Restriction Map of CSM3/YMR048W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CSM3/YMR048W on chromosome XIII from coordinates 366981 to 367934.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.17255

MboI | DpnI | |BstKTI SetI | ||Hpy178III* |MlyI HinfI | ||| BinI* Tsp4CI* MaeI |PleI | Hpy188I \ \\\ \ \ \ \\ \ \ ATGGATCAAGATTTTGACAGTTTATTACTAGGTTTCAATGACTCCGATAGTGTCCAAAAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTAGTTCTAAAACTGTCAAATAATGATCCAAAGTTACTGAGGCTATCACAGGTTTTT // / / / / // // // || | | BinI* Tsp4CI* || |PleI |Hpy188I || | Hpy178III* || MlyI HinfI || MboI |MaeI |DpnI SetI BstKTI M D Q D F D S L L L G F N D S D S V Q K W I K I L T V Y Y * V S M T P I V S K K G S R F * Q F I T R F Q * L R * C P K R ----:----|----:----|----:----|----:----|----:----|----:----| X S * S K S L K N S P K L S E S L T W F X P D L N Q C N I V L N * H S R Y H G F H I L I K V T * * * T E I V G I T D L F BseGI | BinI* | | FokI | | | MboI | | | | DpnI | | | | |BstKTI | | | | || BsrDI | | | | || | BinI* | | | | || | | AciI | | | | || | | | MboI | | | | || | | | BamHI | | | | || | | | XhoII Tsp4CI* | | | | || | | | | DpnI |Csp6I BccI | | | | || | | | | NlaIV ||RsaI |CviJI | | | | || | | | | |BstKTI \\\ \\ \ \ \ \ \\ \ \ \ \ \\ GACCCAACTGTACCAAATGGCTTGGATGGTTCAGTAGTTGATCCTACCATTGCGGATCCA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGGTTGACATGGTTTACCGAACCTACCAAGTCATCAACTAGGATGGTAACGCCTAGGT / // / / / // / / / /// / | |Csp6I CviJI BseGI | || | | | ||| XhoII | RsaI BccI | || | | | ||| BamHI Tsp4CI* | || | | | ||| MboI | || | | | ||NlaIV | || | | | ||DpnI | || | | | |BstKTI | || | | | AciI | || | | BinI* | || | BsrDI | || MboI | |FokI | |DpnI | BstKTI BinI* D P T V P N G L D G S V V D P T I A D P T Q L Y Q M A W M V Q * L I L P L R I Q P N C T K W L G W F S S * S Y H C G S N ----:----|----:----|----:----|----:----|----:----|----:----| S G V T G F P K S P E T T S G V M A S G L G L Q V L H S P H N L L Q D * W Q P D V W S Y W I A Q I T * Y N I R G N R I W AciI BinI* | TspEI | | MwoI | | | BplI | | | BplI | | | |AluI | | | |CviJI TspEI | | | ||MaeI |MnlI | | | ||Bce83I* StuI || MseI | | | |||SetI CviJI || | BplI | | | |||| Hin4II* HaeIII || | BplI | | | |||| | MmeI | SmlI || | | CviJI DdeI \ \ \ \\\\ \ \ \ \ \\ \ \ \ \ ACCGCAATTACAGCTAGAAAGAGAAGGCCTCAAGTAAAATTAACAGCCGAAAAACTACTC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCGTTAATGTCGATCTTTCTCTTCCGGAGTTCATTTTAATTGTCGGCTTTTTGATGAG // / / /// / / / / / / // / / || | | ||| | MmeI | | | | || CviJI TspRI || | | ||| Hin4II* | | | | |MseI || | | ||| MaeI | | | | TspEI || | | ||CviJI | | | BplI || | | ||AluI | | | BplI || | | |Bce83I* | | MnlI || | | SetI | SmlI || | TspEI HaeIII || MwoI CviJI || BplI StuI || BplI |AciI BinI* T A I T A R K R R P Q V K L T A E K L L P Q L Q L E R E G L K * N * Q P K N Y S R N Y S * K E K A S S K I N S R K T T Q ----:----|----:----|----:----|----:----|----:----|----:----| V A I V A L F L L G * T F N V A S F S S L R L * L * F S F A E L L I L L R F V V G C N C S S L S P R L Y F * C G F F * E TspRI | BspCNI | |SetI | |BseMII | ||Hpy166II CviRI* ApoI | ||| NdeI | BciVI TspEI \ \\\ \ \ \ \ AGTGATAAAGGTTTACCATATGTTTTGAAAAATGCACATAAAAGGATACGAATTTCCTCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTATTTCCAAATGGTATACAAAACTTTTTACGTGTATTTTCCTATGCTTAAAGGAGT / /// / / / / / DdeI ||| | NdeI | BciVI TspEI ||| Hpy166II CviRI* ApoI ||BseMII |BspCNI SetI S D K G L P Y V L K N A H K R I R I S S V I K V Y H M F * K M H I K G Y E F P Q * * R F T I C F E K C T * K D T N F L K ----:----|----:----|----:----|----:----|----:----|----:----| L S L P K G Y T K F F A C L L I R I E E * H Y L N V M H K S F H V Y F S V F K R T I F T * W I N Q F I C M F P Y S N G * AluI CviJI | SetI | |BsiYI* MnlI | || FatI |Hin4I | || SduI |Hin4I Hin4I | || BseSI || NdeI SspI Hin4I | || |CviAII \\ \ \ \ \ \\ \\ AAAAAAAACTCATATGACAACTTATCAAATATTATTCAGTTTTACCAGCTTTGGGCACAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTTTGAGTATACTGTTGAATAGTTTATAATAAGTCAAAATGGTCGAAACCCGTGTA / / / / / / / / / / | MnlI NdeI | Hin4I | | | | CviAII Hin4I | Hin4I | | | NlaIII Hin4I SspI | | BseSI | | SduI | BsiYI* | CviJI | AluI SetI K K N S Y D N L S N I I Q F Y Q L W A H K K T H M T T Y Q I L F S F T S F G H M K K L I * Q L I K Y Y S V L P A L G T * ----:----|----:----|----:----|----:----|----:----|----:----| F F F E Y S L K D F I I * N * W S Q A C L F F S M H C S I L Y * E T K G A K P V F F V * I V V * * I N N L K V L K P C M StyI SecI* MboI MboII | TspDTI BglII |TspDTI TspEI | | ApoI XhoII || Tsp4CI* NlaIII | | TspEI | DpnI || | SetI | XmnI | | | MseI | |BstKTI || | |BinI* \ \ \ \ \ \ \ \\ \\ \ \\ GAATTGTTTCCCAAGGCAAAATTTAAGGATTTTATGAAGATCTGTCAAACAGTAGGTAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAACAAAGGGTTCCGTTTTAAATTCCTAAAATACTTCTAGACAGTTTGTCATCCATTT / / / / / / // / / / / / | TspEI | SecI* | MseI || | | | SetI BinI* | XmnI | StyI TspEI || | | Tsp4CI* FatI TspDTI ApoI || | TspDTI || | MboII || XhoII || BglII || MboI |DpnI BstKTI E L F P K A K F K D F M K I C Q T V G K N C F P R Q N L R I L * R S V K Q * V K I V S Q G K I * G F Y E D L S N S R * N ----:----|----:----|----:----|----:----|----:----|----:----| S N N G L A F N L S K I F I Q * V T P L H I T E W P L I * P N * S S R D F L L Y F Q K G L C F K L I K H L D T L C Y T F CviJI MboI | PleI XhoII | |MlyI FatI | DpnI | || BsiYI* |CviAII | |BstKTI | || | BcgI ||BslFI | ||BsrI DdeI HinfI | || | BccI ||| NlaIII \ \\\ \ \ \ \\ \ \ \\\ \ ACAGATCCAGTTCTTAGAGAATATAGAGTCAGCCTTTTTAGGGACGAGATGGGCATGAGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTAGGTCAAGAATCTCTTATATCTCAGTCGGAAAAATCCCTGCTCTACCCGTACTCA // / / / / // / / / // / || XhoII DdeI | | || | BccI | || BslFI || MboI | | || BcgI | |FatI |DpnI | | |BsiYI* | CviAII |BsrI | | PleI NlaIII BstKTI | | MlyI | CviJI HinfI T D P V L R E Y R V S L F R D E M G M S Q I Q F L E N I E S A F L G T R W A * V R S S S * R I * S Q P F * G R D G H E F ----:----|----:----|----:----|----:----|----:----|----:----| V S G T R L S Y L T L R K L S S I P M L F L D L E * L I Y L * G K * P R S P C S C I W N K S F I S D A K K P V L H A H T BfiI BssKI EcoRII | ScrFI | BseBI BsmAI | |SetI TaqI | BcgI BsrI | || HphI SetI \ \ \ \ \ \\ \ \ TTCGATGTTGGCACACGGGAGACTGGGCAAGACCTGGAAAGACAATCACCTATGGTTGAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTACAACCGTGTGCCCTCTGACCCGTTCTGGACCTTTCTGTTAGTGGATACCAACTT / / / / / / / / TaqI | BsmAI BsrI | | EcoRII SetI BcgI | | BssKI | | HphI | BseBI | ScrFI BfiI SetI F D V G T R E T G Q D L E R Q S P M V E S M L A H G R L G K T W K D N H L W L K R C W H T G D W A R P G K T I T Y G * R ----:----|----:----|----:----|----:----|----:----|----:----| K S T P V R S V P C S R S L C D G I T S N R H Q C V P S Q A L G P F V I V * P Q E I N A C P L S P L V Q F S L * R H N F FatI AflIII BspLU11I* |CviAII || MaeIII || Tsp45I || |NspI || |NlaIII || || MboII || || | AciI || || | SecI* || || | DsaI* || || | Ksp632I* || || | | AciI || || | | FnuDII* StuI Hin6I || || | | NspBII* CviJI |GlaI || || | | |MnlI HaeIII |MstI* || || | | |SacII | MboII ||HhaI \\ \\ \ \ \\ \ \ \\\ GAACATGTCACTTCCGCGGAAGAGAGGCCTATTGTCGCAGATAGTTTTGCGCAAGACAAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTACAGTGAAGGCGCCTTCTCTCCGGATAACAGCGTCTATCAAAACGCGTTCTGTTT / // / / //// / / /// | || | | |||DsaI* | MboII ||Hin6I | || | | |||SecI* HaeIII |MstI* | || | | |||AciI CviJI |GlaI | || | | ||Ksp632I* StuI HhaI | || | | |NspBII* | || | | |FnuDII* | || | | |AciI | || | | |MnlI | || | | SacII | || | Tsp45I | || | MaeIII | || MboII | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI E H V T S A E E R P I V A D S F A Q D K N M S L P R K R G L L S Q I V L R K T K T C H F R G R E A Y C R R * F C A R Q K ----:----|----:----|----:----|----:----|----:----|----:----| S C T V E A S S L G I T A S L K A C S L L V H * K R P L S A * Q R L Y N Q A L C F M D S G R F L P R N D C I T K R L V F HphI | EcoRV Hpy166II | |MboII | TaqI | ||BsaBI SetI \ \ \ \\\ \ AGGAATGTAAACAATGTCGATTACGATAATGACGAAGATGACGATATCTATCACCTTTCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTACATTTGTTACAGCTAATGCTATTACTGCTTCTACTGCTATAGATAGTGGAAAGA / / / / / / Hpy166II TaqI | | | SetI | | BsaBI | MboII | EcoRV HphI R N V N N V D Y D N D E D D D I Y H L S G M * T M S I T I M T K M T I S I T F L E C K Q C R L R * * R R * R Y L S P F L ----:----|----:----|----:----|----:----|----:----|----:----| L F T F L T S * S L S S S S S I * * R E F S H L C H R N R Y H R L H R Y R D G K P I Y V I D I V I I V F I V I D I V K R Tsp4CI* |Csp6I MaeII ||RsaI Ksp632I* | SetI ||| MseI |MnlI MboII | TaiI ||| | TspDTI \\ \ \ \ \\\ \ \ TATCGCAACAGAAGAGGACGAGTTTTGGACGAACGTGGGAATAATGAAACGGTACTTAAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGCGTTGTCTTCTCCTGCTCAAAACCTGCTTGCACCCTTATTACTTTGCCATGAATTG / / / / / / // // | Ksp632I* MboII | MaeII | || |MseI MnlI TaiI | || TspDTI SetI | |Csp6I | RsaI Tsp4CI* Y R N R R G R V L D E R G N N E T V L N I A T E E D E F W T N V G I M K R Y L T S Q Q K R T S F G R T W E * * N G T * Q ----:----|----:----|----:----|----:----|----:----|----:----| * R L L L P R T K S S R P F L S V T S L K D C C F L V L K P R V H S Y H F P V * I A V S S S S N Q V F T P I I F R Y K V BdaI BdaI | MboII | CviRI* AsuI* | | BseGI DraII AciI | | EcoT22I Bsp120I BisI | | | FokI |AsuI* |BlsI | | | | XmnI |BmgT120I AclI ||TauI | | | | | BbvII* ||CviJI MaeII ||| DdeI | | | | | | MboII ||NlaIV | SetI ||| SauI* | | | | | | |Csp6I ||HaeIII | TaiI ||| | SfaNI | | | | | | ||RsaI ||BmgT120I \ \ \\\ \ \ \ \ \ \ \ \ \\\ \\\ AACGTTGTGCCGCCTAAGGAAGATTTGGATGCATTATTGAAGACATTCAGGGTACAAGGG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCAACACGGCGGATTCCTTCTAAACCTACGTAATAACTTCTGTAAGTCCCATGTTCCC / / //// / / / /// // / // /// | | |||AciI | | | ||CviRI* |FokI | || ||BmgT120I | | ||BisI | | | ||BseGI XmnI | || ||HaeIII | | |BlsI | | | |MboII | || ||NlaIV | | TauI | | | EcoT22I | || ||CviJI | MaeII | | BdaI | || |BdaI | AclI | | BdaI | || |BdaI TaiI | SfaNI | || HgiJII* SetI SauI* | || BseSI DdeI | || SduI | || ApaI | |Csp6I | RsaI BbvII* MboII N V V P P K E D L D A L L K T F R V Q G T L C R L R K I W M H Y * R H S G Y K G R C A A * G R F G C I I E D I Q G T R A ----:----|----:----|----:----|----:----|----:----|----:----| L T T G G L S S K S A N N F V N L T C P C R Q A A * P L N P H M I S S M * P V L V N H R R L F I Q I C * Q L C E P Y L P CviJI |MaeI |BseGI || FalI BdaI MboII || FalI BdaI | AluI || | MwoI |ApaI | CviJI || | |Hin6I |SduI | | SetI || | ||GlaI |BseSI | | |TsoI || | ||FokI |HgiJII* | | || BccI || | ||MstI* || CviJI FalI | | || |MboII || | ||FspAI || HaeIII FalI | | || || SfaNI || | |||HhaI \\ \ \ \ \ \\ \\ \ \\ \ \\\\ CCCGTTGGCCTTGAAGAAAATGAGAAGAAGCTCTTATTAGGATGGCTAGATGCGCATAGA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GGGCAACCGGAACTTCTTTTACTCTTCTTCGAGAATAATCCTACCGATCTACGCGTATCT // / / / / // // /// / /// / || | FalI | | || |BccI ||| | ||| FokI || | FalI | | || MboII ||| | ||Hin6I || HaeIII | | |TsoI ||| | |FspAI || CviJI | | CviJI ||| | |MstI* |Bsp120I | | AluI ||| | |GlaI |AsuI* | SetI ||| | HhaI BmgT120I MboII ||| MwoI DraII ||| MaeI AsuI* ||CviJI |BseGI SfaNI FalI FalI P V G L E E N E K K L L L G W L D A H R P L A L K K M R R S S Y * D G * M R I E R W P * R K * E E A L I R M A R C A * K ----:----|----:----|----:----|----:----|----:----|----:----| G T P R S S F S F F S K N P H S S A C L A R Q G Q L F H S S A R I L I A L H A Y G N A K F F I L L L E * * S P * I R M S XmnI MaeII | SetI | TaiI | BbvII* | | MboII | | | MboII | | | | TfiI | | | | HinfI | | | | | Eco57I | | | | | Eco57MI CviJI | | | | | | Ksp632I* \ \ \ \ \ \ \ \ AAAATGGAAAAAGGCTCTATGACTGAAGAAGACGTTCAACTGATTCAAAGTTTGGAAGAG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTACCTTTTTCCGAGATACTGACTTCTTCTGCAAGTTGACTAAGTTTCAAACCTTCTC / // / / / / / / CviJI || | | | | HinfI Ksp632I* || | | | | TfiI || | | | Eco57MI || | | | Eco57I || | | BbvII* || | | MboII || | MboII || MaeII |XmnI TaiI SetI K M E K G S M T E E D V Q L I Q S L E E K W K K A L * L K K T F N * F K V W K S N G K R L Y D * R R R S T D S K F G R V ----:----|----:----|----:----|----:----|----:----|----:----| F I S F P E I V S S S T * S I * L K S S F F P F L S * S Q L L R E V S E F N P L F H F F A R H S F F V N L Q N L T Q F L BssKI EcoRII |SecI* MboII ||ScrFI | MnlI TspDTI BslFI ||BseBI \ \ \ \ \\\ TGGGAAATGAATGATATAGAGGGACAACATACTCATTATGATTTATTGCCAGGGGGAGAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCTTTACTTACTATATCTCCCTGTTGTATGAGTAATACTAAATAACGGTCCCCCTCTA / / / / / / | MnlI TspDTI BslFI | EcoRII MboII | BssKI | SecI* BseBI ScrFI W E M N D I E G Q H T H Y D L L P G G D G K * M I * R D N I L I M I Y C Q G E M G N E * Y R G T