P * I L L F K P H R A K S * F E * G I F H E S C F S N L ----:----|----:----|----:----|----:----|----:----|----:----| K V P S L A S K F L A N E M F G A K * V K * R A L L Q N S Y P M K W S D Q K E F E G P * S S I Q I L C K G H I R S K L G BsrDI | BsaXI | | DdeI | | | Csp6I SetI | | | |RsaI MwoI MwoI SetI MnlI SfeI* NlaIV | | | || BsmI |AciI BstAPI \ \ \ \ \ \ \ \\ \ \\ \ TCACACACTTTCTCTATAGGTTCCCAAGCATTGCCTAAGTACGCATTCTCCGCATTGTTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGTGTGAAAGAGATATCCAAGGGTTCGTAACGGATTCATGCGTAAGAGGCGTAACAAA / // / / / / // / / / / MnlI || | | BsaXI | || MwoI | | BsaXI || | BsrDI | |Csp6I | BstAPI || NlaIV | |BsmI | MwoI |SfeI* | RsaI AciI SetI DdeI S H T F S I G S Q A L P K Y A F S A L F H T L S L * V P K H C L S T H S P H C L T H F L Y R F P S I A * V R I L R I V C ----:----|----:----|----:----|----:----|----:----|----:----| E C V K E I P E W A N G L Y A N E A N N R V C K R * L N G L M A * T R M R R M T * V S E R Y T G L C Q R L V C E G C Q K BsaXI BetI* | Bce83I* SetI SmlI SetI TaqI |HpaII \ \ \ \ \ \ \\ GCCAACGATAACCTATTTGCTCAAGGTAATATCGACAACGATTTATCTGTTTCCGGTAGA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTGCTATTGGATAAACGAGTTCCATTATAGCTGTTGCTAAATAGACAAAGGCCATCT / / // / // | SetI |SmlI TaqI |BetI* Bce83I* SetI HpaII A N D N L F A Q G N I D N D L S V S G R P T I T Y L L K V I S T T I Y L F P V D Q R * P I C S R * Y R Q R F I C F R * I ----:----|----:----|----:----|----:----|----:----|----:----| A L S L R N A * P L I S L S K D T E P L Q W R Y G I Q E L Y Y R C R N I Q K R Y G V I V * K S L T I D V V I * R N G T S BccI |EcoRV SetI || Hpy188I |HindII || | CfrI |Hpy166II || | | BalI || SfeI* || | | CviJI MseI DdeI || |SetI || | | HaeIII \ \ \\ \\ \\ \ \ \ TTAAACTATGGTTGGGATAAGAAAAACATTTCTAAGGTCAACCTACAGATATCAGATGGC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTGATACCAACCCTATTCTTTTTGTAAAGATTCCAGTTGGATGTCTATAGTCTACCG / // // / / / / MseI || |SetI | | | HaeIII || | | | | CviJI || | | | | BalI || | | | Hpy188I || | | EcoRV || | | BccI || | SfeI* || Hpy166II || HindII |DdeI SetI L N Y G W D K K N I S K V N L Q I S D G * T M V G I R K T F L R S T Y R Y Q M A K L W L G * E K H F * G Q P T D I R W P ----:----|----:----|----:----|----:----|----:----|----:----| N F * P Q S L F F M E L T L R C I D S P I L S H N P Y S F C K * P * G V S I L H * V I T P I L F V N R L D V * L Y * I A Hpy166II | MaeII CviJI | | SetI | Hpy188I | | TaiI \ \ \ \ \ CAACCAACAATGTGTCAGTTAGAACAAGACTATCAGGCTTCCGATTTTTCTGTGAACGTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGGTTGTTACACAGTCAATCTTGTTCTGATAGTCCGAAGGCTAAAAAGACACTTGCAT / / / // / CfrI | Hpy188I || MaeII CviJI |TaiI |SetI Hpy166II Q P T M C Q L E Q D Y Q A S D F S V N V N Q Q C V S * N K T I R L P I F L * T * T N N V S V R T R L S G F R F F C E R K ----:----|----:----|----:----|----:----|----:----|----:----| W G V I H * N S C S * * A E S K E T F T G V L L T D T L V L S D P K R N K Q S R L W C H T L * F L V I L S G I K R H V Y BseMII |BspCNI || Hin4II* || | DdeI ApoI || | Hin4II* TspEI || | |Hpy188I EcoRI SetI CviRI* \\ \ \\ \ \ \ AAGACATTGAACCCTTCGTTCTCTGAGAAGGGCGAATTCACAGGTGTTGCTGTTGCATCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTGTAACTTGGGAAGCAAGAGACTCTTCCCGCTTAAGTGTCCACAACGACAACGTAGA // / // / / / / |BspCNI | || DdeI | SetI CviRI* BseMII | |Hpy188I EcoRI | Hin4II* TspEI Hin4II* ApoI