Restriction Map of MSN2/YMR037C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

MSN2/YMR037C on chromosome XIII from coordinates 346517 to 344403.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 Tsp4CI* |SalI ||TaqI ||AccI ||McrI* |||HindII |||Hpy166II |||| FatI FatI |||| |CviAII |CviAII |||| || NlaIII MboII || NlaIII \\\\ \\ \ \ \\ \ ATGACGGTCGACCATGATTTCAATAGCGAAGATATTTTATTCCCCATAGAAAGCATGAGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGCCAGCTGGTACTAAAGTTATCGCTTCTATAAAATAAGGGGTATCTTTCGTACTCA // //// // / / // || |||| |FatI MboII | |FatI || |||| CviAII | CviAII || |||NlaIII NlaIII || ||SalI || |AccI || |TaqI || Hpy166II || HindII |McrI* Tsp4CI* M T V D H D F N S E D I L F P I E S M S * R S T M I S I A K I F Y S P * K A * V D G R P * F Q * R R Y F I P H R K H E * ----:----|----:----|----:----|----:----|----:----|----:----| X V T S W S K L L S S I K N G M S L M L X S P R G H N * Y R L Y K I G W L F C S H R D V M I E I A F I N * E G Y F A H T AccI |BssNAI |Hpy166II || MaeII || |BsaAI || || SetI SspI || || TaiI | MseI \\ \\ \ \ \ AGTATACAATACGTGGAGAATAATAACCCAAATAATATTAACAACGATGTTATCCCGTAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TCATATGTTATGCACCTCTTATTATTGGGTTTATTATAATTGTTGCTACAATAGGGCATA // / // / / |AccI | |MaeII | MseI | | BsaAI SspI | TaiI | SetI Hpy166II BssNAI S I Q Y V E N N N P N N I N N D V I P Y V Y N T W R I I T Q I I L T T M L S R I Y T I R G E * * P K * Y * Q R C Y P V F ----:----|----:----|----:----|----:----|----:----|----:----| L I C Y T S F L L G F L I L L S T I G Y Y Y V I R P S Y Y G L Y Y * C R H * G T T Y L V H L I I V W I I N V V I N D R I AciI | MboI XbaI | XhoII |MaeI Tsp4CI* | | DpnI |Hpy178III* | DdeI | | |BstKTI || EcoRV | TspRI | | || BinI* Hpy178III* \\ \ \ \ \ \ \\ \ \ TCTCTAGATATCAAAAACACTGTCTTAGATAGTGCGGATCTCAATGACATTCAAAATCAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGATCTATAGTTTTTGTGACAGAATCTATCACGCCTAGAGTTACTGTAAGTTTTAGTT // / / / / /// / / / || EcoRV | | DdeI ||| | BinI* Hpy178III* |XbaI | Tsp4CI* ||| XhoII | TspRI ||| MboI Hpy178III* ||DpnI MaeI |BstKTI AciI S L D I K N T V L D S A D L N D I Q N Q L * I S K T L S * I V R I S M T F K I K S R Y Q K H C L R * C G S Q * H S K S R ----:----|----:----|----:----|----:----|----:----|----:----| E R S I L F V T K S L A S R L S M * F * N E L Y * F C Q R L Y H P D * H C E F D R * I D F V S D * I T R I E I V N L I L MlyI PleI ApoI |MnlI TspRI TspEI || TaqI |MaeIII | TspRI CviJI || | HinfI BtsI || FokI \ \ \ \\ \ \ \ \\ \ GAAACTTCACTGAATTTGGGGCTTCCTCCACTATCTTTCGACTCTCCACTGCCCGTAACG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGAAGTGACTTAAACCCCGAAGGAGGTGATAGAAAGCTGAGAGGTGACGGGCATTGC / / / // / // / TspRI | CviJI |PleI | |TspRI MaeIII TspEI MnlI | |BtsI ApoI MlyI | HinfI TaqI E T S L N L G L P P L S F D S P L P V T K L H * I W G F L H Y L S T L H C P * R N F T E F G A S S T I F R L S T A R N G ----:----|----:----|----:----|----:----|----:----|----:----| S V E S F K P S G G S D K S E G S G T V L F K V S N P A E E V I K R S E V A R L F S * Q I Q P K R W * R E V R W Q G Y R AluI CviJI BseGI | SetI AluI | TspGWI | Cac8I CviJI | | BccI | | CviRI* | SetI SfaNI \ \ \ \ \ \ \ \ \ GAAACGATACCATCCACTACCGATAACAGCTTGCATTTGAAAGCTGATAGCAACAAAAAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGCTATGGTAGGTGATGGCTATTGTCGAACGTAAACTTTCGACTATCGTTGTTTTTA / / / / / / / / / / / FokI | TspGWI BccI | | | CviRI* | CviJI SfaNI BseGI | | Cac8I | AluI | CviJI SetI | AluI SetI E T I P S T T D N S L H L K A D S N K N K R Y H P L P I T A C I * K L I A T K I N D T I H Y R * Q L A F E S * * Q Q K S ----:----|----:----|----:----|----:----|----:----|----:----| S V