Restriction Map of RNA14/YMR061W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RNA14/YMR061W on chromosome XIII from coordinates 392755 to 394788.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.15566

AluI CviJI |MlyI |PleI HinfI MnlI CviJI ||SetI | Hpy178III* AciI |Tth111I | MaeI \\\ \ \ \ \\ \ \ ATGTCCAGCTCTACGACTCCTGATTTACTATATCCCTCTGCGGACAAAGTCGCAGAGCCT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGGTCGAGATGCTGAGGACTAAATGATATAGGGAGACGCCTGTTTCAGCGTCTCGGA / /// / / / / / / | ||PleI | Hpy178III* | | Tth111I CviJI | |MlyI HinfI | MnlI | CviJI AciI | AluI SetI M S S S T T P D L L Y P S A D K V A E P C P A L R L L I Y Y I P L R T K S Q S L V Q L Y D S * F T I S L C G Q S R R A * ----:----|----:----|----:----|----:----|----:----|----:----| X D L E V V G S K S Y G E A S L T A S G X T W S * S E Q N V I D R Q P C L R L A H G A R R S R I * * I G R R V F D C L R FatI |CviAII MaeIII || NlaIII DdeI Tsp45I || |MslI | TspDTI MseI \ \\ \\ \ \ \ AGTGACAATATACATGGAGATGAACTACGACTTAGAGAAAGGATTAAAGACAATCCCACG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTGTTATATGTACCTCTACTTGATGCTGAATCTCTTTCCTAATTTCTGTTAGGGTGC / / / /// // / MaeI | | ||MslI |DdeI MseI | | |FatI TspDTI | | CviAII | NlaIII Tsp45I MaeIII S D N I H G D E L R L R E R I K D N P T V T I Y M E M N Y D L E K G L K T I P R * Q Y T W R * T T T * R K D * R Q S H E ----:----|----:----|----:----|----:----|----:----|----:----| L S L I C P S S S R S L S L I L S L G V * H C Y V H L H V V V * L F S * L C D W T V I Y M S I F * S K S F P N F V I G R AluI CviJI PleI | SetI SmlI |MlyI | | Bce83I* | Hpy178III* ||DdeI SspI | | | SspI | | HinfI ||Bpu10I \ \ \ \ \ \ \ \ \\\ AATATTTTATCATACTTCCAGCTTATTCAATATTTGGAAACTCAAGAGTCATACGCTAAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTATAAAATAGTATGAAGGTCGAATAAGTTATAAACCTTTGAGTTCTCAGTATGCGATTC / / / / / / / / // SspI | | | SspI | HinfI | |Bpu10I | | Bce83I* | | |DdeI | CviJI | | SetI | AluI | PleI SetI | MlyI Hpy178III* SmlI N I L S Y F Q L I Q Y L E T Q E S Y A K I F Y H T S S L F N I W K L K S H T L R Y F I I L P A Y S I F G N S R V I R * G ----:----|----:----|----:----|----:----|----:----|----:----| F I K D Y K W S I * Y K S V * S D Y A L S Y K I M S G A * E I N P F E L T M R * I N * * V E L K N L I Q F S L L * V S L AccI |HphI |BssNAI |Hpy166II SetI Hpy166II ||TspDTI OliI |AarI SetI ||| TspEI HphI MslI |BspMI \ \\\ \ \ \ \\ GTGAGAGAAGTATACGAGCAATTTCATAACACATTCCCGTTTTATTCACCTGCGTGGACT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CACTCTCTTCATATGCTCGTTAAAGTATTGTGTAAGGGCAAAATAAGTGGACGCACCTGA /// / / / / / ||AccI TspEI HphI | MslI Hpy166II |Hpy166II | OliI |BssNAI SetI TspDTI HphI V R E V Y E Q F H N T F P F Y S P A W T * E K Y T S N F I T H S R F I H L R G L E R S I R A I S * H I P V L F T C V D F ----:----|----:----|----:----|----:----|----:----|----:----| T L S T Y S C N * L V N G N * E G A H V P S L L I R A I E Y C M G T K N V Q T S H S F Y V L L K M V C E R K I * R R P S ApoI Hin4I CviJI BsmAI Tsp4CI* |MmeI CviRI* TspEI HphI TspEI | TspDTI ||MboII \ \ \ \ \ \ \\\ TTGCAACTAAAGGGTGAATTGGCAAGAGATGAATTTGAGACTGTTGAGAAGATTTTGGCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTTGATTTCCCACTTAACCGTTCTCTACTTAAACTCTGACAACTCTTCTAAAACCGA / / / / / / // /// | CviRI* | HphI | | |TspDTI ||MboII BspMI TspEI | | Tsp4CI* |CviJI AarI | Hin4I MmeI TspEI BsmAI ApoI L Q L K G E L A R D E F E T V E K I L A C N * R V N W Q E M N L R L L R R F W L A T K G * I G K R * I * D C * E D F G S ----:----|----:----|----:----|----:----|----:----|----:----| K C S F P S N A L S S N S V T S F I K A K A V L P H I P L L H I Q S Q Q S S K P Q L * L T F Q C S I F K L S N L L N Q S HindII Hin4I SetI Hpy166II \ \ \ CAATGTCTTTCTGGCAAGTTGGAAAATAATGACCTATCTCTTTGGTCAACATATTTGGAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTTACAGAAAGACCGTTCAACCTTTTATTACTGGATAGAGAAACCAGTTGTATAAACCTG / / / Hin4I SetI Hpy166II HindII Q C L S G K L E N N D L S L W S T Y L D N V F L A S W K I M T Y L F G Q H I W T M S F W Q V G K * * P I S L V N I F G L ----:----|----:----|----:----|----:----|----:----|----:----| * H R E P L N S F L S R D R Q D V Y K S E I D K Q C T P F Y H G I E K T L M N P L T K R A L Q F I I V * R K P * C I Q V MnlI AluI MseI BsrI CviJI |TspEI |Hpy166II | SetI \\ \\ \ \ TACATACGCAGAAAAAACAACTTAATTACTGGTGGACAAGAGGCGAGAGCTGTTATTGTC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTATGCGTCTTTTTTGTTGAATTAATGACCACCTGTTCTCCGCTCTCGACAATAACAG / / // / / / | | || Hpy166II | CviJI | | |MnlI | AluI | | BsrI SetI | TspEI MseI Y I R R K N N L I T G G Q E A R A V I V T Y A E K T T * L L V D K R R E L L L S H T Q K K Q L N Y W W T R G E S C Y C Q ----:----|----:----|----:----|----:----|----:----|----:----| * M R L F F L K I V P P C S A L A T I T S C V C F F C S L * Q H V L P S L Q * Q V Y A S F V V * N S T S L L R S S N N D AlfI AlfI CviRI* AlfI | SpeI |TspEI AlfI BsmI | |MaeI CviRI* ||MmeI MboII \ \ \\ \ \\\ \ AAGGCATTCCAACTAGTTATGCAAAAGTGTGCAATTTTTGAACCCAAATCATCTTCTTTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGTAAGGTTGATCAATACGTTTTCACACGTTAAAAACTTGGGTTTAGTAGAAGAAAA / / // / / / // BsmI AlfI |SpeI CviRI* | TspEI |MboII AlfI MaeI CviRI* AlfI MmeI AlfI K A F Q L V M Q K C A I F E P K S S S F R H S N * L C K S V Q F L N P N H L L F G I P T S Y A K V C N F * T Q I I F F L ----:----|----:----|----:----|----:----|----:----|----:----| L A N W S T I C F H A I K S G L D D E K * P M G V L * A F T H L K Q V W I M K K L C E L * N H L L T C N K F G F * R R K MwoI |BtsI |TspRI || CviJI XcmI TspEI || |XmnI |MnlI \ \\ \\ \\ TGGAACGAATATCTCAATTTTTTAGAGCAGTGGAAGCCATTCAACAAATGGGAGGAGCAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTTGCTTATAGAGTTAAAAAATCTCGTCACCTTCGGTAAGTTGTTTACCCTCCTCGTT / / / / // // TspEI | | | |XmnI |MnlI | | | CviJI XcmI | | BtsI | MwoI TspRI W N E Y L N F L E Q W K P F N K W E E Q G T N I S I F * S S G S H S T N G R S N E R I S Q F F R A V E A I Q Q M G G A T ----:----|----:----|----:----|----:----|----:----|----:----| Q F S Y R L K K S C H F G N L L H S S C K S R I D * N K L A T S A M * C I P P A P V F I E I K * L L P L W E V F P L L L TspEI | BseRI | | FatI | | |CviAII | | || NspI | | || NlaIII | | || |DdeI | | || || Hpy188I | | || || | ApoI | | || || | TspEI BspCNI | | || || | EcoRI |BseMII XbaI \ \ \\ \\ \ \ \\ \ CAGCGAATTGACATGCTCAGAGAATTCTACAAGAAAATGCTATGTGTTCCTTTTGATAAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGCTTAACTGTACGAGTCTCTTAAGATGTTCTTTTACGATACACAAGGAAAACTATTA / / / // // /// | | | || |DdeI ||BseMII | | | || Hpy188I |BspCNI | | | |FatI EcoRI | | | CviAII TspEI | | NlaIII ApoI | | NspI | TspEI BseRI Q R I D M L R E F Y K K M L C V P F D N S E L T C S E N S T R K C Y V F L L I I A N * H A Q R I L Q E N A M C S F * * S ----:----|----:----|----:----|----:----|----:----|----:----| C R I S M S L S N * L F I S H T G K S L V A F Q C A * L I R C S F A I H E K Q Y L S N V H E S F E V L F H * T N R K I I MaeI ApoI Hpy178III* TspEI CviJI \ \ \ CTAGAAAAAATGTGGAATAGATACACTCAATGGGAACAAGAAATAAATTCCCTAACAGCC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GATCTTTTTTACACCTTATCTATGTGAGTTACCCTTGTTCTTTATTTAAGGGATTGTCGG // / / |XbaI TspEI CviJI Hpy178III* ApoI MaeI L E K M W N R Y T Q W E Q E I N S L T A * K K C G I D T L N G N K K * I P * Q P R K N V E * I H S M G T R N K F P N S Q ----:----|----:----|----:----|----:----|----:----|----:----| R S F I H F L Y V * H S C S I F E R V A D L F F T S Y I C E I P V L F L N G L L * F F H P I S V S L P F L F Y I G * C G TspDTI FatI | BssKI |CviAII | EcoRII ApoI || NlaIII | | ScrFI TspEI CviJI || | CviJI | | BseBI \ \ \\ \ \ \ \ \ AGAAAATTTATTGGCGAGTTATCAGCCGAATACATGAAAGCCCGTTCCTTATACCAGGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTTAAATAACCGCTCAATAGTCGGCTTATGTACTTTCGGGCAAGGAATATGGTCCTT / / / // / / / / TspEI CviJI | || CviJI TspDTI | EcoRII ApoI | |FatI | BssKI | CviAII BseBI NlaIII ScrFI R K F I G E L S A E Y M K A R S L Y Q E E N L L A S Y Q P N T * K P V P Y T R N K I Y W R V I S R I H E S P F L I P G M ----:----|----:----|----:----|----:----|----:----|----:----| L F N I P S N D A S Y M F A R E K Y W S W F I * Q R T I L R I C S L G N R I G P S F K N A L * * G F V H F G T G * V L F AclI MaeII TspEI Hin6I |MaeIII | SfaNI |GlaI || SetI | |MseI |MstI* || TaiI | |VspI ||HhaI \\ \ \ \\ \\\ TGGTTGAACGTTACTAATGGATTGAAAAGGGCATCTCCAATTAATCTGCGCACAGCAAAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| ACCAACTTGCAATGATTACCTAACTTTTCCCGTAGAGGTTAATTAGACGCGTGTCGTTTG / / / /// /// | | MaeIII ||| ||Hin6I | MaeII ||| |MstI* | AclI ||| |GlaI TaiI ||| HhaI SetI ||SfaNI |VspI |MseI TspEI W L N V T N G L K R A S P I N L R T A N G * T L L M D * K G H L Q L I C A Q Q T V E R Y * W I E K G I S N * S A H S K Q ----:----|----:----|----:----|----:----|----:----|----:----| H N F T V L P N F L A D G I L R R V A F I T S R * * H I S F P M E L * D A C L L P Q V N S I S Q F P C R W N I Q A C C V BssKI SexAI EcoRII |BsiYI* ||ScrFI ||BseBI ||| Acc65I ||| HgiCI* ||| |Csp6I ||| ||RsaI ||| ||SetI ||| ||NlaIV ||| |||MlyI ||| |||PleI ||| ||||KpnI ||| |||||DdeI ||| ||||||SetI ||| ||||||| Hpy188I ||| ||||||| |HinfI ||| ||||||| || MnlI ||| ||||||| || | BspCNI ||| ||||||| || | |BseMII ||| ||||||| || | || MaeIII \\\ \\\\\\\ \\ \ \\ \ AAGAAAAACATACCACAACCAGGTACCTCAGACTCAAACATTCAGCAGTTACAGATTTGG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTTTGTATGGTGTTGGTCCATGGAGTCTGAGTTTGTAAGTCGTCAATGTCTAAACC / /////// // // // / | ||||||| || || |BseMII MaeIII | ||||||| || || BspCNI | ||||||| || |MnlI | ||||||| || HinfI | ||||||| |DdeI | ||||||| Hpy188I | ||||||HgiCI* | ||||||Acc65I | ||||||PleI | |||||Csp6I | |||||MlyI | ||||NlaIV | ||||RsaI | ||||SetI | |||EcoRII | |||SexAI | |||BssKI | ||KpnI | |BseBI | |ScrFI | SetI BsiYI* K K N I P Q P G T S D S N I Q Q L Q I W R K T Y H N Q V P Q T Q T F S S Y R F G E K H T T T R Y L R L K H S A V T D L V ----:----|----:----|----:----|----:----|----:----|----:----| L F F M G C G P V E S E F M * C N C I Q C S F C V V V L Y R L S L C E A T V S K L F V Y W L W T G * V * V N L L * L N P DdeI EcoP15I Hin4I TspEI | BsaXI SfaNI Hin4I BsaXI MboII \ \ \ \ \ \ \ TTGAATTGGATAAAATGGGAAAGGGAGAATAAGTTGATGCTTAGTGAAGATATGCTATCA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTAACCTATTTTACCCTTTCCCTCTTATTCAACTACGAATCACTTCTATACGATAGT / / / / / / / TspEI | EcoP15I | Hin4I BsaXI MboII BsaXI | Hin4I DdeI SfaNI L N W I K W E R E N K L M L S E D M L S * I G * N G K G R I S * C L V K I C Y H E L D K M G K G E * V D A * * R Y A I T ----:----|----:----|----:----|----:----|----:----|----:----| N F Q I F H S L S F L N I S L S S I S D T S N S L I P F P S Y T S A * H L Y A I Q I P Y F P F P L I L Q H K T F I H * * TfiI HinfI | MaeIII | | Hin4I | | Hin4I | | | MaeII | | | | SetI | | | | TaiI FatI | | | | | PsiI |CviAII | | | | | | EcoP15I SetI || NlaIII \ \ \ \ \ \ \ \ \\ \ CAAAGAATCAGTTACGTTTATAAACAAGGTATTCAATACATGATATTTTCTGCTGAAATG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCTTAGTCAATGCAAATATTTGTTCCATAAGTTATGTACTATAAAAGACGACTTTAC // / // / / / / // || | || | | SetI | |FatI || | || | EcoP15I | CviAII || | || PsiI NlaIII || | |MaeII || | MaeIII || TaiI || SetI |HinfI |TfiI Hin4I Hin4I Q R I S Y V Y K Q G I Q Y M I F S A E M K E S V T F I N K V F N T * Y F L L K C K N Q L R L * T R Y S I H D I F C * N V ----:----|----:----|----:----|----:----|----:----|----:----| C L I L * T * L C P I * Y M I N E A S I V F F * N R K Y V L Y E I C S I K Q Q F L S D T V N I F L T N L V H Y K R S F H Hpy188I | ApoI | TspEI | | Hin4I | | Hin4I | | | MboI | | | Hpy188I | | | | DpnI | | | | |TaqI Csp6I | | | | |BstKTI |RsaI | | | | || BinI* \\ \ \ \ \ \\ \ TGGTACGATTATTCAATGTATATATCTGAAAATTCGGATCGACAAAATATCTTATATACT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ACCATGCTAATAAGTTACATATATAGACTTTTAAGCCTAGCTGTTTTATAGAATATATGA // // // // // / / |Csp6I |Hin4I || || || BinI* Hin4I RsaI |Hin4I || || |TaqI Hin4I Hpy188I || || MboI || |DpnI || BstKTI |Hpy188I TspEI ApoI W Y D Y S M Y I S E N S D R Q N I L Y T G T I I Q C I Y L K I R I D K I S Y I L V R L F N V Y I * K F G S T K Y L I Y C ----:----|----:----|----:----|----:----|----:----|----:----| H Y S * E I Y I D S F E S R C F I K Y V T T R N N L T Y I Q F N P D V F Y R I Y P V I I * H I Y R F I R I S L I D * I S Hin4I Hin4I | MwoI | | AluI | | CviJI | | | SetI | | | |MlyI | | | |PleI | | | ||HphI | | | ||| Hpy178III* Hpy188I | | | ||| | HinfI SetI Hin4II* | BsmI \ \ \ \\\ \ \ \ \ \ \ GCGTTATTAGCTAATCCCGACTCACCTTCTCTTACATTCAAGTTATCCGAATGCTACGAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CGCAATAATCGATTAGGGCTGAGTGGAAGAGAATGTAAGTTCAATAGGCTTACGATGCTT / / / // / // / / / | | | || | |SetI Hin4II* | BsmI | | | || | HinfI Hpy188I | | | || Hpy178III* | | | |PleI | | | MlyI | | | HphI | | CviJI | | AluI | SetI MwoI A L L A N P D S P S L T F K L S E C Y E R Y * L I P T H L L L H S S Y P N A T N V I S * S R L T F S Y I Q V I R M L R T ----:----|----:----|----:----|----:----|----:----|----:----| A N N A L G S E G E R V N L N D S H * S Q T I L * D R S V K E * M * T I R I S R R * * S I G V * R R K C E L * G F A V F ApaLI | CviRI* | Hpy166II TfiI | | SduI HinfI | | BseSI BsrI | Hpy188I Tsp4CI* | | HgiAI* \ \ \ \ \ \ \ CTGGATAATGATTCTGAAAGTGTTTCTAACTGTTTTGACAAGTGCACTCAAACTTTACTA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GACCTATTACTAAGACTTTCACAAAGATTGACAAAACTGTTCACGTGAGTTTGAAATGAT / // / / / / BsrI |Hpy188I Tsp4CI* | | ApaLI HinfI | Hpy166II TfiI | CviRI* HgiAI* BseSI SduI L D N D S E S V S N C F D K C T Q T L L W I M I L K V F L T V L T S A L K L Y Y G * * F * K C F * L F * Q V H S N F T I ----:----|----:----|----:----|----:----|----:----|----:----| S S L S E S L T E L Q K S L H V * V K S V P Y H N Q F H K * S N Q C T C E F K V Q I I I R F T N R V T K V L A S L S * * Hpy188I MboI | ApoI HphI | DpnI | MnlI | MboII | |BstKTI | TspEI | | BbvI \ \\ \ \ \ \ \ TCGCAGTATAAAAAGATCGCCTCCGATGTAAATTCGGGTGAAGATAATAACACAGAGTAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AGCGTCATATTTTTCTAGCGGAGGCTACATTTAAGCCCACTTCTATTATTGTGTCTCATA // / / / / / / / || MboI | MnlI TspEI | MboII BbvI |DpnI Hpy188I ApoI HphI BstKTI S Q Y K K I A S D V N S G E D N N T E Y R S I K R S P P M * I R V K I I T Q S M A V * K D R L R C K F G * R * * H R V * ----:----|----:----|----:----|----:----|----:----|----:----| D C Y L F I A E S T F E P S S L L V S Y I A T Y F S R R R H L N P H L Y Y C L T R L I F L D G G I Y I R T F I I V C L I TseI AluI CviJI |BisI ||BlsI ||SetI ||| TspDTI TspEI ||| | MnlI | MseI \\\ \ \ \ \ GAACAAGAGCTGCTATACAAACAGAGGGAAAAATTAACATTCGTGTTTTGCGTGTATATG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTTCTCGACGATATGTTTGTCTCCCTTTTTAATTGTAAGCACAAAACGCACATATAC / //// / // | |||| MnlI |MseI | |||TspDTI TspEI | |||TseI | ||BisI | |BlsI | CviJI | AluI SetI E Q E L L Y K Q R E K L T F V F C V Y M N K S C Y T N R G K N * H S C F A C I * T R A A I Q T E G K I N I R V L R V Y E ----:----|----:----|----:----|----:----|----:----|----:----| S C S S S Y L C L S F N V N T N Q T Y I H V L A A I C V S P F I L M R T K R T Y F L L Q * V F L P F F * C E H K A H I H Hpy178III* | AciI | | TseI | | |BisI | | ||BlsI | | ||| MaeII | | ||| |BsaAI | | ||| ||Csp6I | | ||| |||RsaI | | ||| |||SetI | | ||| |||TaiI | | ||| |||| Tsp4CI* TspDTI | TspDTI | ||| |||| |BbvI \ \ \ \ \\\ \\\\ \\ AATACGATGAAAAGAATATCAGGACTATCCGCAGCACGTACTGTATTTGGTAAATGTCGT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGCTACTTTTCTTATAGTCCTGATAGGCGTCGTGCATGACATAAACCATTTACAGCA / / / ///// ///// / TspDTI | | ||||| ||||| BbvI | | ||||| ||||Tsp4CI* | | ||||| |||Csp6I | | ||||| ||RsaI | | ||||| |MaeII | | ||||| BsaAI | | ||||TaiI | | ||||SetI | | |||TseI | | ||BisI | | |BlsI | | AciI | Hpy178III* TspDTI N T M K R I S G L S A A R T V F G K C R I R * K E Y Q D Y P Q H V L Y L V N V V Y D E K N I R T I R S T Y C I W * M S * ----:----|----:----|----:----|----:----|----:----|----:----| F V I F L I D P S D A A R V T N P L H R S Y S S F F I L V I R L V Y Q I Q Y I D I R H F S Y * S * G C C T S Y K T F T T FatI |CviAII || NlaIII || Eco57I || Eco57MI || |AcyI || |MaeII || ||ZraI || ||| AccI || ||| SetI || ||| TaiI || ||| AatII || ||| |Hpy166II || ||| || MaeII CviRI* || ||| || |BsaAI | EcoT22I || ||| || || SetI | | ApoI Hpy166II MseI || ||| || || TaiI | | TspEI \ \ \\ \\\ \\ \\ \ \ \ \ AAACTGAAGCGTATATTAACACATGACGTCTACGTGGAAAATGCATATTTAGAATTTCAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGACTTCGCATATAATTGTGTACTGCAGATGCACCTTTTACGTATAAATCTTAAAGTT / / / /// // // // / / / Hpy166II | | ||| || || |MaeII | CviRI* TspEI | | ||| || || BsaAI EcoT22I ApoI | | ||| || |AccI | | ||| || |TaiI | | ||| || |SetI | | ||| || Hpy166II | | ||| |MaeII | | ||| |AcyI | | ||| ZraI | | ||AatII | | ||FatI | | ||TaiI | | ||SetI | | |CviAII | | Eco57MI | | Eco57I | NlaIII MseI K L K R I L T H D V Y V E N A Y L E F Q N * S V Y * H M T S T W K M H I * N F K T E A Y I N T * R L R G K C I F R I S K ----:----|----:----|----:----|----:----|----:----|----:----| L S F R I N V C S T * T S F A Y K S N * Y V S A Y I L V H R R R P F H M N L I E F Q L T Y * C M V D V H F I C I * F K L MseI BccI PsiI MseI SetI TspEI |AhaIII* |Hin4I \ \ \ \ \\ \\ AATCAAAACGATTATAAGACTGCTTTTAAGGTTTTAGAATTGGGTTTAAAATACTTCCAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTTTTGCTAATATTCTGACGAAAATTCCAAAATCTTAACCCAAATTTTATGAAGGTT / / / // / // PsiI MseI TspEI |MseI | |BstXI SetI | | BccI | Hin4I AhaIII* N Q N D Y K T A F K V L E L G L K Y F Q I K T I I R L L L R F * N W V * N T S K S K R L * D C F * G F R I G F K I L P K ----:----|----:----|----:----|----:----|----:----|----:----| F * F S * L V A K L T K S N P K F Y K W F D F R N Y S Q K * P K L I P N L I S G I L V I I L S S K L N * F Q T * F V E L DdeI MseI MseI TfiI BstXI | Hin4I | SspI |AhaIII* HinfI \ \ \ \ \ \\ \ AACGATGGAGTTTATATCAACAAATACTTAGATTTTTTAATATTTTTAAATAAGGATTCG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTACCTCAAATATAGTTGTTTATGAATCTAAAAAATTATAAAAATTTATTCCTAAGC / / / / // / | DdeI | SspI |MseI HinfI Hin4I MseI AhaIII* TfiI N D G V Y I N K Y L D F L I F L N K D S T M E F I S T N T * I F * Y F * I R I R R W S L Y Q Q I L R F F N I F K * G F A ----:----|----:----|----:----|----:----|----:----|----:----| F S P T * I L L Y K S K K I N K F L S E F R H L K Y * C I S L N K L I K L Y P N V I S N I D V F V * I K * Y K * I L I R MseI | BarI | |BseYI | ||Hin4II* | ||| AluI | ||| GsaI | ||| CviJI | ||| PvuII MboI | ||| NspBII* | DpnI | ||| | SetI | |BstKTI SetI TspRI CviRI* | ||| | |BsiYI* \ \\ \ \ \ \ \\\ \ \\ CAGATCAAAACCTTATTTGAAACATCAGTGGAAAAAGTGCAAGATTTAACCCAGCTGAAG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTAGTTTTGGAATAAACTTTGTAGTCACCTTTTTCACGTTCTAAATTGGGTCGACTTC // / / / / / / / / / || | SetI TspRI | | | | | NspBII* || MboI | | | | | BsiYI* |DpnI | | | | | BseYI BstKTI | | | | | PvuII | | | | | CviJI | | | | | AluI | | | | SetI | | | Hin4II* | | | GsaI | | MseI | BarI CviRI* Q I K T L F E T S V E K V Q D L T Q L K R S K P Y L K H Q W K K C K I * P S * R D Q N L I * N I S G K S A R F N P A E G ----:----|----:----|----:----|----:----|----:----|----:----| C I L V K N S V D T S F T C S K V W S F A S * F R I Q F M L P F L A L N L G A S L D F G * K F C * H F F H L I * G L Q L TfiI HinfI AclI Eco57I | TaqI MaeIII MaeII Eco57MI | | ApoI |TspDTI | SetI | BarI | | TspEI || MseI | TaiI \ \ \ \ \ \\ \ \ \ GAAATATACAAGAAAATGATAAGTTATGAATCGAAATTCGGTAACTTAAACAACGTTTAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTATATGTTCTTTTACTATTCAATACTTAGCTTTAAGCCATTGAATTTGTTGCAAATA / / / / // / / / / | BarI | TaqI || | | | MaeII Eco57MI HinfI || | | | AclI Eco57I TfiI || | | TaiI || | | SetI || | MseI || MaeIII |TspDTI TspEI ApoI E I Y K K M I S Y E S K F G N L N N V Y K Y T R K * * V M N R N S V T * T T F I N I Q E N D K L * I E I R * L K Q R L F ----:----|----:----|----:----|----:----|----:----|----:----| S I Y L F I I L * S D F N P L K F L T * P F I C S F S L N H I S I R Y S L C R K F Y V L F H Y T I F R F E T V * V V N I XbaI |MaeI TaqI Tsp4CI* ApoI |Hpy178III* AsuII | NlaIV TspEI \\ \ \ \ \ TCTCTAGAGAAAAGATTTTTCGAACGGTTCCCCCAAGAAAATTTGATTGAAGTTTTCACA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGATCTCTTTTCTAAAAAGCTTGCCAAGGGGGTTCTTTTAAACTAACTTCAAAAGTGT // / / / / |XbaI | | NlaIV TspEI Hpy178III* | Tsp4CI* ApoI MaeI AsuII TaqI S L E K R F F E R F P Q E N L I E V F T L * R K D F S N G S P K K I * L K F S Q S R E K I F R T V P P R K F D * S F H K ----:----|----:----|----:----|----:----|----:----|----:----| E R S F L N K S R N G W S F K I S T K V N E L S F I K R V T G G L F N S Q L K * R * L F S K E F P E G L F I Q N F N E C MseI |HpaI |MmeI ApoI |HindII TspEI MseI TspEI |Hpy166II MnlI \ \ \ \\ \ AGTCGTTATCAAATTCAAAACTCCAACTTAATAAAGAAATTAGAGTTAACTTATATGTAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TCAGCAATAGTTTAAGTTTTGAGGTTGAATTATTTCTTTAATCTCAATTGAATATACATA / / / / // / TspEI MseI | | |MseI MnlI ApoI | | Hpy166II | | HindII | | HpaI | MmeI TspEI S R Y Q I Q N S N L I K K L E L T Y M Y V V I K F K T P T * * R N * S * L I C I S L S N S K L Q L N K E I R V N L Y V * ----:----|----:----|----:----|----:----|----:----|----:----| L R * * I * F E L K I F F N S N V * I Y L D N D F E F S W S L L S I L T L K Y T T T I L N L V G V * Y L F * L * S I H I CfrI | BalI | CviJI | BsaBI | HaeIII | |BseGI | || FatI | || |CviAII MaeIII | || ||BglI Tsp4CI* | || ||MwoI |MboII | || ||| FokI |BbvII* | || ||| NlaIII || MboII Hpy178III* | || ||| |BccI || | MboII | BccI | || ||| |CviJI \\ \ \ \ \ \ \\ \\\ \\ AATGAGGAAGAAGACAGTTACTTTTCTTCTGGAAACGGGGATGGCCATCATGGCTCTTAC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTCCTTCTTCTGTCAATGAAAAGAAGACCTTTGCCCCTACCGGTAGTACCGAGAATG // / / / / // /// //// / || | BbvII* | BccI || ||| |||| FokI || | MaeIII Hpy178III* || ||| |||BccI || | MboII || ||| ||CviJI || MboII || ||| |FatI |MboII || ||| CviAII Tsp4CI* || ||NlaIII || |MwoI || |BglI || CfrI |HaeIII |BsaBI |CviJI |BalI BseGI N E E E D S Y F S S G N G D G H H G S Y M R K K T V T F L L E T G M A I M A L T * G R R Q L L F F W K R G W P S W L L Q ----:----|----:----|----:----|----:----|----:----|----:----| L S S S S L * K E E P F P S P W * P E * Y H P L L C N S K K Q F R P H G D H S K I L F F V T V K R R S V P I A M M A R V Hpy188I | BsmAI MnlI BsrI AjuI \ \ \ \ \ AATATGAGTTCGTCAGATAGAAAGAGACTAATGGAGGAAACTGGAAACAATGGAAACTTC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTATACTCAAGCAGTCTATCTTTCTCTGATTACCTCCTTTGACCTTTGTTACCTTTGAAG / / / / / Hpy188I | MnlI BsrI AjuI BsmAI N M S S S D R K R L M E E T G N N G N F I * V R Q I E R D * W R K L E T M E T S Y E F V R * K E T N G G N W K Q W K L L ----:----|----:----|----:----|----:----|----:----|----:----| L I L E D S L F L S I S S V P F L P F K C Y S N T L Y F S V L P P F Q F C H F S I H T R * I S L S * H L F S S V I S V E HinfI | DdeI | | AjuI | | Hpy188I | | | AluI | | | CviJI | | | | SetI ApoI | | | | |MnlI TspEI | | | | || BspCNI | BsmAI | | | | || |BseMII | | MlyI | | | | || || SetI | | PleI | | | | || || | Hpy178III* MmeI \ \ \ \ \ \ \ \\ \\ \ \ \ TCCAATAAGAAATTCAAAAGAGACTCAGAGCTTCCAACAGAGGTTCTTGATTTATTGAGC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTATTCTTTAAGTTTTCTCTGAGTCTCGAAGGTTGTCTCCAAGAACTAAATAACTCG / /// / //// / / // / / / | ||| | |||| | | || SetI | MmeI | ||| | |||| | | |BseMII Hpy178III* | ||| | |||| | | BspCNI | ||| | |||| | MnlI | ||| | |||| CviJI | ||| | |||| AluI | ||| | |||SetI | ||| | ||DdeI | ||| | |Hpy188I | ||| | HinfI | ||| AjuI | ||BsmAI | |PleI | MlyI TspEI ApoI S N K K F K R D S E L P T E V L D L L S P I R N S K E T Q S F Q Q R F L I Y * A Q * E I Q K R L R A S N R G S * F I E R ----:----|----:----|----:----|----:----|----:----|----:----| E L L F N L L S E S S G V S T R S K N L R W Y S I * F L S L A E L L P E Q N I S G I L F E F S V * L K W C L N K I * Q A MaeII Hin6I | SetI |GlaI | TaiI ApoI |MstI* | | SspI SfaNI ||HhaI ApoI | | | MseI TspEI TaqI ||| TspEI TspEI \ \ \ \ \ \ \\\ \ \ GTTATACCAAAACGTCAATATTTTAATACAAATTTACTCGATGCGCAGAAATTGGTGAAT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CAATATGGTTTTGCAGTTATAAAATTATGTTTAAATGAGCTACGCGTCTTTAACCACTTA / / / / / / /// / | | SspI MseI TspEI | ||Hin6I TspEI | MaeII SfaNI | |MstI* TaiI ApoI | |GlaI SetI | HhaI TaqI V I P K R Q Y F N T N L L D A Q K L V N L Y Q N V N I L I Q I Y S M R R N W * I Y T K T S I F * Y K F T R C A E I G E F ----:----|----:----|----:----|----:----|----:----|----:----| T I G F R * Y K L V F K S S A C F N T F R * V L V D I N * Y L N V R H A S I P S N Y W F T L I K I C