Restriction Map of CTK3/YML112W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CTK3/YML112W on chromosome XIII from coordinates 45063 to 45953.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.29923

AsuI* AvaII DraII PpuMI |BmgT120I ||SetI |||AlwNI |||Hpy178III* |||| BsgI |||| |BbvI Hpy178III* |||| || SetI | AluI |||| || |CviRI* | CviJI |||| || || MboII | |MaeI |||| || || | BspMI BarI | ||SetI |||| || || | |MwoI |HinfI | ||TspDTI TspEI |||| || || | || TseI \\ \ \\\ \ \\\\ \\ \\ \ \\ \ ATGGACTCTCTTGAAGCTAGATTACAATTCATTCAGGTCCTGAAGAACCTGCAAAAGACG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTGAGAGAACTTCGATCTAATGTTAAGTAAGTCCAGGACTTCTTGGACGTTTTCTGC / / / / / / / / // / / / / // // | | | | MaeI | | | || | | SetI | |MwoI |BspMI | | | TspDTI | | | || | BsgI | MboII |Hin4I | | | CviJI | | | || | CviRI* Eco57MI | | | AluI | | | || | BbvI Eco57I | | SetI | | | || Hpy178III* | Hpy178III* | | | |PpuMI HinfI | | | |DraII | | | |AvaII | | | |AsuI* | | | BmgT120I | | AlwNI | SetI TspEI M D S L E A R L Q F I Q V L K N L Q K T W T L L K L D Y N S F R S * R T C K R R G L S * S * I T I H S G P E E P A K D A ----:----|----:----|----:----|----:----|----:----|----:----| X S E R S A L N C N M * T R F F R C F V X P S E Q L * I V I * E P G S S G A F S H V R K F S S * L E N L D Q L V Q L L R BisI Eco57I Eco57MI SalI |BlsI |TaqI ||CviRI* |AccI ||| Hin4I ||HindII ||| |HgaI ||Hpy166II ||| || BsmAI |||Hpy99I ||| || | MlyI ||||Hin4I ||| || | PleI HinfI |||||BtgZI Tsp4CI* \\\ \\ \ \ \ \\\\\\ \ CTGCACAAGACCAGAGACTCTATCACATCATCGTCGACCACCACACCACCGTCATCGCAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GACGTGTTCTGGTCTCTGAGATAGTGTAGTAGCAGCTGGTGGTGTGGTGGCAGTAGCGTT /// /// / // /// / / / ||CviRI* ||BsmAI HinfI || ||SalI BtgZI Tsp4CI* MwoI ||TseI |HgaI || |AccI |BisI |PleI || |TaqI BlsI MlyI || Hpy166II || HindII |Hin4I Hpy99I L H K T R D S I T S S S T T T P P S S Q C T R P E T L S H H R R P P H H R H R N A Q D Q R L Y H I I V D H H T T V I A T ----:----|----:----|----:----|----:----|----:----|----:----| S C L V L S E I V D D D V V V G G D D C A A C S W L S * * M M T S W W V V T M A Q V L G S V R D C * R R G G C W R * R L MwoI | AluI | CviJI Tsp4CI* MnlI | | SetI | SmlI SfeI* | Bce83I* \ \ \ \ \ \ \ \ CAAAAGCTGAACAATGACCCTATACAGTTCTACTTGAGAAACTACAGACATCACTACGAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTCGACTTGTTACTGGGATATGTCAAGATGAACTCTTTGATGTCTGTAGTGATGCTC / / / / / / / | CviJI Tsp4CI* SmlI | | Bce83I* | AluI | MnlI SetI SfeI* Q K L N N D P I Q F Y L R N Y R H H Y E K S * T M T L Y S S T * E T T D I T T R K A E Q * P Y T V L L E K L Q T S L R G ----:----|----:----|----:----|----:----|----:----|----:----| C F S F L S G I C N * K L F * L C * * S V F A S C H G * V T R S S F S C V D S R L L Q V I V R Y L E V Q S V V S M V V L FatI |BccI |CviAII || NlaIII || |MslI || || BstXI || || | AsuI* || || | AvaII || || | |BmgT120I || || | ||NlaIV || || | ||| MboII || || | ||| |MaeI BsrI TaqI || || | ||| |TspDTI MaeII \ \\ \\ \ \\\ \\ \ GACTTCCACCAATGTTTGTTCGATACAACCATGAAGATGGACCCACTAGATAGACTGGAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAGGTGGTTACAAACAAGCTATGTTGGTACTTCTACCTGGGTGATCTATCTGACCTG / / //// // / / // TaqI | |||MslI || | MaeI |TaiI | ||FatI || TspDTI |SetI | |CviAII || MboII BsrI | |BstXI |AvaII | BccI |AsuI* NlaIII BmgT120I NlaIV D F H Q C L F D T T M K M D P L D R L D T S T N V C S I Q P * R W T H * I D W T L P P M F V R Y N H E D G P T R * T G R ----:----|----:----|----:----|----:----|----:----|----:----| S K W W H K N S V V M F I S G S S L S S P S G G I N T R Y L W S S P G V L Y V P V E V L