K T L N P S F S E K G E F T G V A V A S R H * T L R S L R R A N S Q V L L L H L D I E P F V L * E G R I H R C C C C I F ----:----|----:----|----:----|----:----|----:----|----:----| F V N F G E N E S F P S N V P T A T A D L S M S G K T R Q S P R I * L H Q Q Q M L C Q V R R E R L L A F E C T N S N C R AluI SfaNI CviJI GsuI Hpy178III* | BseRI |MnlI SetI | GsuI | | MaeIII TspEI ||SetI Eco57MI | Eco57MI \ \ \ \ \\\ \ \ \ TTTCTACAAAGTGTTACTCCTCAATTAGCTTTAGGTTTAGAAACTTTATACTCCAGAACT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGATGTTTCACAATGAGGAGTTAATCGAAATCCAAATCTTTGAAATATGAGGTCTTGA / / / / / / / // | SfaNI MaeIII | | | Eco57MI |Hpy178III* BseRI | | | GsuI Eco57MI | | SetI GsuI | CviJI | MnlI | AluI TspEI SetI F L Q S V T P Q L A L G L E T L Y S R T F Y K V L L L N * L * V * K L Y T P E L S T K C Y S S I S F R F R N F I L Q N * ----:----|----:----|----:----|----:----|----:----|----:----| K R C L T V G * N A K P K S V K Y E L V K E V F H * E E I L K L N L F K I S W F K * L T N S R L * S * T * F S * V G S S Tsp4CI* | Hin6I | |GlaI | |SfaNI | |Eco47III | ||HhaI | |||HaeII | ||||BssKI | ||||EcoRII | ||||| ScrFI | ||||| BseBI | ||||| | SetI MlyI | ||||| | | TspDTI HphI PleI HinfI BsmAI \ \\\\\ \ \ \ \ \ \ \ GACGGTAGCGCTCCAGGTGATGCTGGTGTTTCATACTTGACTCGTTATGTCTCCAAGAAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCCATCGCGAGGTCCACTACGACCACAAAGTATGAACTGAGCAATACAGAGGTTCTTC / //// /// // / // / / | |||| ||| |TspDTI HphI |PleI HinfI BsmAI | |||| ||| EcoRII MlyI | |||| ||| BssKI | |||| ||BseBI | |||| ||ScrFI | |||| |SetI | |||| SfaNI | |||Hin6I | ||Eco47III | ||GlaI | |HhaI | HaeII Tsp4CI* D G S A P G D A G V S Y L T R Y V S K K T V A L Q V M L V F H T * L V M S P R S R * R S R * C W C F I L D S L C L Q E A ----:----|----:----|----:----|----:----|----:----|----:----| S P L A G P S A P T E Y K V R * T E L F Q R Y R E L H H Q H K M S S E N H R W S V T A S W T I S T N * V Q S T I D G L L AsuI* |BmgT120I ||CviJI ||HaeIII ||| MfeI ||| TspEI ||| | CviRI* ||| | | Cac8I ||| | | | CviJI ||| | | | | BtgZI ||| | | | | | MwoI ||| | | | | | Tsp4CI* ||| | | | | | | MseI ||| | | | | | | |TspEI ||| | | | | | | || MwoI ||| | | | | | | || | CviRI* ||| | | | | | | || | | MslI ||| | | | | | | || | | | SfaNI \\\ \ \ \ \ \ \ \\ \ \ \ \ CAAGATTGGATTTTTTCGGGCCAATTGCAAGCCAACGGTGCTTTAATTGCATCGCTATGG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTAACCTAAAAAAGCCCGGTTAACGTTCGGTTGCCACGAAATTAACGTAGCGATACC // // / / / / / / / // / || || | | | | | | | || MslI || || | | | | | | | |CviRI* || || | | | | | | | TspEI || || | | | | | | MseI || || | | | | | MwoI || || | | | | BtgZI || || | | | Tsp4CI* || || | | MwoI || || | CviJI || || Cac8I || |CviRI* || TspEI || MfeI |AsuI* BmgT120I HaeIII CviJI Q D W I F S G Q L Q A N G A L I A S L W K I G F F R A N C K P T V L * L H R Y G R L D F F G P I A S Q R C F N C I A M E ----:----|----:----|----:----|----:----|----:----|----:----| C S Q I K E P W N C A L P A K I A D S H A L N S K K P G I A L W R H K L Q M A I L I P N K R A L Q L G V T S * N C R * P MnlI AluI |BspMI SetI CviJI || TaqI | TaqI | SetI NlaIV \\ \ \ \ \ \ \ AGAAAAGTAGCACAAAATGTCGAGGCAGGTATCGAAACTACATTACAAGCTGGTATGGTT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTTCATCGTGTTTTACAGCTCCGTCCATAGCTTTGATGTAATGTTCGACCATACCAA / / / / / / / / / SfaNI MnlI | | SetI TaqI | CviJI NlaIV | TaqI | AluI