I G D V V S L L K C K F A S L L L F P F S V M W * R Y C S A N S L Q Y C C F F R Y W G S G I V A Q M Q F S I A V F I Hpy178III* TatI |NruI |Csp6I |FnuDII* TspEI ||RsaI || CviRI* BtgZI | MseI ||ScaI MaeI CviJI \\ \ \ \ \ \\\ \ \ CGCGATGCAAGAACTATTGAAAATGATAGTGAAATTAAGAGTACTAATAATGCTAGTGGC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GCGCTACGTTCTTGATAACTTTTACTATCACTTTAATTCTCATGATTATTACGATCACCG // / / // /// / / || CviRI* BtgZI |MseI ||TatI | CviJI |Hpy178III* TspEI |Csp6I MaeI FnuDII* ScaI NruI RsaI R D A R T I E N D S E I K S T N N A S G A M Q E L L K M I V K L R V L I M L V A R C K N Y * K * * * N * E Y * * C * W L ----:----|----:----|----:----|----:----|----:----|----:----| R S A L V I S F S L S I L L V L L A L P D R H L F * Q F H Y H F * S Y * Y H * H A I C S S N F I I T F N L T S I I S T A TatI Bsp1407I |Csp6I ||RsaI HphI SetI ||TspDTI \ \ \\\ TCTGGGGCAAATCAATACACAACTCTTACTTCACCTTATCCTATGAACGACATTTTGTAC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGACCCCGTTTAGTTATGTGTTGAGAATGAAGTGGAATAGGATACTTGCTGTAAAACATG / / / /// HphI SetI | ||Bsp1407I | ||TspGWI | ||TatI | |Csp6I | RsaI TspDTI S G A N Q Y T T L T S P Y P M N D I L Y L G Q I N T Q L L L H L I L * T T F C T W G K S I H N S Y F T L S Y E R H F V Q ----:----|----:----|----:----|----:----|----:----|----:----| E P A F * Y V V R V E G * G I F S M K Y S Q P L D I C L E * K V K D * S R C K T R P C I L V C S K S * R I R H V V N Q V Acc65I HphI HgiCI* MaeIII |Csp6I | TspDTI ||RsaI | |HphI ||NlaIV | || TspDTI ||Hin4II* FatI | || | MaeIII ||| KpnI TspGWI | || | Tsp45I ||| | SetI |CviAII | || | Tsp4CI* ||| | Hin4I MnlI || NlaIII | || | | SetI ||| | Hin4I Hpy188I \\ \ \ \\ \ \ \ \\\ \ \ \ AACATGAACAATCCGTTACAATCACCGTCACCTTCATCGGTACCTCAAAATCCGACTATA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTACTTGTTAGGCAATGTTAGTGGCAGTGGAAGTAGCCATGGAGTTTTAGGCTGATAT / // / / / / / / / ///// / | |FatI | | | | | | Tsp45I ||||HgiCI* Hpy188I | CviAII | | | | | | MaeIII ||||Acc65I MnlI NlaIII | | | | | SetI |||Csp6I | | | | Tsp4CI* ||NlaIV | | | TspDTI ||RsaI | | MaeIII ||SetI | | HphI |Hin4II* | TspDTI |Hin4I HphI |Hin4I KpnI N M N N P L Q S P S P S S V P Q N P T I T * T I R Y N H R H L H R Y L K I R L * H E Q S V T I T V T F I G T S K S D Y K ----:----|----:----|----:----|----:----|----:----|----:----| L M F L G N C D G D G E D T G * F G V I C C S C D T V I V T V K M P V E F D S * V H V I R * L * R * R * R Y R L I R S Y MnlI | MmeI | |Hin4I | |Hin4I | || MaeIII TspEI MnlI \ \\ \ \ \ AATCCTCCCATAAATACAGCAAGTAACGAAACTAATTTATCGCCTCAAACTTCAAATGGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGGAGGGTATTTATGTCGTTCATTGCTTTGATTAAATAGCGGAGTTTGAAGTTTACCA /// / / / ||MmeI MaeIII TspEI MnlI |MnlI Hin4I Hin4I N P P I N T A S N E T N L S P Q T S N G I L P * I Q Q V T K L I Y R L K L Q M V S S H K Y S K * R N * F I A S N F K W * ----:----|----:----|----:----|----:----|----:----|----:----| F G G M F V A L L S V L K D G * V E F P L D E W L Y L L Y R F * N I A E F K L H I R G Y I C C T V F S I * R R L S * I T TspDTI | AvaI | XhoI | SmlI | PspXI | |TaqI | |BmeT110I | || CviJI MaeII | || | SduI | SetI | || | HgiJII* | TaiI BseRI | || | | MnlI | | MseI \ \ \\ \ \ \ \ \ \ AATGAAACTCTTATATCTCCTCGAGCCCAACAACATACGTCCATTAAAGATAATCGTCTG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTTGAGAATATAGAGGAGCTCGGGTTGTTGTATGCAGGTAATTTCTATTAGCAGAC / / /// / / / / BseRI TspDTI ||| MnlI | MaeII MseI ||CviJI TaiI |PspXI SetI |SmlI |XhoI |AvaI BmeT110I HgiJII* TaqI SduI N E T L I S P R A Q Q H T S I K D N R L M K L L Y L L E P N N I R P L K I I V C * N S Y I S S S P T T Y V H * R * S S V ----:----|----:----|----:----|----:----|----:----|----:----| L