Restriction Map of GTR1/YML121W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GTR1/YML121W on chromosome XIII from coordinates 26930 to 27862.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.20386

BccI | MboII | | Hpy188I | | | AsuI* | | | |BmgT120I | | | ||CviJI | | | ||Cfr10I | | | ||HaeIII | | | |||HpaII | | | |||| AsuI* | | | |||| AvaII | | | |||| RsrII | | | |||| |BmgT120I | | | |||| || BglI | | | |||| || MwoI | | | |||| || HpaII | | | |||| || | CviJI | | | |||| || | |NlaIV | | | |||| || | ||BetI* | | | |||| || | |||HpaII | | | |||| || | |||| BdaI | | | |||| || | |||| BdaI MnlI \ \ \ \\\\ \\ \ \\\\ \ \ ATGTCGTCAAATAATAGGAAGAAACTGCTTCTGATGGGCCGGTCCGGCTCCGGTAAATCG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGCAGTTTATTATCCTTCTTTGACGAAGACTACCCGGCCAGGCCGAGGCCATTTAGC // / // //// /// // / || | || |||| ||| || MnlI || | || |||| ||| |BetI* || | || |||| ||| HpaII || | || |||| ||| BdaI || | || |||| ||| BdaI || | || |||| ||NlaIV || | || |||| |CviJI || | || |||| HpaII || | || |||RsrII || | || |||AvaII || | || |||AsuI* || | || ||BmgT120I || | || |Cfr10I || | || HpaII || | || MwoI || | || BglI || | |AsuI* || | BmgT120I || | HaeIII || | CviJI || Hpy188I |MboII BccI M S S N N R K K L L L M G R S G S G K S C R Q I I G R N C F * W A G P A P V N R V V K * * E E T A S D G P V R L R * I V ----:----|----:----|----:----|----:----|----:----|----:----| X D D F L L F F S S R I P R D P E P L D X T T L Y Y S S V A E S P G T R S R Y I H R * I I P L F Q K Q H A P G A G T F R TaqI SetI MaeIII TstI |MboI | BdaI BsaXI || DpnI | BdaI | TaqII HgiCI* || |BstKTI | | AciI | |MaeI | NlaIV \\ \\ \ \ \ \ \\ \ \ TCAATGAGGTCGATCATCTTTAGTAACTACTCCGCTTTTGACACTAGGAGATTGGGTGCC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTACTCCAGCTAGTAGAAATCATTGATGAGGCGAAAACTGTGATCCTCTAACCCACGG / // / // / / / / / / SetI || MboI |MaeIII | | | MaeI | HgiCI* |DpnI BdaI | | TaqII NlaIV BstKTI BdaI | BsaXI TaqI AciI TstI S M R S I I F S N Y S A F D T R R L G A Q * G R S S L V T T P L L T L G D W V P N E V D H L * * L L R F * H * E I G C H ----:----|----:----|----:----|----:----|----:----|----:----| D I L D I M K L L * E A K S V L L N P A T L S T S * R * Y S S R K Q C * S I P H * H P R D D K T V V G S K V S P S Q T G Hin4I Hin4I BsaXI SduI | MlyI | TstI HgiAI* | PleI HinfI \ \ \ \ \ \ ACCATTGATGTAGAGCACTCCCATTTGAGATTTCTTGGGAATATGACTCTAAATCTGTGG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTAACTACATCTCGTGAGGGTAAACTCTAAAGAACCCTTATACTGAGATTTAGACACC / / / // / BsaXI HgiAI* Hin4I |PleI HinfI TstI SduI Hin4I MlyI T I D V E H S H L R F L G N M T L N L W P L M * S T P I * D F L G I * L * I C G H * C R A L P F E I S W E Y D S K S V G ----:----|----:----|----:----|----:----|----:----|----:----| V M S T S C E W K L N R P F I V R F R H W W Q H L A S G N S I E Q S Y S E L D T G N I Y L V G M