Restriction Map of ILV2/YMR108W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

ILV2/YMR108W on chromosome XIII from coordinates 484084 to 486147.


MboI BclI | DpnI | |BstKTI FalI FalI | || Hpy188I FalI MseI FalI \ \\ \ \ \ \ ATGATCAGACAATCTACGCTAAAAAACTTCGCTATTAAGCGTTGCTTTCAACATATAGCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTAGTCTGTTAGATGCGATTTTTTGAAGCGATAATTCGCAACGAAAGTTGTATATCGT // / / / / || Hpy188I FalI MseI FalI || BclI FalI FalI || MboI |DpnI BstKTI M I R Q S T L K N F A I K R C F Q H I A * S D N L R * K T S L L S V A F N I * H D Q T I Y A K K L R Y * A L L S T Y S I ----:----|----:----|----:----|----:----|----:----|----:----| X I L C D V S F F K A I L R Q K * C I A X S * V I * A L F S R * * A N S E V Y L H D S L R R * F V E S N L T A K L M Y C SetI | FatI | |CviAII | || AarI | || BspMI | || NlaIII | || |MboI | || || DpnI | || || |BstKTI | || || || AluI | || || || CviJI | || || || | SetI | || || || | | Hin6I | || || || | | FnuDII* | || || || | | |GlaI | || || || | | ||TseI | || || || | | ||HhaI | || || || | | |||BisI | || || || | | ||||BlsI | || || || | | |||||Hin6I | || || || | | ||||||GlaI | || || || | | ||||||Eco47III | || || || | | |||||||HhaI | || || || | | ||||||||HaeII | || || || | | ||||||||| MboII | || || || | | ||||||||| BbvII* AciI | || || || | | ||||||||| |BbvI \ \ \\ \\ \\ \ \ \\\\\\\\\ \\ TACCGCAACACACCTGCCATGAGATCAGTAGCTCTCGCGCAGCGCTTTTATAGTTCGTCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGCGTTGTGTGGACGGTACTCTAGTCATCGAGAGCGCGTCGCGAAAATATCAAGCAGA / / / // //// / / //////// / // AciI SetI | || |||| | CviJI |||||||| | |BbvI | || |||| | AluI |||||||| | BbvII* | || |||| SetI |||||||| MboII | || |||MboI |||||||Hin6I | || ||BspMI ||||||Eco47III | || ||AarI ||||||GlaI | || |DpnI |||||TseI | || BstKTI |||||HhaI | |FatI ||||HaeII | CviAII ||||BisI NlaIII |||BlsI ||Hin6I |GlaI FnuDII* HhaI Y R N T P A M R S V A L A Q R F Y S S S T A T H L P * D Q * L S R S A F I V R L P Q H T C H E I S S S R A A L L * F V F ----:----|----:----|----:----|----:----|----:----|----:----| Y R L V G A M L D T A R A C R K * L E D M G C C V Q W S I L L E R A A S K Y N T V A V C R G H S * Y S E R L A K I T R R CviJI | EcoNI | | BsiYI* | | | MnlI | | | CviJI Tsp4CI* | | | HaeIII | TspRI | | | | CviJI | | BsmAI | | | | |AlwNI HgaI | | Esp3I | | | | ||Cac8I \ \ \ \ \ \ \ \ \\\ TCCCGTTATTACAGTGCGTCTCCATTACCAGCCTCTAAAAGGCCAGAGCCTGCTCCAAGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGGGCAATAATGTCACGCAGAGGTAATGGTCGGAGATTTTCCGGTCTCGGACGAGGTTCA // / / / / / // / / / || Tsp4CI* | | | | || | | Cac8I |HgaI | | | | || | CviJI TspRI | | | | || AlwNI | | | | |HaeIII | | | | |CviJI | | | | MnlI | | | EcoNI | | BsiYI* | CviJI Esp3I BsmAI S R Y Y S A S P L P A S K R P E P A P S P V I T V R L H Y Q P L K G Q S L L Q V P L L Q C V S I T S L * K A R A C S K F ----:----|----:----|----:----|----:----|----:----|----:----| E R * * L A D G N G A E L L G S G A G L K G N N C H T E M V L R * F A L A Q E L G T I V T R R W * W G R F P W L R S W T CviJI | AciI | Cac8I | | NspBII* | | | FauI | | | |TsoI | | | || SetI BseMII BinI* | | | || | TspEI |BspCNI | MboI | | | || | | Hin4II* || Hin6I | | DpnI | | | || | | | CviJI || FnuDII* | | |BstKTI | | | || | | | |DdeI || |GlaI \ \ \\ \ \ \ \\ \ \ \ \\ \\ \\ TTCAATGTTGATCCATTAGAACAGCCCGCTGAACCTTCAAAATTGGCTAAGAAACTACGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTACAACTAGGTAATCTTGTCGGGCGACTTGGAAGTTTTAACCGATTCTTTGATGCG / // / / / / / / // / /// // | || MboI | | | | FauI || | ||BspCNI |GlaI | |DpnI | | | SetI || | |BseMII FnuDII* | BstKTI | | | TsoI || | DdeI HhaI BinI* | | NspBII* || CviJI | | AciI |TspEI | Cac8I Hin4II* CviJI F N V D P L E Q P A E P S K L A K K L R S M L I H * N S P L N L Q N W L R N Y A Q C * S I R T A R * T F K I G * E T T R ----:----|----:----|----:----|----:----|----:----|----:----| K L T S G N S C G A S G E F N A L F S R N * H Q D M L V A R Q V K L I P * S V V E I N I W * F L G S F R * F Q S L F * A HhaI |DdeI |EspI* || CviJI || | BciVI || | | FatI MnlI || | | |CviAII |Hpy99I SspI || | | || NlaIII SetI || MseI BsrI | MseI \\ \ \ \\ \ \ \\ \ \ \ \ GCTGAGCCTGACATGGATACCTCTTTCGTCGGTTTAACTGGTGGTCAAATATTTAACGAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTCGGACTGTACCTATGGAGAAAGCAGCCAAATTGACCACCAGTTTATAAATTGCTT / // / / // / / / / / / / | || | | || SetI | MnlI | BsrI SspI MseI | || | | |FatI Hpy99I MseI | || | | CviAII | || | NlaIII | || BciVI | |CviJI | EspI* | DdeI Hin6I A E P D M D T S F V G L T G G Q I F N E L S L T W I P L S S V * L V V K Y L T K * A * H G Y L F R R F N W W S N I * R N ----:----|----:----|----:----|----:----|----:----|----:----| A S G S M S V E K T P K V P P * I N L S R Q A Q C P Y R K R R N L Q H D F I * R S L R V H I G R E D T * S T T L Y K V F Hpy178III* | AclI | MaeII BssKI | | SetI EcoRII | | TaiI | ScrFI | | | TsoI | BseBI SfaNI | | | | Tsp4CI* | | SetI | SetI \ \ \ \ \ \ \ \ \ \ ATGATGTCCAGACAAAACGTTGATACTGTATTTGGTTATCCAGGTGGTGCTATCCTACCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TACTACAGGTCTGTTTTGCAACTATGACATAAACCAATAGGTCCACCACGATAGGATGGA / / / / / // / / | | | TsoI Tsp4CI* || EcoRII SetI | | MaeII || BssKI | | AclI |BseBI | TaiI |ScrFI | SetI SetI Hpy178III* M M S R Q N V D T V F G Y P G G A I L P * C P D K T L I L Y L V I Q V V L S Y L D V Q T K R * Y C I W L S R W C Y P T C ----:----|----:----|----:----|----:----|----:----|----:----| I I D L C F T S V T N P * G P P A I R G F S T W V F R Q Y Q I Q N D L H H * G V H H G S L V N I S Y K T I W T T S D * R MslI | Tsp4CI* | | TspRI Hpy166II | | |ApoI |TspDTI | | |TspEI MboII BcgI \\ \ \ \\ \ \ GTTTACGATGCCATTCATAACAGTGATAAATTCAACTTCGTTCTTCCAAAACACGAACAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CAAATGCTACGGTAAGTATTGTCACTATTTAAGTTGAAGCAAGAAGGTTTTGTGCTTGTT /// / // // / / ||Hpy166II | |Tsp4CI* |MboII BcgI SetI |TspDTI | MslI TspEI SfaNI TspRI ApoI V Y D A I H N S D K F N F V L P K H E Q F T M P F I T V I N S T S F F Q N T N K L R C H S * Q * * I Q L R S S K T R T R ----:----|----:----|----:----|----:----|----:----|----:----| T * S A M * L L S L N L K T R G F C S C Q K R H W E Y C H Y I * S R E E L V R V N V I G N M V T I F E V E N K W F V F L HgiCI* | SetI | NlaIV | |Cfr10I | ||HpaII Hpy166II | ||| MaeIII | BssKI | ||| Tsp45I | SexAI | ||| | FatI | EcoRII | ||| | |CviAII | | ScrFI | ||| | ||Hin4II* AluI | | BseBI | ||| | ||| NlaIII CviJI | | | TsoI | ||| | ||| | BcgI CviJI | SetI | | | | SetI MaeIII \ \\\ \ \\\ \ \ \ \ \ \ \ \ \ \ \ GGTGCCGGTCACATGGCAGAAGGCTACGCCAGAGCTTCTGGTAAACCAGGTGTTGTCTTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGGCCAGTGTACCGTCTTCCGATGCGGTCTCGAAGACCATTTGGTCCACAACAGAAC / / // // // / / / / // / | | || || |BcgI CviJI | CviJI | || EcoRII | | || || |FatI | AluI | || SexAI | | || || CviAII SetI | || BssKI | | || |Hin4II* | |BseBI | | || |Tsp45I | |ScrFI | | || |MaeIII | SetI | | || NlaIII | TsoI | | |Cfr10I Hpy166II | | HpaII | HgiCI* NlaIV G A G H M A E G Y A R A S G K P G V V L V P V T W Q K A T P E L L V N Q V L S W C R S H G R R L R Q S F W * T R C C L G ----:----|----:----|----:----|----:----|----:----|----:----| P A P * M A S P * A L A E P L G P T T K L H R D C P L L S R W L K Q Y V L H Q R T G T V H C F A V G S S R T F W T N D Q AsuI* |BmgT120I ||BssKI ||CviJI ||EcoRII ||HaeIII ||| ScrFI ||| BseBI ||| | HgiCI* ||| | | SetI MaeIII ||| | | NlaIV | SfaNI CviRI* \\\ \ \ \ \ \ \ GTTACTTCTGGGCCAGGTGCCACCAATGTCGTTACTCCAATGGCAGATGCCTTTGCAGAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGAAGACCCGGTCCACGGTGGTTACAGCAATGAGGTTACCGTCTACGGAAACGTCTG / //// // / / / / MaeIII |||| || HgiCI* | SfaNI CviRI* |||| |NlaIV MaeIII |||| EcoRII |||| BssKI |||BseBI |||ScrFI ||SetI |AsuI* BmgT120I HaeIII CviJI V T S G P G A T N V V T P M A D A F A D L L L G Q V P P M S L L Q W Q M P L Q T Y F W A R C H Q C R Y S N G R C L C R R ----:----|----:----|----:----|----:----|----:----|----:----| T V E P G P A V L T T V G I A S A K A S P * K Q A L H W W H R * E L P