S V R I D G R A W C C V D M L S L R R Y H F E * I E E L G V V Y T W * L Y D D I F S K Y R R S G L L M R G N F I I T Q TspEI | TspDTI | |TaqI | |AsuII | || TfiI | || HinfI SetI | || | XmnI TspEI \ \ \\ \ \ \ TCCTTACCTAATGGTGCTAATTCGAATCTTTTCATTGACACTAACCCAAACAATTTGAAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAATGGATTACCACGATTAAGCTTAGAAAAGTAACTGTGATTGGGTTTGTTAAACTTG / / / / // / SetI | | | |XmnI TspEI | | | HinfI | | | TfiI | | AsuII | | TaqI | TspEI TspDTI S L P N G A N S N L F I D T N P N N L N P Y L M V L I R I F S L T L T Q T I * T L T * W C * F E S F H * H * P K Q F E R ----:----|----:----|----:----|----:----|----:----|----:----| D K G L P A L E F R K M S V L G F L K F T R V * H H * N S D K * Q C * G L C N S G * R I T S I R I K E N V S V W V I Q V DdeI | TspDTI | |Hpy188I | || ApoI | || TspEI MfeI | || | BspCNI DdeI TspEI | || | |BseMII TspEI \ \ \ \\ \ \\ \ GAAAAACTAAGAAATCAATTGAACTCAGATACAAATTCATATTCTAACTCCATTTCTAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTGATTCTTTAGTTAACTTGAGTCTATGTTTAAGTATAAGATTGAGGTAAAGATTA / / / // /// DdeI | | |DdeI ||TspEI | | Hpy188I ||ApoI | TspDTI |BseMII TspEI BspCNI MfeI E K L R N Q L N S D T N S Y S N S I S N K N * E I N * T Q I Q I H I L T P F L I K T K K S I E L R Y K F I F * L H F * F ----:----|----:----|----:----|----:----|----:----|----:----| S F S L F * N F E S V F E Y E L E M E L R F V L F D I S S L Y L N M N * S W K * F F * S I L Q V * I C I * I R V G N R I TspEI | MseI | |SwaI MseI | |AhaIII* |TspEI MlyI | ||ApoI ||AloI PleI | ||TspEI ||PpiI |TspRI TspEI | ||| BsrI ||BsaXI || HinfI \ \ \\\ \ \\\ \\ \ TCAAACTCCAATTCTACGGGTAATTTAAATTCCAGTTATTTTAATTCACTGAACATAGAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTTGAGGTTAAGATGCCCATTAAATTTAAGGTCAATAAAATTAAGTGACTTGTATCTG / / /// // / / // / // TspEI TspEI ||| |TspEI | | || TspEI |PleI ||| |ApoI | | |TspRI MlyI ||| BsrI | | MseI ||MseI | BsaXI |AhaIII* PpiI |SwaI AloI TspEI S N S N S T G N L N S S Y F N S L N I D Q T P I L R V I * I P V I L I H * T * T K L Q F Y G * F K F Q L F * F T E H R L ----:----|----:----|----:----|----:----|----:----|----:----| E F E L E V P L K F E L * K L E S F M S N L S W N * P Y N L N W N N * N V S C L * V G I R R T I * I G T I K I * Q V Y V BsaXI | AloI | PpiI | | MaeII | | | SetI | | | TaiI FatI | | | | MaeI |CviAII | | | | | MboI || NlaIII | | | | | | DpnI || |MaeI | | | | | | |BstKTI TspEI \\ \\ \ \ \ \ \ \ \\ \ TCCATGCTAGATGATTACGTTTCTAGTGATCTCTTATTGAATGATGATGATGATGACACT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTACGATCTACTAATGCAAAGATCACTAGAGAATAACTTACTACTACTACTACTGTGA // // // / / / // / || || |BsaXI | MaeII | || MboI || || |PpiI TaiI | |DpnI || || |AloI SetI | BstKTI || || MaeI MaeI || |FatI || CviAII |NlaIII HinfI S M L D D Y V S S D L L L N D D D D D T P C * M I T F L V I S Y * M M M M M T L H A R * L R F * * S L I E * * * * * H * ----:----|----:----|----:----|----:----|----:----|----:----| E M S S S * T E L S R K N F S S S S S V S W A L H N R K * H D R I S H H H H H C G H * I I V N R T I E * Q I I I I I V S MaeII MboII | Hpy99I | |SetI | |TaiI | || PsiI MnlI | || | TspGWI |ApoI | || | | TspEI |TspEI \ \\ \ \ \ \\ AATTTATCACGCCGAAGATTTAGCGACGTTATAACAAACCAATTTCCGTCAATGACAAAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAATAGTGCGGCTTCTAAATCGCTGCAATATTGTTTGGTTAAAGGCAGTTACTGTTTA / / / / / / / / TspEI | | | | TspGWI TspEI MnlI | | | PsiI | | MaeII | MboII | TaiI | SetI Hpy99I N L S R R R F S D V I T N Q F P S M T N I Y H A E D L A T L * Q T N F R Q * Q I F I T P K I * R R Y N K P I S V N D K F ----:----|----:----|----:----|----:----|----:----|----:----| L K D R R L N L S T I