Restriction Map of SRT1/YMR101C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

SRT1/YMR101C on chromosome XIII from coordinates 469476 to 468445.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 Hpy188I |TfiI BsiYI* BfiI BsrI TspDTI |HinfI CviJI | CviJI \ \ \ \\ \ \ \ ATGAAAATGCCCAGTATTATTCAGATTCAGTTTGTAGCCCTAAAAAGGCTTTTGGTAGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTTTACGGGTCATAATAAGTCTAAGTCAAACATCGGGATTTTTCCGAAAACCATCTT / / / / / / / / BfiI BsrI TspDTI | HinfI | BsiYI* CviJI | TfiI CviJI Hpy188I M K M P S I I Q I Q F V A L K R L L V E * K C P V L F R F S L * P * K G F W * K E N A Q Y Y S D S V C S P K K A F G R N ----:----|----:----|----:----|----:----|----:----|----:----| X F I G L I I * I * N T A R F L S K T S X S F A W Y * E S E T Q L G L F A K P L H F H G T N N L N L K Y G * F P K Q Y F BtsI TspRI Hpy188I \ \ ACCAAAGAACAGATGTGCTTCGCAGTGAAAAGTATATTTCAGAGAGTATTTGCGTGGGTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTTCTTGTCTACACGAAGCGTCACTTTTCATATAAAGTCTCTCATAAACGCACCCAA / / / TspRI BtsI Hpy188I T K E Q M C F A V K S I F Q R V F A W V P K N R C A S Q * K V Y F R E Y L R G L Q R T D V L R S E K Y I S E S I C V G Y ----:----|----:----|----:----|----:----|----:----|----:----| V L S C I H K A T F L I N * L T N A H T F W L V S T S R L S F Y I E S L I Q T P G F F L H A E C H F T Y K L S Y K R P N MseI FatI |TspDTI |CviAII ||HindIII || Eco57I ||| AluI || Eco57MI ||| CviJI || |NlaIII Hpy188I ||| | SetI || || MboII | SspI \\\ \ \ \\ \\ \ \ \ ATGTCATTAAGCTTGTTTTCATGGTTTTATGTAAATCTTCAGAATATTTTGATAAAAGCA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTAATTCGAACAAAAGTACCAAAATACATTTAGAAGTCTTATAAAACTATTTTCGT / / / / // // / / / | | | | || || MboII | SspI | | | | || |FatI Hpy188I | | | | || CviAII | | | | |Eco57MI | | | | |Eco57I | | | | NlaIII | | | HindIII | | CviJI | | AluI | MseI | SetI TspDTI M S L S L F S W F Y V N L Q N I L I K A C H * A C F H G F M * I F R I F * * K H V I K L V F M V L C K S S E Y F D K S I ----:----|----:----|----:----|----:----|----:----|----:----| I D N L K N E H N * T F R * F I K I F A * T M L S T K M T K H L D E S Y K S L L H * * A Q K * P K I Y I K L I N Q Y F C AsuI* |BmgT120I || AlwNI || |TspRI || || FatI || || AflIII || || BspLU11I* || || |CviAII || || || NspI || || || NlaIII || || || | BsmAI || || || | | BccI || || || | | |FatI || || || | | ||CviAII || || || | | ||| NlaIII || || || | | ||| | MaeIII || || || | | ||| | BstEII || || || | | ||| | | BseGI ||CviJI || || | | ||| | | | BetI* ||HaeIII || || | | ||| | | | |HpaII MseI |||BsrI || || | | ||| | | | || FokI \ \\\\ \\ \\ \ \ \\\ \ \ \ \\ \ TTAAGGGTAGGGCCAGTGCCTGAACATGTCTCCTTTATCATGGATGGTAACCGGAGATAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AATTCCCATCCCGGTCACGGACTTGTACAGAGGAAATAGTACCTACCATTGGCCTCTATA / /// / / // // // / / // / MseI ||| AlwNI | || || || | | || FokI ||AsuI* | || || || | | |BetI* |BmgT120I | || || || | | HpaII |HaeIII | || || || | BstEII |CviJI | || || || | MaeIII TspRI | || || || BseGI BsrI | || || |FatI | || || CviAII | || |NlaIII | || |BccI | || BsmAI | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI L R V G P V P E H V S