BspMI SetI R K V A Q N V E A G I E T T L Q A G M V E K * H K M S R Q V S K L H Y K L V W F K S S T K C R G R Y R N Y I T S W Y G S ----:----|----:----|----:----|----:----|----:----|----:----| L F T A C F T S A P I S V V N C A P I T S F L L V F H R P L Y R F * M V L Q Y P S F Y C L I D L C T D F S C * L S T H N BinI* | MboI BsiYI* Hin4I | Hin4I | SduI | MnlI | | DpnI | BseSI | SetI | | |BccI | | MfeI | | Tsp4CI* | | |BstKTI | | TspEI | | | TaqI \ \ \\ \ \ \ \ \ \ \ CCTATTACTGATCCATTGATGGGCACTCCAATTGGTATTCAACCTACTGTCGAGGGTTCT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGATAATGACTAGGTAACTACCCGTGAGGTTAACCATAAGTTGGATGACAGCTCCCAAGA // // / / / / / / / / / || || | | BseSI | | | | | TaqI || || | | SduI | | | | Tsp4CI* || || | BsiYI* | | | MnlI || || MboI | | SetI || || BccI | Hin4I || |DpnI TspEI || BstKTI MfeI |BinI* Hin4I P I T D P L M G T P I G I Q P T V E G S L L L I H * W A L Q L V F N L L S R V L Y Y * S I D G H S N W Y S T Y C R G F Y ----:----|----:----|----:----|----:----|----:----|----:----| G I V S G N I P V G I P I * G V T S P E E * * Q D M S P C E L Q Y E V * Q R P N R N S I W Q H A S W N T N L R S D L T R Csp6I TfiI DdeI TspDTI |RsaI HinfI \ \ \\ \ ACCACTATTGGTGCTAAGTATGAATACAGACAATCTGTATATCGTGGTACATTAGATTCC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTGATAACCACGATTCATACTTATGTCTGTTAGACATATAGCACCATGTAATCTAAGG / / // / DdeI TspDTI |Csp6I HinfI RsaI TfiI T T I G A K Y E Y R Q S V Y R G T L D S P L L V L S M N T D N L Y I V V H * I P H Y W C * V * I Q T I C I S W Y I R F Q ----:----|----:----|----:----|----:----|----:----|----:----| V V I P A L Y S Y L C D T Y R P V N S E * W * Q H * T H I C V I Q I D H Y M L N G S N T S L I F V S L R Y I T T C * I G SetI | FatI | CviRI* | |CviAII | || NspI | || NlaIII | || | XbaI | || | |MaeI BdaI | || | |Hpy178III* TspGWI BdaI \ \\ \ \\ \ \ AATGGTAAGGTTGCATGTTTTCTAGAAAGAAAAGTTCTGCCAACTCTGTCCGTTTTATTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCATTCCAACGTACAAAAGATCTTTCTTTTCAAGACGGTTGAGACAGGCAAAATAAA / / // // / / SetI | |FatI |XbaI TspGWI BdaI | CviAII Hpy178III* BdaI CviRI* MaeI NlaIII NspI N G K V A C F L E R K V L P T L S V L F M V R L H V F * K E K F C Q L C P F Y F W * G C M F S R K K S S A N S V R F I L ----:----|----:----|----:----|----:----|----:----|----:----| L P L T A H K R S L F T R G V R D T K N W H Y P Q M N E L F F L E A L E T R K I I T L N C T K * F S F N Q W S Q G N * K TaqI ClaI |MboI || DpnI || |BstKTI AciI || || Hpy178III* | AccI || || | BdaI | |Hpy166II AciI || ||HphI | BdaI EcoP15I | || TspEI \ \\ \\\ \ \ \ \ \\ \ TGCGGTGAAATCGATCATTTCAAGAACGATACCAAGATTGGTTGCGGTCTACAATTTGAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| ACGCCACTTTAGCTAGTAAAGTTCTTGCTATGGTTCTAACCAACGCCAGATGTTAAACTT / //// / / / / // / AciI |||MboI | BdaI EcoP15I | |AccI TspEI ||HphI | BdaI | Hpy166II |DpnI Hpy178III* AciI BstKTI ClaI TaqI C G E I D H F K N D T K I G C G L Q F E A V K S I I S R T I P R L V A V Y N L K R * N R S F Q E R Y Q D W L R S T I * N ----:----|----:----|----:----|----:----|----:----|----:----| Q P S I S * K L F S V L I P Q P R C N S K R H F R D N * S R Y W S Q N R D V I Q A T F D I M E L V I G L N T A T * L K F HgaI MaeIII Hpy178III* SetI BstEII | TspEI MaeIII | BccI | BsrDI \ \ \ \ \ \ \ ACTGCTGGTAATCAAGAATTACTAATGTTACAACAAGGTTTAGACGCAGATGGTAACCCA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGACGACCATTAGTTCTTAATGATTACAATGTTGTTCCAAATCTGCGTCTACCATTGGGT / / / / / // / | TspEI | SetI BccI || MboII Hpy178III* MaeIII |BstEII |MaeIII |HgaI BsrDI T A G N Q E L L M L Q Q G L D A D G N P L L V I K N Y * C Y N K V * T Q M V T H C W * S R I T N V T T R F R R R W * P I ----:----|----:----|----:----|----:----|----:----|----:----| V A P L * S N S I N C C P K S A S P L G F Q Q Y D L I V L T V V L N L R L H Y G S S T I L F * * H * L L T * V C I T V W MboII | CviRI* | | Cac8I SapI | | | AluI Ksp632I* | | | CviJI | MfeI | | | | SetI | TspEI MnlI \ \ \ \ \ \ \ \ TTGCAAGCTCTTCCTCAATTGTGA 1150 1160 ----:----|----:----|---- AACGTTCGAGAAGGAGTTAACACT / / / / / / | | CviJI | | MnlI | | AluI | TspEI | Cac8I | MfeI | SetI Ksp632I* CviRI* SapI L Q A L P Q L * C K L F L N C X A S S S S I V X ----:----|----:----|---- N C A R G * N H M A L E E E I T Q L S K R L Q S # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AflIII 1 AjuI 1 AluI 6 AluBI ApoI 3 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I BalI 1 MlsI,MluNI,MscI,Msp20I BccI 3 Bce83I* 1 BpuEI BciVI 1 BfuI BdaI 2 BetI* 1 BsaWI BinI* 1 AlwI,BspPI,AclWI BmgT120I 2 BsaAI 1 BstBAI,Ppu21I BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseMII 2 BseRI 2 BseSI 1 BaeGI,BstSLI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 3 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 2 BspMI 1 BfuAI,Acc36I,BveI BsrDI 2 BseMI,Bse3DI BssKI 4 BstSCI,StyD4I BstAPI 1 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 2 BtgZI 1 BtrI 1 BmgBI,AjiI Cac8I 2 BstC8I CauII* 3 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 2 CviJI 13 CviKI-1 CviRI* 7 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 2 MalI DsaI* 1 BtgI,BstDSI Eco47III 1 Aor51HI,AfeI Eco57MI 2 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FatI 2 GlaI 1 GsuI 2 BpmI HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 2 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 3 HpaII 4 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 3 KpnI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 4 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 MfeI 4 MunI MlyI 1 SchI MnlI 8 MseI 2 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PleI 1 PpsI RsaI 4 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 23 SfaNI 3 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI SnaBI 1 Eco105I,BstSNI StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 5 TfiI 2 PfeI Tsp45I 1 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 1 XbaI 1 XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AcyI AflII AgeI AhaIII* AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvaI AvaII AvrII BaeI BamHI BarI BbvCI BbvI BbvII* BceAI BcgI BclI BfiI BglI BglII BisI BlsI BmeT110I BmtI BplI Bpu10I BsaBI BseGI BsePI BseYI BsgI BsiI* BslFI BsmFI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrBI BsrI BssNAI Bst1107I BstF5I BstXI BstZ17I BtsCI BtsI Cfr10I Cfr9I CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco57I EcoICRI EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI Fnu4HI FnuDII* FokI FseI FspAI GsaI HgiAI* HgiJII* HindIII HpaI Hpy99I KasI MauBI McrI* MluI MmeI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI SwaI TaqII TatI TauI TseI TsoI TspMI TspRI TstI Tth111I VspI XcmI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769