V F W N G D I V F * N I V G F I * R R * L L G I E T L S L I * * A S S K A V N Y C V L K R * H C I NlaIV | BseGI FokI | | Hpy188I |AsuI* | | | BccI ApoI |AvaII | | | TspEI TspEI ||BmgT120I | | | | MseI TaqI EcoRI ||| SetI | | | | VspI \ \ \\\ \ \ \ \ \ \ TCGAGGAATTCTATTTCTCACTCTTTGGACCTTTGGAACCATCCGAAAATTAATCCAAGC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTCCTTAAGATAAAGAGTGAGAAACCTGGAAACCTTGGTAGGCTTTTAATTAGGTTCG / / / /// / / / // | TaqI EcoRI ||AvaII NlaIV | | |VspI TspEI TspEI ||AsuI* BseGI | | |MseI ApoI ApoI ||FokI | | TspEI |BmgT120I | BccI SetI Hpy188I S R N S I S H S L D L W N H P K I N P S R G I L F L T L W T F G T I R K L I Q A E E F Y F S L F G P L E P S E N * S K Q ----:----|----:----|----:----|----:----|----:----|----:----| E L F E I E * E K S R Q F W G F I L G L N S S N * K E S K P G K S G D S F * D L R P I R N R V R Q V K P V M R F N I W A Bce83I* SmlI MnlI | TspEI |SetI | CviRI* Hpy188I \ \ \\ \ \ \ AATAGAAATACAAATCTCAATATCACTACTAATTCTACCTCAAGTTCCAATGCAAGTCCG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCTTTATGTTTAGAGTTATAGTGATGATTAAGATGGAGTTCAAGGTTACGTTCAGGC / / / / / / / Bce83I* | SetI | MnlI | Hpy188I TspEI SmlI CviRI* N R N T N L N I T T N S T S S S N A S P I E I Q I S I S L L I L P Q V P M Q V R * K Y K S Q Y H Y * F Y L K F Q C K S E ----:----|----:----|----:----|----:----|----:----|----:----| L L F V F R L I V V L E V E L E L A L G C Y F Y L D * Y * * * N * R L N W H L D I S I C I E I D S S I R G * T G I C T R MlyI PleI | CviRI* | | HinfI MslI | | TspDTI SspI Cac8I \ \ \ \ \ \ AATACCACTACTATGAACGCAAATGCAGACTCAAATATTGCTGGCAACCCGAAAAACAAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGGTGATGATACTTGCGTTTACGTCTGAGTTTATAACGACCGTTGGGCTTTTTGTTA / // // / / / MslI || || | SspI Cac8I || || HinfI || |TspDTI || CviRI* |PleI MlyI N T T T M N A N A D S N I A G N P K N N I P L L * T Q M Q T Q I L L A T R K T M Y H Y Y E R K C R L K Y C W Q P E K Q * ----:----|----:----|----:----|----:----|----:----|----:----| F V V V I F A F A S E F I A P L G F F L S Y W * * S R L H L S L Y Q Q C G S F C I G S S H V C I C V * I N S A V R F V I HindII Hpy166II | TfiI | HinfI HgaI | | MseI FokI \ \ \ \ \ GACGCTACCATAGACAATGAGTTGACACAGATTCTTAACGAATATAATATGAACTTCAAC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCGATGGTATCTGTTACTCAACTGTGTCTAAGAATTGCTTATATTATACTTGAAGTTG / / / / HgaI Hpy166II | MseI HindII HinfI TfiI D A T I D N E L T Q I L N E Y N M N F N T L P * T M S * H R F L T N I I * T S T R Y H R Q * V D T D S * R I * Y E L Q R ----:----|----:----|----:----|----:----|----:----|----:----| S A V M S L S N V C I R L S Y L I F K L H R * W L C H T S V S E * R I Y Y S S * V S G Y V I L Q C L N K V F I I H V E V SduI TspEI BseGI |TspDTI BseSI Cac8I SfaNI \\ \ \ \ GATAATTTGGGCACATCCACTTCTGGCAAGAACAAATCTGCTTGCCCAAGTTCTTTTGAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTAAACCCGTGTAGGTGAAGACCGTTCTTGTTTAGACGAACGGGTTCAAGAAAACTA / / / / / / / | | | | BseGI Cac8I SfaNI | | | BseSI | | | SduI | | TspEI | FokI TspDTI D N L G T S T S G K N K S A C P S S F D I I W A H P L L A R T N L L A Q V L L M * F G H I H F W Q E Q I C L P K F F * C ----:----|----:----|----:----|----:----|----:----|----:----| S L K P V D V E P L F L D A Q G L E K S R Y N P C M W K Q C S C I Q K G L N K Q I I Q A C G S R A L V F R S A W T R K I AluI TspEI CviJI | MwoI | SetI \ \ \ \ GCCAATGCTATGACAAAGATAAATCCAAGTCAGCAATTACAGCAACAGCTAAACCGAGTT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTACGATACTGTTTCTATTTAGGTTCAGTCGTTAATGTCGTTGTCGATTTGGCTCAA / / / / | TspEI | CviJI MwoI | AluI SetI A N A M T K I N P S Q Q L Q Q Q L N R V P M L * Q R * I Q V S N Y S N S * T E F Q