T Y S L * F I A R G R * ----:----|----:----|----:----|----:----|----:----|----:----| H S I F S I S P C C V * * S K N G P P S T P F S H Y L P V V Y E N H N I A L P L P F H I I Y L S L M S M I I * Q W P S I MboI | DpnI | |BstKTI | ||Hpy178III* Hin4II* CviJI MmeI | ||| SfaNI | BseGI FokI | TspDTI \ \ \\\ \ \ \ \ \ \ GAGTTTGGCGTAGATCAAGATGAGTTGGATGCTATGAAGGAAATGGGCTTTTAG 910 920 930 940 950 ----:----|----:----|----:----|----:----|----:----|---- CTCAAACCGCATCTAGTTCTACTCAACCTACGATACTTCCTTTACCCGAAAATC / // / / / / / / / MmeI || | | SfaNI | BseGI | TspDTI || | Hpy178III* Hin4II* | CviJI || MboI FokI |DpnI BstKTI E F G V D Q D E L D A M K E M G F * S L A * I K M S W M L * R K W A F X V W R R S R * V G C Y E G N G L L X ----:----|----:----|----:----|----:----|----:----|---- S N P T S * S S N S A I F S I P K * H T Q R L D L H T P H * S P F P S K L K A Y I L I L Q I S H L F H A K L # Enzymes that cut Frequency Isoschizomers AciI 5 BspACI,SsiI AclI 1 Psp1406I AflIII 1 AluI 3 AluBI ApaI 1 ApoI 2 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I BamHI 1 BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 1 BpuEI BcgI 1 BciVI 1 BfuI BdaI 2 BfiI 1 BmrI,BmuI BglII 1 BinI* 5 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 2 BplI 2 BsaBI 1 Bse8I,BseJI BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 1 BseSI 2 BaeGI,BstSLI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI Bsp120I 1 PspOMI BspCNI 1 BspLU11I* 1 PscI,PciI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 6 Csp6I 3 CviQI,RsaNI CviAII 3 CviJI 13 CviKI-1 CviRI* 2 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 6 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI Eco57I 1 AcuI Eco57MI 1 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 2 FatI 3 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 FspAI 1 GlaI 2 HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 2 HpyAV Hin6I 2 HinP1I,HspAI HinfI 3 HphI 2 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 1 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 12 MlyI 2 SchI MmeI 2 MnlI 5 MseI 3 Tru1I,Tru9I MstI* 2 AviII,FspI,NsbI,Acc16I MwoI 2 HpyF10VI,BstMWI NdeI 2 FauNDI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 1 BstNSI,XceI PleI 2 PpsI RsaI 3 AfaI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 12 SfaNI 3 LweI SmlI 1 SmoI SspI 1 StuI 2 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 2 TauI 1 TfiI 1 PfeI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 5 TasI,Tsp509I,Sse9I TspRI 1 TscAI XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BalI BarI BbvCI BbvI BceAI BclI BetI* BglI BmeT110I BmtI Bpu10I BsaAI BsaXI BsePI BseRI BseYI BsgI BsiI* BsmI Bsp1407I BspHI BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EgeI EheI Esp3I EspI* FauI FseI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HindII HindIII HpaI HpaII Hpy99I KasI KpnI MauBI McrI* MfeI MluI MroNI MslI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspXI PsrI PstI PvuI PvuII RsrII SacI SalI SanDI SapI ScaI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TaqII TatI TseI TspGWI TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769