L H R Q L N S R P W T G G I D N S W H C I G K C V SfaNI TfiI SpeI | Csp6I HinfI BslFI |MaeI | |RsaI MnlI \ \ \\ \ \\ \ GGGATTCCAATGGTTGTCTTTACAGGGCAAGTCCCAACTAGTGCTATCGGTACTGATGCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCCTAAGGTTACCAACAGAAATGTCCCGTTCAGGGTTGATCACGATAGCCATGACTACGA / / // / // / HinfI BslFI |SpeI | |Csp6I MnlI TfiI MaeI | RsaI SfaNI G I P M V V F T G Q V P T S A I G T D A G F Q W L S L Q G K S Q L V L S V L M L D S N G C L Y R A S P N * C Y R Y * C F ----:----|----:----|----:----|----:----|----:----|----:----| P I G I T T K V P C T G V L A I P V S A R S E L P Q R * L A L G L * H * R Y Q H P N W H N D K C P L D W S T S D T S I S XbaI |MaeI CviJI |Hpy178III* | AcyI || MboI | MaeII || BglII | |ZraI || XhoII | || SetI || | DpnI FatI | || TaiI || | |BstKTI |TspGWI | || AatII || | || Csp6I |CviAII | || | Hpy99I || | || |RsaI || NlaIII \ \\ \ \ \\ \ \\ \\ \\ \ TTCCAAGAGGCTGACGTCGTTGGTATTTCTAGATCTTGTACGAAATGGAATGTCATGGTC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTTCTCCGACTGCAGCAACCATAAAGATCTAGAACATGCTTTACCTTACAGTACCAG / //// /// / // // // | |||MaeII ||| | |Csp6I || |FatI | |||AcyI ||| | RsaI || CviAII | ||ZraI ||| XhoII |NlaIII | |Hpy99I ||| BglII TspGWI | AatII ||| MboI | TaiI ||DpnI | SetI |BstKTI CviJI |XbaI Hpy178III* MaeI F Q E A D V V G I S R S C T K W N V M V S K R L T S L V F L D L V R N G M S W S P R G * R R W Y F * I L Y E M E C H G Q ----:----|----:----|----:----|----:----|----:----|----:----| K W S A S T T P I E L D Q V F H F T M T K G L P Q R R Q Y K * I K Y S I S H * P E L L S V D N T N R S R T R F P I D H D BsrDI BsiI* | MboII | AciI SecI* | | MnlI | BsrBI DsaI* TspEI | | | MseI CviJI TspEI | | AccI \ \ \ \ \ \ \ \ \ \ \ AAGTCCGTGGAAGAATTGCCATTGCGTATTAACGAGGCTTTTGAAATTGCCACGAGCGGT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGGCACCTTCTTAACGGTAACGCATAATTGCTCCGAAAACTTTAACGGTGCTCGCCA / / / / / / / // / DsaI* | | MnlI MseI CviJI TspEI || AciI SecI* | MboII |BsrBI TspEI BsiI* BsrDI K S V E E L P L R I N E A F E I A T S G S P W K N C H C V L T R L L K L P R A V V R G R I A I A Y * R G F * N C H E R * ----:----|----:----|----:----|----:----|----:----|----:----| L D T S S N G N R I L S A K S I A V L P * T R P L I A M A Y * R P K Q F Q W S R L G H F F Q W Q T N V L S K F N G R A T MaeIII | BseGI | | TseI Hpy166II | | |BisI | BssKI | | ||BlsI | |HpaII | | |||AluI | ||ScrFI | | |||FokI | ||CauII* | | |||CviJI | ||| AsuI* | | |||| SetI | ||| AvaII | | |||| | SmlI | ||| |NlaIV | | |||| | AflII | ||| |BmgT120I TaqI | | |||| | |MseI | ||| || BsrI BslFI | | |||| | || BbvI \ \\\ \\ \ \ \ \ \\\\ \ \\ \ AGACCGGGACCAGTCTTGGTCGATTTACCAAAGGATGTTACAGCAGCTATCTTAAGAAAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGGCCCTGGTCAGAACCAGCTAAATGGTTTCCTACAATGTCGTCGATAGAATTCTTTA // / /// / / / / /// / // / || | ||AvaII | BslFI | | ||| | || BbvI || | ||AsuI* TaqI | | ||| | |AflII || | |BmgT120I | | ||| | |SmlI || | BssKI | | ||| | MseI || | NlaIV | | ||| FokI || | BsrI | | ||CviJI || CauII* | | ||TseI || HpaII | | ||AluI || ScrFI | | |BisI |AccI | | BlsI Hpy166II | | SetI | MaeIII BseGI R P G P V L V D L P K D V T A A I L R N D R D Q S W S I Y Q R M L Q Q L S * E I T G T S L G R F T K G C Y S S Y L K K S ----:----|----:----|----:----|----:----|----:----|----:----| L G P G T K T S K G F S T V A A I K L F Y V P V L R P R N V L P H * L L * R L F S R S W D Q D I * W L I N C C S D * S I Hin6I Ksp632I* TspEI FnuDII* EcoP15I | MmeI | MseI |GlaI TspEI | MboII | | BccI | | BsrI ||HhaI \ \ \ \ \ \ \ \ \ \\\ CCAATTCCAACAAAAACAACTCTTCCATCAAACGCACTAAACCAATTAACCAGTCGCGCA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTAAGGTTGTTTTTGTTGAGAAGGTAGTTTGCGTGATTTGGTTAATTGGTCAGCGCGT / // / / // /// TspEI |EcoP15I | BccI |MseI ||Hin6I MboII Ksp632I* |BsrI |GlaI MmeI TspEI FnuDII* HhaI P I P T K T T L P S N A L N Q L T S R A Q F Q Q K Q L F H Q T H * T N * P V A H N S N K N N S S I K R T K P I N Q S R T ----:----|----:----|----:----|----:----|----:----|----:----| G