I * E I R L F Q H I MseI |AhaIII* ||HphI ||| MboI ||| BclI MmeI ||| | DpnI TfiI SduI | MseI ||| | |BstKTI HinfI Tsp4CI* HgiAI* | SetI \\\ \ \\ \ \ \ \ \ TTTTTAAATGATCAAGTAGAGATTCCAACAGTTGAGAGCACCAAGTCAGGTTAA 1990 2000 2010 2020 2030 ----:----|----:----|----:----|----:----|----:----|---- AAAAATTTACTAGTTCATCTCTAAGGTTGTCAACTCTCGTGGTTCAGTCCAATT / // // / / / / / / | || || BclI | | HgiAI* MmeI MseI | || || MboI | | SduI SetI | || |DpnI | Tsp4CI* | || BstKTI HinfI | |MseI TfiI | AhaIII* | HphI TspEI ApoI F L N D Q V E I P T V E S T K S G * F * M I K * R F Q Q L R A P S Q V X F K * S S R D S N S * E H Q V R L X ----:----|----:----|----:----|----:----|----:----|---- K K F S * T S I G V T S L V L D P * N K L H D L L S E L L Q S C W T L N K * I I L Y L N W C N L A G L * T L # Enzymes that cut Frequency Isoschizomers AarI 1 AatII 1 Acc65I 1 Asp718I AccI 2 FblI,XmiI AciI 2 BspACI,SsiI AclI 2 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 3 DraI AjuI 1 AlfI 2 AluI 7 AluBI ApaLI 1 Alw44I,VneI ApoI 13 AcsI,XapI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BalI 1 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 1 BpuEI BclI 1 FbaI,Ksp22I BglI 1 BinI* 1 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 Bpu10I 1 BsaAI 2 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 3 BseRI 1 BseSI 1 BaeGI,BstSLI BseYI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 3 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 3 BspMI 1 BfuAI,Acc36I,BveI BsrI 3 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 4 BstXI 1 BtsI 1 CfrI 1 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 6 CviJI 15 CviKI-1 CviRI* 6 HpyCH4V DdeI 7 BstDEI,HpyF3I DpnI 4 MalI Eco57I 2 AcuI Eco57MI 2 EcoP15I 2 EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 6 FokI 1 GlaI 2 GsaI 1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 6 Hin4II* 2 HpyAV Hin6I 2 HinP1I,HspAI HindII 2 HincII HinfI 10 HpaI 1 KspAI HphI 6 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 9 KpnI 1 MaeI 4 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 6 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MlyI 5 SchI MmeI 5 MnlI 9 MseI 16 Tru1I,Tru9I MslI 2 RseI,SmiMI MstI* 2 AviII,FspI,NsbI,Acc16I MwoI 3 HpyF10VI,BstMWI NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 1 BstNSI,XceI OliI 1 AleI PleI 5 PpsI PsiI 2 AanI PvuII 1 RsaI 3 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SetI 25 SexAI 1 MabI SfaNI 3 LweI SmlI 1 SmoI SpeI 1 BcuI,AhlI SspI 4 TaiI 7 TaqI 4 TfiI 5 PfeI TseI 2 ApeKI Tsp45I 1 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 8 TspEI 25 TasI,Tsp509I,Sse9I TspRI 2 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI XbaI 2 XcmI 1 XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AbsI AflII AflIII AgeI AloI AlwNI ApaI AscI AsuI* AvaI AvaII AvrII BaeI BamHI BbvCI BceAI BcgI BciVI BdaI BetI* BfiI BglII BmeT110I BmgT120I BmtI BplI BsePI BsgI BsiI* BslFI BsmFI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BstAPI BstEII BtgZI BtrI Cac8I CauII* Cfr10I Cfr9I ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRV EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GsuI HaeII HgaI HgiJII* HindIII HpaII Hpy99I KasI Ksp632I* MauBI McrI* MfeI MluI MroNI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SecI* SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TatI TauI TsoI TspGWI TspMI TstI XhoI XhoII XmaCI XmaI XmaIII* # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769