C Y D K D K S K S A I T A T A K P S S ----:----|----:----|----:----|----:----|----:----|----:----| A L A I V F I F G L * C N C C C S F R T H W H * S L S L D L D A I V A V A L G L G I S H C L Y I W T L L * L L L * V S N HphI | TseI | |BisI MslI | ||BlsI SetI |FatI | |||AluI |MaeIII Tsp4CI* ||CviAII | |||CviJI |Tsp45I | BdaI ||| NlaIII | |||| SetI ||BbvI MnlI | BdaI ||| | XmnI \ \\\\ \ \\\ \ \ \ \\\ \ \ CAACACAAGCAGCTCACCTCGTCACATAATAACAGTAGCACTAACATGAAATCCTTCAAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTGTTCGTCGAGTGGAGCAGTGTATTATTGTCATCGTGATTGTACTTTAGGAAGTTG / /// / // // // // / / HphI ||| SetI |MnlI |BdaI || || XmnI TspDTI ||CviJI Tsp45I |BdaI || |FatI ||TseI MaeIII Tsp4CI* || CviAII ||AluI BbvI |NlaIII |BisI MslI BlsI SetI Q H K Q L T S S H N N S S T N M K S F N N T S S S P R H I I T V A L T * N P S T T Q A A H L V T * * Q * H * H E I L Q Q ----:----|----:----|----:----|----:----|----:----|----:----| * C L C S V E D C L L L L V L M F D K L E V C A A * R T V Y Y C Y C * C S I R * L V L L E G R * M I V T A S V H F G E V TspDTI | MboI | Hin4II* | | DpnI | | |BstKTI | | || BdaI TaqI | | || BdaI ClaI | | || |Hin4II* | FalI DdeI | | || || Hpy178III* AluI | FalI | TsoI | | || || |FalI CviJI | | TfiI | |AluI | | || || |FalI | SetI | | HinfI | |CviJI \ \ \\ \\ \\ \ \ \ \ \ \ \\ AGCGATCTTTATTCAAGAAGGCAAAGAGCTTCTTTACCCATAATCGATGATTCACTAAGC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCTAGAAATAAGTTCTTCCGTTTCTCGAAGAAATGGGTATTAGCTACTAAGTGATTCG / // // / / / / / / / //// | || || | | | CviJI | ClaI | |||CviJI | || || | | | AluI | TaqI | |||AluI | || || | | SetI FalI | ||DdeI | || || | Hpy178III* FalI | |SetI | || || Hin4II* | TsoI | || || FalI HinfI | || || FalI TfiI | || |BdaI | || |BdaI | || MboI | |DpnI | BstKTI Hin4II* S D L Y S R R Q R A S L P I I D D S L S A I F I Q E G K E L L Y P * S M I H * A R S L F K K A K S F F T H N R * F T K L ----:----|----:----|----:----|----:----|----:----|----:----| L S R * E L L C L A E K G M I S S E S L C R D K N L F A F L K K V W L R H N V L A I K I * S P L S S R * G Y D I I * * A TseI |BisI ||BlsI SetI ||| ApoI | BssKI ||| TspEI | SexAI BseGI ||| EcoRI | EcoRII | BbvI ||| | BplI | | ScrFI | BbvII* ||| | BplI | | BseBI | | FokI ||| | | TspDTI | | |SetI | | | MboII ||| | | |ApoI | | || MseI | | | |TspDTI ||| | | |TspEI \ \ \\ \ \ \ \ \\ \\\ \ \ \\ TACGACCTGGTTAATAAGCAGGATGAAGACCCCAAGAACGATATGCTGCCGAATTCAAAT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTGGACCAATTATTCGTCCTACTTCTGGGGTTCTTGCTATACGACGGCTTAAGTTTA / / / / / / / //// // | | | MseI BseGI | FokI |||BplI |EcoRI | | EcoRII TspDTI |||BplI |TspEI | | SexAI BbvII* ||TseI |ApoI | | BssKI MboII |BisI TspDTI | BseBI BbvI BlsI | ScrFI SetI Y D L V N K Q D E D P K N D M L P N S N T T W L I S R M K T P R T I C C R I Q I R P G * * A G * R P Q E R Y A A E F K F ----:----|----:----|----:----|----:----|----:----|----:----| * S R T L L C S S S G L F S I S G F E F S R G P * Y A P H L G W S R Y A A S N L V V Q N I L L I F V G L V I H Q R I * I BplI BplI | Tsp4CI* | | TfiI | | HinfI | | |Hin4I | | |Hin4I | | || HgaI | | || | TspGWI | | || | Hpy188I TspEI | | || | | Eam1105I \ \ \ \\ \ \ \ TTGAGTTCATCTCAACAATTTATCAAACCGTCTATGATTCTTTCAGACAATGCGTCCGTT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCAAGTAGAGTTGTTAAATAGTTTGGCAGATACTAAGAAAGTCTGTTACGCAGGCAA / // / / / // / / TspEI |BplI | Hin4I | || | Eam1105I ApoI |BplI | Hin4I | || HgaI TspEI Tsp4CI* | |Hpy188I | TspGWI HinfI TfiI L S S S Q Q F I K P S M I L S D N A S V * V H L N N L S N R L * F F Q T M R P L E F I S T I Y Q T V Y D S F R Q C V R Y ----:----|----:----|----:----|----:----|----:----|----:----| K