I G V F V V R G D F A S F W N V L R A D L E L L F L E E M L R V L G I L W D R W N W C F C S K W * V C * V L * G T A C FatI MboI |CviAII BclI TsoI || CviRI* TseI | DpnI | ApoI || NlaIII |BisI | BbvI | TspEI || | TspDTI ||BlsI | |BstKTI \ \ \\ \ \ \\\ \ \\ CAAGATGAATTTGTCATGCAAAGTATCAATAAAGCAGCAGATTTGATCAACTTGGCAAAG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTACTTAAACAGTACGTTTCATAGTTATTTCGTCGTCTAAACTAGTTGAACCGTTTC / / / // /// // / / TsoI | | |TspDTI ||TseI || | BbvI | | |CviRI* |BisI || BclI | | |FatI BlsI || MboI | | CviAII |DpnI | NlaIII BstKTI TspEI ApoI Q D E F V M Q S I N K A A D L I N L A K K M N L S C K V S I K Q Q I * S T W Q R R * I C H A K Y Q * S S R F D Q L G K E ----:----|----:----|----:----|----:----|----:----|----:----| C S S N T M C L I L L A A S K I L K A F V L H I Q * A F Y * Y L L L N S * S P L L I F K D H L T D I F C C I Q D V Q C L MseI |AhaIII* || FatI || |BccI || |CviAII || || CviRI* || || NlaIII || || |MslI MaeII || || || BstXI | SetI || || || | AsuI* EcoP15I | TaiI || || || | AvaII |SetI | | Hpy99I || || || | |BmgT120I \\ \ \ \ \\ \\ \\ \ \\ AAACCTGTCTTATACGTCGGTGCTGGTATTTTAAACCATGCAGATGGTCCAAGATTACTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGACAGAATATGCAGCCACGACCATAAAATTTGGTACGTCTACCAGGTTCTAATGAT / / // / // / //// // / SetI | || MaeII || | |||MslI |AvaII BdaI | |Hpy99I || | ||CviRI* |AsuI* BdaI | TaiI || | ||FatI BmgT120I | SetI || | |CviAII EcoP15I || | |BstXI || | BccI || NlaIII |MseI AhaIII* K P V L Y V G A G I L N H A D G P R L L N L S Y T S V L V F * T M Q M V Q D Y * T C L I R R C W Y F K P C R W S K I T K ----:----|----:----|----:----|----:----|----:----|----:----| F G T K Y T P A P I K F W A S P G L N S S V Q R I R R H Q Y K L G H L H D L I V F R D * V D T S T N * V M C I T W S * * BdaI BdaI | TspEI | | MseI | | | MaeIII | | | Tsp45I SetI | | | | Tsp4CI* MaeIII | | | | | SduI Tsp45I | | | | | HgiAI* | BdaI TspDTI | | | | | | HphI | BdaI | SetI SetI \ \ \ \ \ \ \ \ \ \ \ \ AAAGAATTAAGTGACCGTGCTCAAATACCTGTCACCACTACTTTACAAGGTTTAGGTTCA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTAATTCACTGGCACGAGTTTATGGACAGTGGTGATGAAATGTTCCAAATCCAAGT // / / / / / / / / / / |MseI | | | SetI | Tsp45I | SetI SetI Hin4I TspEI | | HphI | MaeIII TspDTI Hin4I | HgiAI* BdaI | SduI BdaI Tsp4CI* Tsp45I MaeIII K E L S D R A Q I P V T T T L Q G L G S K N * V T V L K Y L S P L L Y K V * V H R I K * P C S N T C H H Y F T R F R F I ----:----|----:----|----:----|----:----|----:----|----:----| F S N L S R A * I G T V V V K C P K P E L L I L H G H E F V Q * W * K V L N L N F F * T V T S L Y R D G S S * L T * T * TaqI | Hin4I Hin4I | Hin4I Hin4I | | BinI* | MwoI | | | MboI | | CviRI* | | | XhoII | | | Tsp4CI* | | | | DpnI AlfI | | | |OliI | | | | |BstKTI MboII AlfI | | | |MslI \ \ \ \ \\ \ \ \ \ \ \\ TTCGACCAAGAAGATCCAAAATCATTGGATATGCTTGGTATGCACGGTTGTGCTACTGCC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTGGTTCTTCTAGGTTTTAGTAACCTATACGAACCATACGTGCCAACACGATGACGG / / // / / / / / / / / | | || | MboII | | MwoI | | MslI | | || XhoII | Hin4I | | OliI | | || MboI | Hin4I | Tsp4CI* | | |DpnI AlfI CviRI* | | BstKTI AlfI | BinI* TaqI F D Q E D P K S L D M L G M H G C A T A S T K K I Q N H W I C L V C T V V L L P R P R R S K I I G Y A W Y A R L C Y C Q ----:----|----:----|----:----|----:----|----:----|----:----| N S W S S G F D N S I S P I C P Q A V A M R G L L D L I M P Y A Q Y A R N H * Q E V L F I W F * Q I H K T H V T T S S G BssKI EcoRII TspEI | BglI | CviRI* Hpy99I | MwoI | | MwoI | McrI* | ScrFI | | BstAPI | |DrdI | BseBI | | | MaeI | |Tsp4CI* | |SetI CviRI* | | | | TfiI | |Tth111I | |AlfI | BtsI | | | | HinfI | || MaeIII | |AlfI | TspRI | | | | | TaqI | || Tsp45I \ \\ \ \ \ \ \ \ \ \ \ \\ \ AACCTGGCAGTGCAAAATGCCGACTTGATAATTGCAGTTGGTGCTAGATTCGACGACCGT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGACCGTCACGTTTTACGGCTGAACTATTAACGTCAACCACGATCTAAGCTGCTGGCA / / / / / // / / / / /// // | | | | CviRI* || BstAPI | | | ||| |TspRI | | | | BtsI || MwoI | | | ||| Tth111I | | | EcoRII |CviRI* | | | ||Tsp4CI* | | | BssKI TspEI | | | |DrdI | | BseBI | | | McrI* | | ScrFI | | TaqI | | TspRI | Hpy99I | AlfI | HinfI | AlfI | TfiI MwoI MaeI BglI SetI N L A V Q N A D L I I A V G A R F D D R T W Q C K M P T * * L Q L V L D S T T V P G S A K C R L D N C S W C * I R R P C ----:----|----:----|----:----|----:----|----:----|----:----| L R A T C F A S K I I A T P A L N S S R W G P L A F H R S S L Q L Q H * I R R G V Q C H L I G V Q Y N C N T S S E V V T Hpy178III* | MwoI | | BbvI | | |AluI | | |CviJI | | || SetI | | || | MwoI | | || | |Hpy99I | | || | || TseI | | || | || CviRI* | | || | || |BisI | | || | || ||MnlI | | || | || ||BlsI | | || | || |||TseI | | || | || |||AluI | | || | || |||CviJI | | || | || |||PvuII | | || | || |||NspBII* | | || | || ||||BisI BsrI | | || | || |||||BlsI TspRI | | || | || |||||SetI | GsuI | | || | || |||||| SecI* | Eco57MI ApoI | | || | || |||||| | MnlI | |SspI TspEI | | || | || |||||| | | BbvI \ \\ \ \ \ \\ \ \\ \\\\\\ \ \ \ GTCACTGGTAATATTTCTAAATTCGCTCCAGAAGCTCGTCGTGCAGCTGCCGAGGGTAGA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTGACCATTATAAAGATTTAAGCGAGGTCTTCGAGCAGCACGTCGACGGCTCCCATCT / / / / / / / / / // /////// / / // | | | SspI | | | | | |MwoI ||||||| | | |BsgI | | Eco57MI | | | | | |BbvI ||||||| | | TspDTI | | GsuI | | | | | Hpy99I ||||||| | | BbvI | BsrI | | | | CviJI ||||||| | | SetI Tsp45I | | | | AluI ||||||| | SecI* MaeIII | | | SetI ||||||| MnlI | | Hpy178III* ||||||TseI | MwoI |||||BisI TspEI ||||BlsI ApoI |||NspBII* |||PvuII |||CviJI |||TseI |||AluI ||BisI |BlsI |SetI |MnlI CviRI* V T G N I S K F A P E A R R A A A E G R S L V I F L N S L Q K L V V Q L P R V E H W * Y F * I R S R S S S C S C R G * R ----:----|----:----|----:----|----:----|----:----|----:----| T V P L I E L N A G S A R R A A A S P L H * Q Y Y K * I R E L L E D H L Q R P Y D S T I N R F E S W F S T T C S G L T S TspDTI MnlI |BsgI | NmeAIII ||SetI | | TaqI SetI SetI \\\ \ \ \ \ \ GGTGGTATTATTCATTTCGAGGTTAGTCCAAAAAACATAAACAAGGTTGTTCAAACTCAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCATAATAAGTAAAGCTCCAATCAGGTTTTTTGTATTTGTTCCAACAAGTTTGAGTT / / / / | | TaqI SetI | | SetI | NmeAIII MnlI G G I I H F E V S P K N I N K V V Q T Q V V L F I S R L V Q K T * T R L F K L K W Y Y S F R G * S K K H K Q G C S N S N ----:----|----:----|----:----|----:----|----:----|----:----| P P I I * K S T L G F F M F L T T * V * L H Y * E N R P * D L F C L C P Q E F E T T N N M E L N T W F V Y V L N N L S L Hin4II* | SfaNI | | BtsI | | TspRI | | | SetI HphI BfiI BsrI \ \ \ \ \ \ \ ATAGCAGTGGAAGGTGATGCTACGACCAATCTGGGCAAAATGATGTCAAAGATTTTCCCA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TATCGTCACCTTCCACTACGATGCTGGTTAGACCCGTTTTACTACAGTTTCTAAAAGGGT // /// / / / / || ||SetI HphI BfiI | BsiYI* || |SfaNI BsrI || BtsI |Hin4II* TspRI I A V E G D A T T N L G K M M S K I F P * Q W K V M L R P I W A K * C Q R F S Q S S G R * C Y D Q S G Q N D V K D F P S ----:----|----:----|----:----|----:----|----:----|----:----| I A T S P S A V V L R P L I I D F I K G F L L P L H H * S W D P C F S T L S K G Y C H F T I S R G I Q A F H H * L N E W MnlI MseI SetI |BsiYI* | Hpy188I BarI Hin4II* MboII \\ \ \ \ \ \ GTTAAGGAGAGGTCTGAATGGTTTGCTCAAATAAATAAATGGAAGAAGGAATACCCATAC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CAATTCCTCTCCAGACTTACCAAACGAGTTTATTTATTTACCTTCTTCCTTATGGGTATG / / / / / / / / | MseI SetI Hpy188I BarI Hin4II* MboII Eco57MI MnlI GsuI V K E R S E W F A Q I N K W K K E Y P Y L R R G L N G L L K * I N G R R N T H T * G E V * M V C S N K * M E E G I P I R ----:----|----:----|----:----|----:----|----:----|----:----| T L S L D S H N A * I F L H F F S Y G Y L * P S T Q I T Q E F L Y I S S P I G M N L L P R F P K S L Y I F P L L F V W V HinfI | PfoI | BssKI | EcoRII | | ScrFI | | BseBI | | | MboI GsuI | | | XhoII Eco57MI | | | | DpnI |MnlI | | | | |BseRI || BarI | | | | |BstKTI || |BsmAI | | | | || TspEI || || MlyI | | | | || |BinI* Tsp4CI* || || PleI | | | | || || MseI | PsiI \\ \\ \ \ \ \ \ \\ \\ \ \ \ GCTTATATGGAGGAGACTCCAGGATCTAAAATTAAACCACAGACGGTTATAAAGAAACTA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CGAATATACCTCCTCTGAGGTCCTAGATTTTAATTTGGTGTCTGCCAATATTTCTTTGAT // /// / / // / / // / / |MnlI ||BsmAI | | || | | |MseI | PsiI BarI |PleI | | || | | TspEI Tsp4CI* MlyI | | || | BinI* | | || XhoII | | || MboI | | |DpnI | | EcoRII | | BstKTI | | BseRI | | BssKI | | PfoI | BseBI | ScrFI HinfI A Y M E E T P G S K I K P Q T V I K K L L I W R R L Q D L K L N H R R L * R N Y L Y G G D S R I * N * T T D G Y K E T I ----:----|----:----|----:----|----:----|----:----|----:----| A * I S S V G P D L I L G C V T I F F S R K Y P P S E L I * F * V V S P * L S V S I H L L S W S R F N F W L R N Y L F * FatI AflIII BspLU11I* |CviAII ||CspCI |||BbvII* ||||NspI ||||NlaIII StyI ||||| MboII SecI* SetI ||||| |MaeIII BbvI \ \ \\\\\ \\ \ TCCAAGGTTGCCAACGACACAGGAAGACATGTCATTGTTACAACGGGTGTGGGGCAACAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTCCAACGGTTGCTGTGTCCTTCTGTACAGTAACAATGTTGCCCACACCCCGTTGTA / / / // / / | SecI* | || BbvII* MaeIII | StyI | || MboII SetI | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII CspCI NspI S K V A N D T G R H V I V T T G V G Q H P R L P T T Q E D M S L L Q R V W G N I Q G C Q R H R K T C H C Y N G C G A T S ----:----|----:----|----:----|----:----|----:----|----:----| D L T A L S V P L C T M T V V P T P C C I W P Q W R C L F V H * Q * L P H P A V G L N G V V C S S M D N N C R T H P L M FatI TseI BsrI CviJI TspRI |BisI |CviAII CspCI ||BlsI || NlaIII TspDTI SetI \ \\\ \\ \ \ \ CAAATGTGGGCTGCTCAACACTGGACATGGAGAAATCCACATACTTTCATCACATCAGGT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTACACCCGACGAGTTGTGACCTGTACCTCTTTAGGTGTATGAAAGTAGTGTAGTCCA // //// / / / // / / |CspCI |||| TspRI | | |FatI TspDTI SetI BbvI |||TseI | | CviAII ||BisI | NlaIII |BlsI BsrI CviJI Q M W A A Q H W T W R N P H T F I T S G K C G L L N T G H G E I H I L S S H Q V N V G C S T L D M E K S T Y F H H I R W ----:----|----:----|----:----|----:----|----:----|----:----| * I H A A * C Q V H L F G C V K M V D P D F T P Q E V S S M S F D V Y K * * M L L H P S S L V P C P S I W M S E D C * T MaeIII MwoI | Tsp4CI* | BccI | | BsmAI | |SmlI | | Eco31I | ||SduI | | |Bce83I* | ||HgiAI* BccI | | || AciI | ||| MwoI | Csp6I | | || BisI | ||| | CviRI* | |RsaI | | || |BlsI | ||| | | CviJI | |SetI | | || ||TauI | ||| | | |TsoI \ \\ \ \ \\ \\\ \ \\\ \ \ \\ GGTTTAGGTACGATGGGTTACGGTCTCCCTGCCGCCATCGGTGCTCAAGTTGCAAAGCCA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAATCCATGCTACCCAATGCCAGAGGGACGGCGGTAGCCACGAGTTCAACGTTTCGGT / / // / / //// / / / / / / // | | |Csp6I | | |||| | | | | | | |CviJI | | RsaI | | |||| | | | | | | TsoI | BccI | | |||| | | | | | CviRI* SetI | | |||| | | | | SmlI | | |||| | | | MwoI | | |||| | | BccI | | |||| | HgiAI* | | |||| | SduI | | |||| MwoI | | |||AciI | | ||BisI | | |Eco31I | | |BsmAI | | |BlsI | | TauI | Bce83I* Tsp4CI* MaeIII G L G T M G Y G L P A A I G A Q V A K P V * V R W V T V S L P P S V L K L Q S Q F R Y D G L R S P C R H R C S S C K A R ----:----|----:----|----:----|----:----|----:----|----:----| P K P V I P * P R G A A M P A * T A F G H N L Y S P N R D G Q R W R H E L Q L A T * T R H T V T E R G G D T S L N C L W HgaI HphI |MseI ||MlyI ||PleI |||SfaNI ||||FatI MaeIII |||||CviAII TfiI BccI Tsp45I |||||| HinfI BceAI HinfI | FokI | BseGI |||||| NlaIII | TspEI \ \ \ \ \ \\\\\\ \ \ \ GAATCTTTGGTTATTGACATTGATGGTGACGCATCCTTTAACATGACTCTAACGGAATTG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGAAACCAATAACTGTAACTACCACTGCGTAGGAAATTGTACTGAGATTGCCTTAAC / / / // / //// // / / / HinfI BccI FokI || | |||| || HinfI | TspEI TfiI || | |||| |FatI BceAI || | |||| CviAII || | |||| SfaNI || | |||HgaI || | ||NlaIII || | |MseI || | |PleI || | MlyI || HphI |Tsp45I |MaeIII BseGI E S L V I D I D G D A S F N M T L T E L N L W L L T L M V T H P L T * L * R N * I F G Y * H * W * R I L * H D S N