Q S K K P I H S * I Q P Tsp4CI* | Hin4I | Hin4I | | BslFI | | | MaeII | | | AflIII | | | |BtrI HphI | | | || SetI TspEI | | | || TaiI | XmnI BccI \ \ \ \\ \ \ \ \ GACTGTGGTGGGCAGGACGTGTTTATGGAGAATTATTTCACCAAGCAAAAAGACCACATT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTGACACCACCCGTCCTGCACAAATACCTCTTAATAAAGTGGTTCGTTTTTCTGGTGTAA / //// / / / Tsp4CI* |||| AflIII HphI TspEI Hin4I |||MaeII XmnI Hin4I ||BtrI |BslFI TaiI SetI D C G G Q D V F M E N Y F T K Q K D H I T V V G R T C L W R I I S P S K K T T F L W W A G R V Y G E L F H Q A K R P H F ----:----|----:----|----:----|----:----|----:----|----:----| S Q P P C S T N I S F * K V L C F S W M P S H H A P R T * P S N N * W A F L G C V T T P L V H K H L I I E G L L F V V N AarI BspMI Hpy178III* | CviRI* | | SetI | | | MseI | | | |TspEI | | | || Hin4I HinfI | | | || Hin4I Bce83I* | | | || |MaeII | HindII | | | || || SetI | Hpy166II SmlI | | | || || TaiI | | PleI | Hin4I | | | || || | BsgI | | |MlyI | Hin4I \ \ \ \\ \\ \ \ \ \ \\ \ \ TTCCAGATGGTGCAGGTGTTAATTCACGTTTTTGATGTAGAGTCAACTGAAGTTCTCAAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTCTACCACGTCCACAATTAAGTGCAAAAACTACATCTCAGTTGACTTCAAGAGTTC / / / // // // // / // / / / | | | |SetI || || |BsgI | || | Hin4I SmlI | | | CviRI* || || MaeII | || | Hin4I | | BspMI || |TaiI | || PleI | | AarI || |SetI | || MlyI | Hpy178III* || TspEI | |Hpy166II BccI |MseI | |HindII Hin4I | HinfI Hin4I Bce83I* F Q M V Q V L I H V F D V E S T E V L K S R W C R C * F T F L M * S Q L K F S R P D G A G V N S R F * C R V N * S S Q G ----:----|----:----|----:----|----:----|----:----|----:----| K W I T C T N I * T K S T S D V S T R L K G S P A P T L E R K Q H L T L Q L E * E L H H L H * N V N K I Y L * S F N E L CviRI* Hpy178III* | HindIII TatI | AcyI Eco57I | | AluI |Csp6I | | Hpy99I Eco57MI | | CviJI TspEI ||RsaI | | | ApoI | SspI | | | SetI | MseI ||ScaI | | | TspEI \ \ \ \ \ \ \ \ \\\ \ \ \ \ GATATTGAAATATTTGCAAAAGCTTTGAAGCAATTAAGGAAGTACTCTCCCGACGCCAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAACTTTATAAACGTTTTCGAAACTTCGTTAATTCCTTCATGAGAGGGCTGCGGTTT / / / / / / // /// // / / | SspI | | | HindIII |MseI ||TatI || AcyI MboII Eco57MI | | CviJI TspEI |Csp6I |Hpy178III* Eco57I | | AluI ScaI Hpy99I | SetI RsaI CviRI* D I E I F A K A L K Q L R K Y S P D A K I L K Y L Q K L * S N * G S T L P T P K Y * N I C K S F E A I K E V L S R R Q N ----:----|----:----|----:----|----:----|----:----|----:----| S I S I N A F A K F C N L F Y E G S A L P Y Q F I Q L L K S A I L S T S E R R W I N F Y K C F S Q L L * P L V R G V G F MboI XhoII BccI | DpnI AluI HgaI CviRI* | |BstKTI PpiI CviJI MboII | MmeI | || BinI* | MnlI | SetI \ \ \ \ \\ \ \ \ \ \ ATTTTTGTTCTTCTGCATAAGATGGATCTTGTTCAGTTGGATAAGAGAGAGGAGCTGTTC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAACAAGAAGACGTATTCTACCTAGAACAAGTCAACCTATTCTCTCTCCTCGACAAG / / // // / / / / / / | HgaI |BccI || | | PpiI MnlI | CviJI TspEI CviRI* || | BinI* | AluI ApoI MmeI || XhoII SetI || MboI |DpnI BstKTI I F V L L H K M D L V Q L D K R E E L F F L F F C I R W I L F S W I R E R S C S F C S S A * D G S C S V G * E R G A V P ----:----|----:----|----:----|----:----|----:----|----:----| I K T R R C L I S R T * N S L L S S S N F K Q E E A Y S P D Q E T P Y S L P A T N K N K Q M L H I K N L Q I L S L L Q E BseRI |FatI DdeI |BspHI |SetI ||CviAII || MboII ||Hpy178III* || BbvII* ||| NlaIII || | TspDTI ||| |BseMII || | | MaeII Hpy188I ||| ||BspCNI || | | | SetI |ApoI ||| |||PpiI || | | | TaiI |TspEI Hpy188I \\\ \\\\ \\ \ \ \ \ \\ \ CAAATCATGATGAAAAACCTGAGTGAAACGTCTTCGGAATTTGGGTTTCCCAATCTGATA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTAGTACTACTTTTTGGACTCACTTTGCAGAAGCCTTAAACCCAAAGGGTTAGACTAT / / /// / // / / / / / / | | ||BspCNI SetI || | | | TspEI | SetI | | ||BspHI || | | | ApoI Hpy188I | | ||FatI || | | Hpy188I | | |Hpy178III* || | MaeII | | |CviAII || BbvII* | | |BseMII || TaiI | | PpiI || SetI | NlaIII |TspDTI BseRI MboII DdeI Q I M M K N L S E T S S E F G F P N L I K S * * K T * V K R L R N L G F P I * * N H D E K P E * N V F G I W V S Q S D R ----:----|----:----|----:----|----:----|----:----|----:----| W I M I F F R L S V D E S N P N G L R I G F * S S F G S H F T K P I Q T E W D S L D H H F V Q T F R R R F K P K G I Q Y FatI |CviAII SetI TaqI BseGI FokI || NlaIII \ \ \ \ \\ \ GGTTTTCCTACTTCGATTTGGGATGAGAGTTTATACAAGGCATGGTCGCAGATTGTATGC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAAAGGATGAAGCTAAACCCTACTCTCAAATATGTTCCGTACCAGCGTCTAACATACG / / / / // TaqI BseGI | | |FatI | | CviAII | NlaIII FokI G F P T S I W D E S L Y K A W S Q I V C V F L L R F G M R V Y T R H G R R L Y A F S Y F D L G * E F I Q G M V A D C M L ----:----|----:----|----:----|----:----|----:----|----:----| P K G V E I Q S S L K Y L A H D C I T H L N E * K S K P H S N I C P M T A S Q I T K R S R N P I L T * V L C P R L N Y A MmeI BccI | MseI Cac8I |TspEI | | MboII \ \\ \ \ \ TCGCTAATACCCAATATGTCCAACCATCAAAGTAATTTGAAGAAGTTTAAGGAGATTATG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGCGATTATGGGTTATACAGGTTGGTAGTTTCATTAAACTTCTTCAAATTCCTCTAATAC / / / / // Cac8I | | MmeI |MboII | TspEI MseI BccI S L I P N M S N H Q S N L K K F K E I M R * Y P I C P T I K V I * R S L R R L * A N T Q Y V Q P S K * F E E V * G D Y E ----:----|----:----|----:----|----:----|----:----|----:----| E S I G L I D L W * L L K F F N L S I I S A L V W Y T W G D F Y N S S T * P S * R * Y G I H G V M L T I Q L L K L L N H TspEI | TspDTI | |XmnI GsuI FalI | || FalI TaqI Eco57MI FalI | || FalI AsuII | DdeI | BsrI \ \\ \ \ \ \ \ \ AACGCCCTTGAAATTATTCTTTTCGAAAGAACAACTTTCTTAGTGATATGCTCCAGTAAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCGGGAACTTTAATAAGAAAAGCTTTCTTGTTGAAAGAATCACTATACGAGGTCATTA / /// / / / / / | ||TspEI AsuII Eco57MI | FalI BsrI | |XmnI TaqI GsuI | FalI | FalI DdeI | FalI TspDTI N A L E I I L F E R T T F L V I C S S N T P L K L F F S K E Q L S * * Y A P V M R P * N Y S F R K N N F L S D M L Q * W ----:----|----:----|----:----|----:----|----:----|----:----| F A R S I I R K S L V V K K T I H E L L S R G Q F * E K R F F L K R L S I S W Y V G K F N N K E F S C S E * H Y A G T I FatI BspHI |CviAII |Hpy178III* || NlaIII || | TspDTI || | | Hpy188I MaeI \\ \ \ \ \ GGCGAAAATAGTAATGAAAATCATGATAGTTCGGATAATAATAATGTCTTGCTAGACCCG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTTTTATCATTACTTTTAGTACTATCAAGCCTATTATTATTACAGAACGATCTGGGC / // / / / | || | Hpy188I MaeI | || TspDTI | |BspHI | |FatI | Hpy178III* | CviAII NlaIII G E N S N E N H D S S D N N N V L L D P A K I V M K I M I V R I I I M S C * T R R K * * * K S * * F G * * * C L A R P E ----:----|----:----|----:----|----:----|----:----|----:----| P S F L L S F * S L E S L L L T K S S G H R F Y Y H F D H Y N P Y Y Y H R A L G A F I T I F I M I T R I I I I D Q * V R CviRI* XmnI | BdaI |TfiI | BdaI |HinfI EcoRV | | SapI || TaqI |BdaI | | TspEI || AsuII |BdaI XmnI TspDTI | | Ksp632I* \\ \ \\ \ \ \ \ \ AAGCGATTCGAAAAGATATCCAATATAATGAAAAACTTCAAGCAGAGTTGCACGAAATTG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGCTAAGCTTTTCTATAGGTTATATTACTTTTTGAAGTTCGTCTCAACGTGCTTTAAC / / / // / / / // | | AsuII |EcoRV XmnI TspDTI CviRI* |TspEI | | TaqI BdaI BdaI Ksp632I* | HinfI BdaI BdaI SapI | TfiI XmnI K R F E K I S N I M K N F K Q S C T K L S D S K R Y P I * * K T S S R V A R N * A I R K D I Q Y N E K L Q A E L H E I E ----:----|----:----|----:----|----:----|----:----|----:----| F R N S F I D L I I F F K L C L Q V F N S A I R F S I W Y L S F S * A S N C S I L S E F L Y G I Y H F V E L L T A R F Q AciI BsrBI | TfiI | HinfI | | MboII Hin4I | | Hpy178III* |MaeII | | | MseI || SetI | | | | SspI || TaiI \ \ \ \ \ \\ \ AAGAGCGGATTCAAGACTTTAATATTGAACAACAACATCTACGTCAGCGAGTTATCGTCC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTCGCCTAAGTTCTGAAATTATAACTTGTTGTTGTAGATGCAGTCGCTCAATAGCAGG / / / / / / / / / | | | | | SspI | | MaeII | | | | MseI | TaiI | | | Hpy178III* | SetI | | MboII Hin4I | | HinfI | | TfiI | AciI BsrBI K S G F K T L I L N N N I Y V S E L S S R A D S R L * Y * T T T S T S A S Y R P E R I Q D F N I E Q Q H L R Q R V I V Q ----:----|----:----|----:----|----:----|----:----|----:----| F L P N L V K I N F L L M * T L S N D D S S R I * S K L I S C C C R R * R T I T L A S E L S * Y Q V V V D V D A L * R G TspEI Hin4I SspI TspDTI \ \ \ AATATGGTGTGTTTTATAGTGTTGAAAGATATGAATATTCCACAAGAATTAGTATTGGAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTATACCACACAAAATATCACAACTTTCTATACTTATAAGGTGTTCTTAATCATAACCTT / / / / Hin4I SspI | TspEI TspDTI N M V C F