L E D * C N I L G D I I R E S L A D T N S N M E V I * * V T * S E K L C H T R Q T * R L L K D F R R H N K * V I R G N Hin4I MnlI Hin4I CviJI Bce83I* |MwoI SfeI* |SmlI | Hin4II* SetI \\ \ \\ \ \ \ ATTGCGAAAGTGGCGACTACAGGCTTGAGTAATGATATGCCATTTTTGACAGAGGAAGGT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGCTTTCACCGCTGATGTCCGAACTCATTACTATACGGTAAAAACTGTCTCCTTCCA / / / / / // / / | MwoI | | SmlI || Hin4II* SetI Hin4I | CviJI |MnlI Hin4I SfeI* Bce83I* I A K V A T T G L S N D M P F L T E E G L R K W R L Q A * V M I C H F * Q R K V C E S G D Y R L E * * Y A I F D R G R * ----:----|----:----|----:----|----:----|----:----|----:----| I A F T A V V P K L L S I G N K V S S P * Q S L P S * L S S Y H Y A M K S L P L N R F H R S C A Q T I I H W K Q C L F T ApoI TspEI | TaqI | |MboI HphI | || DpnI MslI CviJI Hpy166II | TspEI | || |BstKTI BccI |NlaIV \ \ \ \ \\ \\ \ \\ GAACAAAATGCTAATTCTACTCCAAATTTCGATCTTTCCATCACTCAAATGAATATGGCT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTTTTACGATTAAGATGAGGTTTAAAGCTAGAAAGGTAGTGAGTTTACTTATACCGA / / / / // / // // | HphI TspEI | || MboI |BccI |NlaIV Hpy166II | |DpnI MslI CviJI | BstKTI | TaqI TspEI ApoI E Q N A N S T P N F D L S I T Q M N M A N K M L I L L Q I S I F P S L K * I W L T K C * F Y S K F R S F H H S N E Y G S ----:----|----:----|----:----|----:----|----:----|----:----| S C F A L E V G F K S R E M V * I F I A H V F H * N * E L N R D K W * E F S Y P F L I S I R S W I E I K G D S L H I H S MaeII |BtrI || SetI Cac8I || TaiI | CviRI* || | MnlI | | CspCI || | | BsmAI TspDTI | | | BseGI || | | Esp3I HphI | FokI | | | | SfaNI || | | | CviRI* | CspCI \ \ \ \ \ \ \ \\ \ \ \ \ \ \ CCATTATCGCCTGCATCATCATCCTCCACGTCTCTTGCAACAAATCATTTCTATCACCAT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAATAGCGGACGTAGTAGTAGGAGGTGCAGAGAACGTTGTTTAGTAAAGATAGTGGTA / // / / // // / / / / / TspDTI || | BseGI || || MnlI | Esp3I | CspCI || CviRI* || |MaeII | BsmAI HphI || CspCI || BtrI CviRI* |Cac8I |TaiI FokI |SetI SfaNI P L S P A S S S S T S L A T N H F Y H H H Y R L H H H P P R L L Q Q I I S I T I I I A C I I I L H V S C N K S F L S P F ----:----|----:----|----:----|----:----|----:----|----:----| G N D G A D D D E V D R A V F * K * * W E M I A Q M M M R W T E Q L L D N R D G W * R R C * * G G R R K C C I M E I V M HphI | BsiYI* | |BsiYI* BsiYI* | || MaeIII FatI MboII Hpy188I | || Tsp45I |CviAII | EcoP15I | AciI | || BstEII || NlaIII | | TspDTI MnlI | |Hin4II* \ \\ \ \\ \ \ \ \ \ \ \\ TTCCCACAGCAGGGTCACCATACCATGAACTCTAAAATCGGTTCTTCCCTTCGGAGGCGG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGGTGTCGTCCCAGTGGTATGGTACTTGAGATTTTAGCCAAGAAGGGAAGCCTCCGCC // / / // / // / / / / / |BsiYI* | | |FatI | || | | | | AciI BsiYI* | | CviAII | || | | | Hin4II* HphI | NlaIII | || | | Hpy188I BstEII | || | BsiYI* Tsp45I | || MnlI MaeIII | |EcoP15I | TspDTI MboII F P Q Q G H H T M N S K I G S S L R R R S H S R V T I P * T L K S V L P F G G G P T A G S P Y H E L * N R F F P S E A E ----:----|----:----|----:----|----:----|----:----|----:----| K G C C P * W V M F E L I P E E R R L R N G V A P D G Y W S S * F R N K G E S A E W L L T V M G H V R F D T R G K P P P BsiYI* | Csp6I | |RsaI | || HgiCI* | || Tsp4CI* | || | NlaIV | || | | AciI | || | | BisI BccI | || | | |BlsI EciI | || | | ||TauI \ \ \\ \ \ \\\ AAGTCTGCTGTGCCTTTGATGGGTACGGTGCCGCTTACAAATCAACAAAATAATATAAGC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGACGACACGGAAACTACCCATGCCACGGCGAATGTTTAGTTGTTTTATTATATTCG / / / /// ///// | | BsiYI* ||| ||||AciI | BccI ||| |||BisI EciI ||| ||HgiCI* ||| ||BlsI ||| |TauI ||| NlaIV ||Tsp4CI* |Csp6I RsaI K S A V P L M G T V P L T N Q Q N N I S S L L C L * W V