G I E ----:----|----:----|----:----|----:----|----:----|----:----| S D K T I S M S P S A D K L M V R V S N L I K P * Q C Q H H R M R * C S E L P I F R Q N N V N I T V C G K V H S * R F Q TspGWI |GsuI |Eco57MI || BaeI || | MwoI || | | AluI || | | CviJI MboII || | | | SetI | BaeI || | | | | Csp6I | | SapI || | | | | |RsaI | | Ksp632I* || | | | | || BsrI TspRI | | | TsoI \\ \ \ \ \ \\ \ \ \ \ \ \ AGTTCTGCCGTTCAAGCTGGTACTCCAGTGAAGATTTTGATTTTGAACAATGAAGAGCAA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAGACGGCAAGTTCGACCATGAGGTCACTTCTAAAACTAAAACTTGTTACTTCTCGTT // / / / /// / / / / / || | | | ||TspRI | MboII | TsoI SetI || | | | ||BsrI BaeI Ksp632I* || | | | |Csp6I SapI || | | | RsaI || | | CviJI || | | AluI || | SetI || MwoI |Eco57MI |GsuI |BaeI TspGWI S S A V Q A G T P V K I L I L N N E E Q V L P F K L V L Q * R F * F * T M K S K F C R S S W Y S S E D F D F E Q * R A R ----:----|----:----|----:----|----:----|----:----|----:----| L E A T * A P V G T F I K I K F L S S C S N Q R E L Q Y E L S S K S K S C H L A T R G N L S T S W H L N Q N Q V I F L L SetI |MboII ||TspDTI MfeI |||MaeIII TspEI \\\\ \ GGTATGGTTACTCAATGGCAATCCCTGTTCTACGAACATCGTTATTCCCACACACATCAA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CCATACCAATGAGTTACCGTTAGGGACAAGATGCTTGTAGCAATAAGGGTGTGTGTAGTT / / TspDTI MaeIII MboII G M V T Q W Q S L F Y E H R Y S H T H Q V W L L N G N P C S T N I V I P T H I N Y G Y S M A I P V L R T S L F P H T S I ----:----|----:----|----:----|----:----|----:----|----:----| P I T V * H C D R N * S C R * E W V C * L Y P * E I A I G T R R V D N N G C V D T H N S L P L G Q E V F M T I G V C M L MseI |AhaIII* || SetI || |MseI MnlI || || HinfI |MaeI || || | Hpy178III* TspDTI || AciI CviJI || || | | MnlI \ \\ \ \ \\ \\ \ \ \ TTGAACCCTGATTTCATAAAACTAGCGGAGGCTATGGGTTTAAAAGGTTTAAGAGTCAAG 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTGGGACTAAAGTATTTTGATCGCCTCCGATACCCAAATTTTCCAAATTCTCAGTTC // / / / / // / / / / |TspEI | | | CviJI || SetI MseI | Hpy178III* |MfeI | | AciI |MseI | MnlI TspDTI | MaeI AhaIII* HinfI MnlI L N P D F I K L A E A M G L K G L R V K * T L I S * N * R R L W V * K V * E S R E P * F H K T S G G Y G F K R F K S Q E ----:----|----:----|----:----|----:----|----:----|----:----| N F G S K M F S A S A I P K F P K L T L I S G Q N * L V L P P * P N L L N L L * Q V R I E Y F * R L S H T * F T * S D L StyI SecI* | BfiI | | AsuI* | | DraII | | Bsp120I | | |AsuI* | | |BmgT120I | | ||CviJI | | ||NlaIV | | ||HaeIII | | ||BmgT120I | | ||| BsrI ApoI | | ||| ApaI XmnI | | ||| SduI PleI TspEI | | ||| BseSI |MlyI TspEI DdeI HgaI EcoRI | | ||| HgiJII* \\ \ \ \ \ \ \ \\\ \ AAGCAAGAGGAATTGGACGCTAAGTTGAAAGAATTCGTTTCTACCAAGGGCCCAGTTTTG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGTTCTCCTTAACCTGCGATTCAACTTTCTTAAGCAAAGATGGTTCCCGGGTCAAAAC / / / // / / / /// PleI TspEI DdeI || EcoRI | | ||Bsp120I MlyI || TspEI | | ||AsuI* || ApoI | | |BmgT120I |XmnI | | |DraII HgaI | | |AsuI* | | BmgT120I | | HaeIII | | NlaIV | | CviJI | | BsrI | HgiJII* | SecI* | BseSI | StyI | SduI | ApaI BfiI K Q E E L D A K L K E F V S T K G P V L S K R N W T L S * K N S F L P R A Q F C A R G I G R * V E R I R F Y Q G P S F A ----:----|----:----|----:----|----:----|----:----|----:----| F C S S N S A L N F S N T E V L P G T K S A L P I P R * T S L I R K * W P G L K L L L F Q V S L Q F F E N R G L A W N Q AciI AarI | XbaI BspMI SetI | TspDTI \ \ \ \ CTTGAAGTGGAAGTTGATAAAAAAGTTCCTGTTTTGCCAATGGTGGCAGGTGGTAGCGGT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTTCACCTTCAACTATTTTTTCAAGGACAAAACGGTTACCACCGTCCACCATCGCCA / / / BspMI SetI TspDTI AarI AciI L E V E V D K K V P V L P M V A G G S G L K W K L I K K F L F C Q W W Q V V A V * S G S * * K S S C F A N G G R W * R S ----:----|----:----|----:----|----:----|----:----|----:----| S S T S T S L F T G T K G I T A P P L P A Q L P L Q Y F L E Q K A L P P L H Y R K F H F N I F F N R N Q W H H C T T A T TspEI | MaeII MaeI ApoI BdaI | | SetI Hpy178III* TspEI BdaI | | TaiI \ \ \ \ \ \ CTAGACGAGTTCATAAATTTTGACCCAGAAGTTGAAAGACAACAGACTGAATTACGTCAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GATCTGCTCAAGTATTTAAAACTGGGTCTTCAACTTTCTGTTGTCTGACTTAATGCAGTA // / / / / |XbaI TspEI BdaI | MaeII Hpy178III* ApoI BdaI TspEI MaeI TaiI SetI L D E F I N F D P E V E R Q Q T E L R H * T S S * I L T Q K L K D N R L N Y V I R R V H K F * P R S * K T T D * I T S * ----:----|----:----|----:----|----:----|----:----|----:----| R S S N M F K S G S T S L C C V S N R * D L R T * L N Q G L L Q F V V S Q I V D * V L E Y I K V W F N F S L L S F * T M AciI Csp6I BdaI |RsaI BdaI \\ \ AAGCGTACAGGCGGTAAGCACTGA 2050 2060 ----:----|----:----|---- TTCGCATGTCCGCCATTCGTGACT // / / || | AciI || BdaI || BdaI |Csp6I RsaI K R T G G K H * S V Q A V S T X A Y R R * A L X ----:----|----:----|---- L R V P P L C Q Y A Y L R Y A S L T C A T L V S # Enzymes that cut Frequency Isoschizomers AarI 2 AatII 1 AccI 1 FblI,XmiI AciI 7 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 1 AhaIII* 2 DraI AlfI 2 AluI 6 AluBI AlwNI 1 CaiI ApaI 1 ApoI 5 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BarI 1 BbvI 6 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 5 Bce83I* 1 BpuEI BceAI 1 BcgI 1 BciVI 1 BfuI BclI 2 FbaI,Ksp22I BdaI 4 BfiI 2 BmrI,BmuI BglI 1 BglII 1 BinI* 3 AlwI,BspPI,AclWI BisI 7 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 7 BmgT120I 5 BseBI 5 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 1 BseRI 1 BseSI 1 BaeGI,BstSLI BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI Bsp120I 1 PspOMI BspCNI 1 BspLU11I* 1 PscI,PciI BspMI 2 BfuAI,Acc36I,BveI BsrBI 1 AccBSI,MbiI BsrDI 1 BseMI,Bse3DI BsrI 8 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BstAPI 1 BstKTI 7 BstXI 1 BtsI 2 Cac8I 2 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 5 CviQI,RsaNI CspCI 1 CviAII 9 CviJI 20 CviKI-1 CviRI* 8 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 7 MalI DraII 1 EcoO109I DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57MI 3 EcoNI 1 BstENI,XagI EcoP15I 2 EcoRI 1 EcoRII 5 AjnI,Psp6I,PspGI Esp3I 1 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 9 FauI 1 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 4 GsuI 3 BpmI HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 4 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 4 HpyAV Hin6I 4 HinP1I,HspAI HinfI 6 HpaII 2 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 2 Hpy99I 5 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 11 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 9 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 3 SchI MmeI 1 MnlI 11 MseI 13 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 8 HpyF10VI,BstMWI NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 2 MspA1I NspI 1 BstNSI,XceI OliI 1 AleI PfoI 1 PleI 3 PpsI PsiI 1 AanI PvuII 1 RsaI 5 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 34 SexAI 1 MabI SfaNI 5 LweI SmlI 2 SmoI SpeI 1 BcuI,AhlI SspI 2 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 4 TauI 1 TfiI 3 PfeI TseI 6 ApeKI TsoI 6 Tsp45I 5 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 8 TspEI 17 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 7 TscAI Tth111I 1 PflFI,PsyI,AspI XbaI 2 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AbsI Acc65I AgeI AjuI AloI ApaLI AscI Asp718I AsuII AvaI AvrII BalI BamHI BbvCI BetI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseYI BsmI Bsp1407I BspHI BspMII* BspOI BssNAI Bst1107I BstEII BstZ17I BtgZI BtrI Cfr9I CfrI ClaI DinI DraIII Eam1105I EciI Ecl136II Eco57I EcoICRI EcoRV EcoT22I EgeI EheI FseI FspAI GsaI HindII HindIII HpaI KasI KpnI MauBI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NotI NruI NsiI PacI PasI PflMI PmaCI PmeI PpiI PpuMI PshAI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SauI* ScaI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TatI TspMI TstI VspI XcmI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769