I V L K D M N I P Q E L V L E I W C V L * C * K I * I F H K N * Y W K Y G V F Y S V E R Y E Y S T R I S I G K ----:----|----:----|----:----|----:----|----:----|----:----| L I T H K I T N F S I F I G C S N T N S W Y P T N * L T S L Y S Y E V L I L I P I H H T K Y H Q F I H I N W L F * Y Q F CviJI \ AACATCAAAAAAGCCAAAGAGTTTTTCCAATGA 910 920 930 ----:----|----:----|----:----|--- TTGTAGTTTTTTCGGTTTCTCAAAAAGGTTACT / CviJI N I K K A K E F F Q * T S K K P K S F S N X H Q K S Q R V F P M X ----:----|----:----|----:----|--- F M L F A L S N K W H F C * F L W L T K G I V D F F G F L K E L S # Enzymes that cut Frequency Isoschizomers AarI 1 AciI 2 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AluI 2 AluBI ApoI 2 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 1 BpuEI BdaI 4 BetI* 1 BsaWI BglI 1 BinI* 1 AlwI,BspPI,AclWI BmgT120I 2 BsaXI 1 BseGI 1 BstF5I,BtsCI BseMII 1 BseRI 1 BsgI 1 BslFI 1 BsmFI,FaqI BspCNI 1 BspHI 2 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrBI 1 AccBSI,MbiI BsrI 1 BseNI,Bse1I,BsrSI BstKTI 2 BtrI 1 BmgBI,AjiI Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 1 CviQI,RsaNI CviAII 3 CviJI 5 CviKI-1 CviRI* 4 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 2 MalI Eco57I 1 AcuI Eco57MI 2 EcoRV 1 Eco32I FalI 2 FatI 3 FokI 1 GsuI 1 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 5 HindII 1 HincII HindIII 1 HinfI 4 HpaII 3 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 4 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 1 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MlyI 2 SchI MmeI 2 MnlI 2 MseI 4 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I PleI 2 PpsI PpiI 1 RsaI 1 AfaI RsrII 1 CspI,Rsr2I,CpoI SapI 1 LguI,PciSI,BspQI ScaI 1 BmcAI,AssI,ZrmI SduI 1 MhlI,Bsp1286I SetI 10 SmlI 1 SmoI SspI 3 TaiI 4 TaqI 4 TaqII 1 TatI 1 TfiI 2 PfeI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 9 TasI,Tsp509I,Sse9I TstI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 4 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AccI AclI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvI BceAI BcgI BciVI BclI BfiI BglII BisI BlsI BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BseBI BsePI BseSI BseYI BsiI* BsiYI* BsmAI BsmI Bsp120I Bsp1407I BspLU11I* BspMII* BspOI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtsI CauII* Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoT22I EgeI EheI Esp3I EspI* FauI Fnu4HI FnuDII* FseI FspAI GlaI GsaI HaeII HgiJII* HhaI Hin4II* Hin6I HinP1I HpaI HspAI KasI KpnI MauBI McrI* MfeI MluI Mph1103I MroNI MslI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII SacI SacII SalI SanDI SauI* ScrFI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I StyI SwaI TauI TseI TsoI Tsp45I TspGWI TspMI TspRI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769