R C R L Q I N K I I * A V C C A F D G Y G A A Y K S T K * Y K Q ----:----|----:----|----:----|----:----|----:----|----:----| F D A T G K I P V T G S V F * C F L I L S T Q Q A K S P Y P A A * L D V F Y Y L L R S H R Q H T R H R K C I L L I I Y A BsrDI |BseYI || GsaI CviJI HindII || |MaeIII HaeIII Hpy166II BsrI || |Hin4II* Hin4II* | MaeIII \ \ \\ \\ \ \ \ AGTAGTAGTGTCAACTCAACTGGCAATGGTGCTGGGGTTACGAAGGAAAGAAGGCCAAGT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TCATCATCACAGTTGAGTTGACCGTTACCACGACCCCAATGCTTCCTTTCTTCCGGTTCA / / / / / / / / Hpy166II BsrI | | | | Hin4II* HaeIII HindII | | | MaeIII CviJI | | Hin4II* | | BseYI | GsaI BsrDI S S S V N S T G N G A G V T K E R R P S V V V S T Q L A M V L G L R R K E G Q V * * C Q L N W Q W C W G Y E G K K A K L ----:----|----:----|----:----|----:----|----:----|----:----| L L L T L E V P L P A P T V F S L L G L C Y Y H * S L Q C H H Q P * S P F F A L T T T D V * S A I T S P N R L F S P W T Tth111I | Hin4I | Hin4I | Tsp4CI* | | Hpy178III* | | | MboI Hin4I | | | | DpnI TfiI Hin4I | | | | |BstKTI MboII HinfI | MnlI \ \ \ \ \\ \ \ \ \ TACAGGAGAAAATCAATGACACCGTCCAGAAGATCAAGTGTCGTAATAGAATCAACAAAG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTCCTCTTTTAGTTACTGTGGCAGGTCTTCTAGTTCACAGCATTATCTTAGTTGTTTC / / / / // / / / / / // MaeIII | | | || MboI MboII | | | |MnlI | | | |DpnI | | | BsaXI | | | BstKTI | | PpiI | | Hpy178III* | | AloI | Tth111I | HinfI | Tsp4CI* | TfiI Hin4I Hin4I Hin4I Hin4I Y R R K S M T P S R R S S V V I E S T K T G E N Q * H R P E D Q V S * * N Q Q R Q E K I N D T V Q K I K C R N R I N K G ----:----|----:----|----:----|----:----|----:----|----:----| * L L F D I V G D L L D L T T I S D V F N C S F I L S V T W F I L H R L L I L L V P S F * H C R G S S * T D Y Y F * C L XmnI AluI |Tsp4CI* CviJI AloI || BslFI | SetI PpiI || | BseRI | |MseI BsaXI || | | MaeIII | || MwoI | AvaI || | | Tsp45I | || |Hin6I | XhoI || | | Tsp4CI* | || ||GlaI | SmlI || | | | TspRI | || |||TseI | PspXI || | | | | BsaXI | || |||HhaI | |TaqI || | | | | | AloI | || ||||BisI | |BmeT110I || | | | | | PpiI | || |||||BlsI \ \\ \\ \ \ \ \ \ \ \ \\ \\\\\\ GAACTCGAGGAGAAACCGTTCCACTGTCACATTTGTCCCAAGAGCTTTAAGCGCAGCGAA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGAGCTCCTCTTTGGCAAGGTGACAGTGTAAACAGGGTTCTCGAAATTCGCGTCGCTT // / // / / / / / / / ////// |PspXI | || | | Tsp45I | | | | |||||TseI |SmlI | || | | MaeIII | | | | ||||BisI |XhoI | || | BsaXI | | | | |||BlsI |AvaI | || | PpiI | | | | ||Hin6I BmeT110I | || | AloI | | | | |GlaI TaqI | || Tsp4CI* | | | | HhaI | || BslFI | | | MseI | |BseRI | | MwoI | TspRI | CviJI Tsp4CI* | AluI XmnI SetI E L E E K P F H C H I C P K S F K R S E N S R R N R S T V T F V P R A L S A A N T R G E T V P L S H L S Q E L * A Q R T ----:----|----:----|----:----|----:----|----:----|----:----| S S S S F G N W Q * M Q G L L K L R L S P V R P S V T G S D C K D W S S * A C R F E L L F R E V T V N T G L A K L A A F FatI |CviAII || NspI || NlaIII || | MboI || | BglII || | XhoII || | | DpnI MaeIII || | | |BstKTI Tsp45I BbvI || | | || Hpy166II | NdeI \ \\ \ \ \\ \ \ \ CATTTGAAAAGGCATGTGAGATCTGTTCACTCTAACGAACGACCATTTGCTTGTCACATA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAACTTTTCCGTACACTCTAGACAAGTGAGATTGCTTGCTGGTAAACGAACAGTGTAT / / // // / / / / | | || || | Hpy166II | NdeI | | || || XhoII Tsp45I | | || || BglII MaeIII | | || || MboI | | || |DpnI | | || BstKTI | | |FatI | | CviAII | NlaIII | NspI BbvI H L K R H V R S V H S N E R P F A C H I I * K G M * D L F T L T N D H L L V T Y F E K A C E I C S L * R T T I C L S H M ----:----|----:----|----:----|----:----|----:----|----:----| C K F L C T L D T * E