F I M D G N R R Y * G * G Q C L N M S P L S W M V T G D M K G R A S A * T C L L Y H G W * P E I C ----:----|----:----|----:----|----:----|----:----|----:----| N L T P G T G S C T E K I M S P L R L Y M L P L A L A Q V H R R * * P H Y G S I * P Y P W H R F M D G K D H I T V P S I CviJI MseI HaeIII |HpaI |FatI |HindII ||CviAII |TspDTI ||| NlaIII |Hpy166II ||| | AluI || AclI Hin4II* ||| | XcmI || MaeII | Hpy178III* ||| | CviJI || |MaeIII | | CviJI ||| | BstXI || || SetI | | | BsrI ||| | | SetI || || TaiI \ \ \ \ \\\ \ \ \ \\ \\ \ GCCAAGTCAAGAAGGCTACCAGTAAAAAAAGGCCATGAAGCTGGTGGGTTAACGTTACTA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTCAGTTCTTCCGATGGTCATTTTTTTCCGGTACTTCGACCACCCAATTGCAATGAT / / / / // ///// / // / / | | | BsrI || ||||CviJI | || | MaeIII | | CviJI || ||||AluI | || MaeII | Hpy178III* || |||XcmI | || AclI Hin4II* || ||SetI | |MseI || |FatI | |TaiI || CviAII | |SetI || BstXI | Hpy166II |NlaIII | HindII HaeIII | HpaI CviJI TspDTI A K S R R L P V K K G H E A G G L T L L P S Q E G Y Q * K K A M K L V G * R Y * Q V K K A T S K K R P * S W W V N V T N ----:----|----:----|----:----|----:----|----:----|----:----| A L D L L S G T F F P W S A P P N V N S H W T L F A V L L F L G H L Q H T L T V G L * S P * W Y F F A M F S T P * R * * TaqII CviRI* Tsp4CI* |CviRI* EciI AciI | EcoT22I \ \\ \ \ \ \ ACACTACTGTATATCTGCAAAAGATTGGGTGTAAAATGTGTTTCCGCCTATGCATTTTCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGATGACATATAGACGTTTTCTAACCCACATTTTACACAAAGGCGGATACGTAAAAGA / / / / / / / | | CviRI* EciI | | CviRI* | TaqII | EcoT22I Tsp4CI* AciI T L L Y I C K R L G V K C V S A Y A F S H Y C I S A K D W V * N V F P P M H F L T T V Y L Q K I G C K M C F R L C I F Y ----:----|----:----|----:----|----:----|----:----|----:----| V S S Y I Q L L N P T F H T E A * A N E L V V T Y R C F I P H L I H K R R H M K C * Q I D A F S Q T Y F T N G G I C K R ApoI Hpy166II TspEI ApoI | Tsp4CI* | MseI MboII TspEI | |TspDTI \ \ \ \ \ \\ ATTGAAAATTTTAATAGACCAAAAGAAGAAGTAGATACGCTAATGAATTTGTTTACGGTA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTTTTAAAATTATCTGGTTTTCTTCTTCATCTATGCGATTACTTAAACAAATGCCAT / / / / / / | MseI MboII | | Tsp4CI* TspEI | | TspDTI ApoI | Hpy166II TspEI ApoI I E N F N R P K E E V D T L M N L F T V L K I L I D Q K K K * I R * * I C L R * * K F * * T K R R S R Y A N E F V Y G K ----:----|----:----|----:----|----:----|----:----|----:----| I S F K L L G F S S T S V S I F K N V T * Q F N * Y V L L L L L Y A L S N T * P N F I K I S W F F F Y I R * H I Q K R Y BinI* | MboI | BamHI | XhoII | | DpnI | | NlaIV | | |BstKTI | | || BinI* | | || | BsiYI* MwoI | | || | | MboI |TspDTI | | || | | XhoII || CviJI | | || | | | DpnI HindIII || |StyI | | || | | | |BstKTI | AluI ApoI || |SecI* | | || | | | || FalI | CviJI TspEI || || FalI | | || | | | || FalI | | SetI EcoRI || || FalI | | || | | | || BinI* \ \ \ \ \\ \\ \ \ \ \\ \ \ \ \\ \ AAGCTTGATGAATTCGCAAAAAGAGCCAAGGACTATAAGGATCCCTTATACGGATCTAAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGAACTACTTAAGCGTTTTTCTCGGTTCCTGATATTCCTAGGGAATATGCCTAGATTT / / / / / / / / / / // / / / //// | | HindIII | | | | | | | || | | | |||XhoII | CviJI | | | | | | | || | | | |||MboI | AluI | | | | | | | || | | | ||FalI SetI | | | | | | | || | | | ||FalI | | | | | | | || | | | |DpnI | | | | | | | || | | | BstKTI | | | | | | | || | | BinI* | | | | | | | || | BsiYI* | | | | | | | || XhoII | | | | | | | || BamHI | | | | | | | || MboI | | | | | | | |NlaIV | | | | | | | |DpnI | | | | | | | BstKTI | | | | | | BinI* | | | | | SecI* | | | | | StyI | | | | CviJI | | | FalI | | | FalI | | TspDTI | MwoI EcoRI TspEI ApoI K L D E F A K R A K D Y K D P L Y G S K S L M N S Q K E P R T I R I P Y T D L K A * * I R K K S Q G L * G S L I R I * N ----:----|----:----|----:----|----:----|----:----|----:----| F S S S N A F L A L S * L S G K Y P D L L A Q H I R L F L W P S Y P D R I R I * L K I F E C F S G L V I L I G * V S R F MboI BclI SetI | GsuI | DpnI | Eco57MI TspEI TspGWI | |BstKTI HphI Hpy178III* | MseI \ \ \\ \ \ \ \ ATAAGAATAGTAGGTGATCAATCTTTACTATCTCCAGAAATGAGAAAAAAAATTAAAAAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TATTCTTATCATCCACTAGTTAGAAATGATAGAGGTCTTTACTCTTTTTTTTAATTTTTT / / / /// / / / // | TspGWI | ||| BclI HphI Hpy178III* |MseI BinI* | ||| MboI TspEI | ||DpnI | |BstKTI | Eco57MI | GsuI SetI I R I V G D Q S L L S P E M R K K I K K * E * * V I N L Y Y L Q K * E K K L K K K N S R * S I F T I S R N E K K N * K S ----:----|----:----|----:----|----:----|----:----|----:----| I L I T P S * D K S D G S I L F F I L F F L F L L H D I K V I E L F S F F F * F Y S Y Y T I L R * * R W F H S F F N F F BccI | MboII | |Esp3I | |BsmAI BseGI FokI \ \\ \ \ GTGGAAGAAATCACACAGGATGGAGACGATTTCACTTTATTTATATGTTTTCCTTACACT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTTCTTTAGTGTGTCCTACCTCTGCTAAAGTGAAATAAATATACAAAAGGAATGTGA // // / |MboII |BseGI FokI BccI BsmAI Esp3I V E E I T Q D G D D F T L F I C F P Y T W K K S H R M E T I S L Y L Y V F L T L G R N H T G W R R F H F I Y M F S L H F ----:----|----:----|----:----|----:----|----:----|----:----| T S S I V C S P S S K V K N I H K G * V L P L F * V P H L R N * K I * I N E K C H F F D C L I S V I E S * K Y T K R V S Hpy178III* BbvII* | TfiI | MboII Hpy178III* MaeIII | HinfI | |HphI \ \ \ \ \ \\ TCAAGAAATGATATGTTACATACTATTCGTGATTCAGTTGAAGACCATTTGGAAAATAAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTCTTTACTATACAATGTATGATAAGCACTAAGTCAACTTCTGGTAAACCTTTTATTT / / / / // Hpy178III* MaeIII | HinfI |HphI | TfiI BbvII* Hpy178III* MboII S R N D M L H T I R D S V E D H L E N K Q E M I C Y I L F V I Q L K T I W K I N K K * Y V T Y Y S * F S * R P F G K * I ----:----|----:----|----:----|----:----|----:----|----:----| E L F S I N C V I R S E T S S W K S F L K L F H Y T V Y * E H N L Q L G N P F Y * S I I H * M S N T I * N F V M Q F I F TatI Bsp1407I |Csp6I ||RsaI |||FatI StyI MseI ApoI ||||CviAII SecI* VspI TspEI ||||| NlaIII \ \ \ \\\\\ \ TCACCAAGGATTAATATAAGAAAATTTACTAATAAAATGTACATGGGTTTCCATTCCAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGGTTCCTAATTATATTCTTTTAAATGATTATTTTACATGTACCCAAAGGTAAGGTTA / / / /// // | VspI TspEI ||| |FatI | MseI ApoI ||| CviAII SecI* ||Bsp1407I StyI ||TatI |NlaIII |Csp6I RsaI S P R I N I R K F T N K M Y M G F H S N H Q G L I * E N L L I K C T W V S I