L S R G N A Q * M V N S F A H S I Q E S * R V V M Q K D C M Q F P M H S R N V R V F S W K S T V Y MlyI PleI | Hpy178III* | | HinfI ApoI Hin4I | | Hin4I BsmAI TspEI Hin4I TspEI | | Hin4I |FatI \ \ \ \ \ \ \\ TGCGATAAGAAATTTAGTAGAAGCGATAATTTGTCGCAACACATCAAGACTCATAAAAAA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| ACGCTATTCTTTAAATCATCTTCGCTATTAAACAGCGTTGTGTAGTTCTGAGTATTTTTT / / / // / / / | TspEI TspEI || | HinfI NlaIII | ApoI || Hpy178III* Hin4I |Hin4I Hin4I |Hin4I |PleI MlyI C D K K F S R S D N L S Q H I K T H K K A I R N L V E A I I C R N T S R L I K N R * E I * * K R * F V A T H Q D S * K T ----:----|----:----|----:----|----:----|----:----|----:----| H S L F N L L L S L K D C C M L V * L F I R Y S I * Y F R Y N T A V C * S E Y F A I L F K T S A I I Q R L V D L S M F F CviAII | NlaIII MseI \ \ \ CATGGAGACATTTAA 2110 ----:----|----: GTACCTCTGTAAATT // / |FatI MseI CviAII BsmAI H G D I * M E T F X W R H L X ----:----|----: C P S M * V H L C K M S V N L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 2 FblI,XmiI AciI 3 BspACI,SsiI AhaIII* 1 DraI AloI 2 AluI 7 AluBI ApoI 9 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 2 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 2 BpuEI BdaI 2 BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmeT110I 2 BmgT120I 1 BplI 2 BsaAI 1 BstBAI,Ppu21I BsaXI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 1 BseRI 2 BseSI 1 BaeGI,BstSLI BseYI 1 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 6 BtgZI 1 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 4 BstC8I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CspCI 1 CviAII 8 CviJI 13 CviKI-1 CviRI* 6 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 6 MalI Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 1 EcoP15I 1 EcoRI 2 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI FalI 2 FatI 8 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 GlaI 1 GsaI 1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 8 Hin4II* 7 HpyAV Hin6I 1 HinP1I,HspAI HindII 3 HincII HinfI 9 HphI 7 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 6 Hpy99I 1 KpnI 1 MaeI 4 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 10 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 4 SchI MmeI 1 MnlI 12 MseI 10 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspI 1 BstNSI,XceI PleI 4 PpsI PpiI 2 PsiI 1 AanI PspXI 2 RsaI 4 AfaI SalI 1 ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SetI 21 SexAI 1 MabI SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 4 SmoI SspI 2 SwaI 1 SmiI TaiI 5 TaqI 8 TatI 2 TauI 1 TfiI 5 PfeI TseI 3 ApeKI TsoI 1 Tsp45I 5 NmuCI Tsp4CI* 9 HpyCH4III,TaaI,Bst4CI TspDTI 13 TspEI 27 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 5 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI XbaI 1 XhoI 2 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AcyI AflII AflIII AgeI AjuI AlfI AlwNI ApaI ApaLI AscI AvrII BaeI BalI BamHI BarI BbvCI BceAI BcgI BciVI BclI BetI* BfiI BglI BmtI Bpu10I BsaBI BsePI BsgI BsiI* BsmI Bsp120I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BstAPI BstXI CauII* Cfr10I Cfr9I CfrI DinI DraII DraIII DrdI DsaI* Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoT22I EgeI EheI EspI* FauI FseI FspAI GsuI HaeII HgiAI* HindIII HpaI HpaII KasI Ksp632I* MauBI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NsiI NspBII* OliI PacI PasI PflMI PfoI PmaCI PmeI PpuMI PshAI PspOMI PsrI PstI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* SecI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI TaqII TspMI TstI XcmI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769