P I T K D * Y K K I Y * * N V H G F P F Q * ----:----|----:----|----:----|----:----|----:----|----:----| D G L I L I L F N V L L I Y M P K W E L I V L S * Y L F I * * Y F T C P N G N W * W P N I Y S F K S I F H V H T E M G I MwoI | CviJI MseI | | DdeI BspCNI TspEI VspI Hpy188I MnlI | | | Hpy188I |BseMII \ \ \ \ \ \ \ \ \\ AAATGTGAATTATTAATCAGAACAAGTGGGCATAGGAGGCTCTCAGACTATATGCTATGG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTTACACTTAATAATTAGTCTTGTTCACCCGTATCCTCCGAGAGTCTGATATACGATACC / / / / / / // // | | Hpy188I MnlI MwoI | |DdeI |BseMII | VspI | Hpy188I BspCNI | MseI CviJI TspEI K C E L L I R T S G H R R L S D Y M L W N V N Y * S E Q V G I G G S Q T I C Y G M * I I N Q N K W A * E A L R L Y A M A ----:----|----:----|----:----|----:----|----:----|----:----| L H S N N I L V L P C L L S E S * I S H Y I H I I L * F L H A Y S A R L S Y A I F T F * * D S C T P M P P E * V I H * P MaeII | SetI TatI | TaiI |Csp6I | | CfrI ||RsaI | | | BalI |||FatI | | | CviJI ||||CviAII TspDTI | | | HaeIII AluI ||||| NlaIII | ApoI | | | | ApoI CviJI ||||| |MslI | TspEI | | | | TspEI | SetI \\\\\ \\ \ \ \ \ \ \ \ \ \ CAAGTACATGAAAATGCCACCATTGAATTTAGTGATACGTTGTGGCCAAATTTTAGCTTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCATGTACTTTTACGGTGGTAACTTAAATCACTATGCAACACCGGTTTAAAATCGAAG /// /// / / / / / / / / / ||| ||MslI TspDTI TspEI | MaeII | CfrI | | CviJI ||| |FatI ApoI TaiI HaeIII | | AluI ||| CviAII SetI CviJI | SetI ||TatI BalI TspEI |NlaIII ApoI |Csp6I RsaI Q V H E N A T I E F S D T L W P N F S F K Y M K M P P L N L V I R C G Q I L A S S T * K C H H * I * * Y V V A K F * L L ----:----|----:----|----:----|----:----|----:----|----:----| C T C S F A V M S N L S V N H G F K L K A L V H F H W W Q I * H Y T T A L N * S L Y M F I G G N F K T I R Q P W I K A E Csp6I AsuI* |RsaI AvaII || SetI |BmgT120I Hin4II* BdaI || | TfiI || BdaI | BdaI BdaI || | HinfI || BdaI | BdaI \ \\ \ \ \\ \ \ \ TTTGCTATGTACCTGATGATTCTCAAATGGTCCTTCTTTTCCACCATTCAAAAATATAAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGATACATGGACTACTAAGAGTTTACCAGGAAGAAAAGGTGGTAAGTTTTTATATTA / // / // / / / BdaI |Csp6I HinfI || BdaI | BdaI BdaI RsaI TfiI || BdaI | BdaI SetI |AvaII Hin4II* |AsuI* BmgT120I F A M Y L M I L K W S F F S T I Q K Y N L L C T * * F S N G P S F P P F K N I M C Y V P D D S Q M V L L F H H S K I * * ----:----|----:----|----:----|----:----|----:----|----:----| K A I Y R I I R L H D K K E V M * F Y L R Q * T G S S E * I T R R K W W E F I Y K S H V Q H N E F P G E K G G N L F I I BdaI BdaI TspDTI | FalI | SspI | FalI | | MseI | | FatI | | Hin4II* | | |CviAII | | |AhaIII* TfiI | | || NlaIII | | || FalI HinfI MboII | | || | XmnI | | || FalI \ \ \ \ \\ \ \ \ \ \\ \ GAGAAGAATCACTCATTGTTTGAAAAAATACATGAAAGCGTTCCTTCAATATTTAAAAAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTCTTAGTGAGTAACAAACTTTTTTATGTACTTTCGCAAGGAAGTTATAAATTTTTT / / // / // / / / / // | MboII |FalI | || XmnI | | | |MseI HinfI |FalI | |FatI | | | AhaIII* TfiI BdaI | CviAII | | | FalI BdaI NlaIII | | | FalI | | Hin4II* | SspI TspDTI E K N H S L F E K I H E S V P S I F K K R R I T H C L K K Y M K A F L Q Y L K K E E S L I V * K N T * K R S F N I * K K ----:----|----:----|----:----|----:----|----:----|----:----| S F F * E N N S F I C S L T G E I N L F H S S D S M T Q F F V H F R E K L I * F L L I V * Q K F F Y M F A N R * Y K F F TatI AluI Bsp1407I CviJI |Csp6I | SetI ||RsaI MaeIII \ \ \\\ \ AAGAAAACAGCTATGTCTTTGTACAACTTTCCAAACCCCCCCATTTCAGTTTCGGTTACA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTTGTCGATACAGAAACATGTTGAAAGGTTTGGGGGGGTAAAGTCAAAGCCAATGT / / /// / | CviJI ||Bsp1407I MaeIII | AluI ||TatI SetI |Csp6I RsaI K K T A M S L Y N F P N P P I S V S V T R K Q L C L C T T F Q T P P F Q F R L Q E N S Y V F V Q L S K P P H F S F G Y R ----:----|----:----|----:----|----:----|----:----|----:----| F F V A I D K Y L K G F G G M E T E T V F S F L * T K T C S E L G G W K L K P * L F C S H R Q V V K W V G G N * N R N C GGAGATGAATAA 1030 ----:----|-- CCTCTACTTATT G D E * E M N X R * I X ----:----|-- P S S Y L L H I S I F L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AclI 1 Psp1406I AflIII 1 AhaIII* 1 DraI AluI 5 AluBI AlwNI 1 CaiI ApoI 6 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 2 BclI 1 FbaI,Ksp22I BdaI 4 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BinI* 3 AlwI,BspPI,AclWI BmgT120I 2 BseGI 2 BstF5I,BtsCI BseMII 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 2 Alw26I,BstMAI Bsp1407I 2 BsrGI,BstAUI BspCNI 1 BspLU11I* 1 PscI,PciI BsrI 3 BseNI,Bse1I,BsrSI BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 3 BstXI 1 BtsI 1 CfrI 1 AcoI,EaeI Csp6I 4 CviQI,RsaNI CviAII 7 CviJI 13 CviKI-1 CviRI* 2 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 3 MalI EciI 1 Eco57I 1 AcuI Eco57MI 2 EcoRI 1 EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FalI 4 FatI 7 FokI 2 GsuI 1 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI Hin4II* 3 HpyAV HindII 1 HincII HindIII 2 HinfI 4 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 5 MaeII 2 HpyCH4IV MaeIII 4 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MnlI 1 MseI 8 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI RsaI 4 AfaI SecI* 2 BseDI,BssECI,BsaJI SetI 9 SspI 2 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqII 1 TatI 3 TfiI 4 PfeI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 8 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI VspI 2 PshBI,AseI XcmI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AgeI AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BarI BbvCI BbvI Bce83I* BceAI BcgI BciVI BglI BglII BisI BlsI BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I BspHI BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstNI BstOI BstSCI BstZ17I BtgZI BtrI Cac8I CauII* Cfr10I Cfr9I ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRII EcoRV EgeI EheI EspI* FaqI FauI Fnu4HI FnuDII* FseI FspAI GlaI GsaI HaeII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin6I HinP1I Hpy99I HspAI KasI KpnI Ksp632I* MaeI MauBI McrI* MfeI MluI MlyI MmeI MroNI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NspBII* OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TaqI TauI TseI TsoI Tsp45I TspMI TstI Tth111I XbaI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769