T Q E I C G H L H V W * I S Q V SetI TaiI AciI CviJI \ \ \ GTAGTGATATACTATGTTAGAATAATAAGAAACTTATATCCGCATAGCCATTCCAATACC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CATCACTATATGATACAATCTTATTATTCTTTGAATATAGGCGTATCGGTAAGGTTATGG / / / / MaeII AciI CviJI TsoI V V I Y Y V R I I R N L Y P H S H S N T * * Y T M L E * * E T Y I R I A I P I P S D I L C * N N K K L I S A * P F Q Y Q ----:----|----:----|----:----|----:----|----:----|----:----| T T I Y * T L I I L F K Y G C L W E L V R L S I S H * F L L F S I D A Y G N W Y Y H Y V I N S Y Y S V * I R M A M G I G FatI AluI TsoI |CviAII CviJI | MaeIII MseI || NlaIII | SetI \ \ \ \\ \ \ \ AATGTTACAAAAGTGTTAAACGAAGTGCTACTCATGGACATAGACTTGGTTTTTGAGCTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAATGTTTTCACAATTTGCTTCACGATGAGTACCTGTATCTGAACCAAAAACTCGAA / / / // / / / MaeIII MseI | |FatI | | MwoI | CviAII | CviJI NlaIII | AluI SetI N V T K V L N E V L L M D I D L V F E L M L Q K C * T K C Y S W T * T W F L S F C Y K S V K R S A T H G H R L G F * A L ----:----|----:----|----:----|----:----|----:----|----:----| L T V F T N F S T S S M S M S K T K S S W H * L L T L R L A V * P C L S P K Q A I N C F H * V F H * E H V Y V Q N K L K MwoI Hpy178III* | Hin4I | TfiI | Hin4I | HinfI | | BssKI | | MnlI | | EcoRII | | | Hin4I AluI | | | ScrFI | | | Hin4I CviJI | | | BseBI BsrI | | | |CviJI SetI | SetI \ \ \ \ \ \ \ \ \\ \ \ \ TGTCTGCCCTGCCAGGACTGGAAATCCCTCACGAATCAAGCCACCTGTAAAGAGCTATTC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ACAGACGGGACGGTCCTGACCTTTAGGGAGTGCTTAGTTCGGTGGACATTTCTCGATAAG / / / / / / / / / / / Hin4I | | BsrI | | | | SetI | CviJI Hin4I | EcoRII | | | CviJI | AluI | BssKI | | HinfI SetI BseBI | | MnlI ScrFI | | TfiI | Hin4I | Hin4I Hpy178III* C L P C Q D W K S L T N Q A T C K E L F V C P A R T G N P S R I K P P V K S Y S S A L P G L E I P H E S S H L * R A I P ----:----|----:----|----:----|----:----|----:----|----:----| Q R G Q W S Q F D R V F * A V Q L S S N K D A R G P S S I G * S D L W R Y L A I T Q G A L V P F G E R I L G G T F L * E HgaI | AcyI | | Hpy99I | | | HgaI | | | | MaeIII Hpy188I | | | | Tsp45I | BccI \ \ \ \ \ \ \ CTTGACTTATCCAAACTAATCCATTACGACGCCACCAGCGTCACGCACACACCATCAGAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTGAATAGGTTTGATTAGGTAATGCTGCGGTGGTCGCAGTGCGTGTGTGGTAGTCTG / // / / / | |HgaI | Tsp45I Hpy188I | AcyI | MaeIII Hpy99I HgaI L D L S K L I H Y D A T S V T H T P S D L T Y P N * S I T T P P A S R T H H Q T * L I Q T N P L R R H Q R H A H T I R H ----:----|----:----|----:----|----:----|----:----|----:----| R S K D L S I W * S A V L T V C V G D S G Q S I W V L G N R R W W R * A C V M L K V * G F * D M V V G G A D R V C W * V HgaI BssKI SexAI EcoRII | ScrFI | BseBI | |SetI | || Csp6I | || |RsaI | || || Tsp4CI* | || || | TspRI | || || | Hpy178III* | || || | | MnlI \ \\ \\ \ \ \ ACCACACTCATAGACGCTACTACCTGGTACAGTGTCAAGACAGAGAGGACTACAAAGGAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTGTGAGTATCTGCGATGATGGACCATGTCACAGTTCTGTCTCTCCTGATGTTTCCTG / / / //// // BccI | | |||| |Hpy178III* | | |||| MnlI | | |||Tsp4CI* | | ||Csp6I | | |RsaI | | EcoRII | | SexAI | | BssKI | | TspRI | | HgaI | BseBI | ScrFI SetI T T L I D A T T W Y S V K T E R T T K D P H S * T L L P G T V S R Q R G L Q R T H T H R R Y Y L V Q C Q D R E D Y K G L ----:----|----:----|----:----|----:----|----:----|----:----| V V S M S A V V Q Y L T L V S L V V F S C W V * L R * * R T C H * S L S S * L P G C E Y V S S G P V T D L C L P S C L V BsmAI |PleI ||SmlI TfiI ||MlyI HinfI ||AflII | BsrDI |||MseI | | PpiI |||| TspGWI | | | CviRI* HinfI |||| |BsmAI PpiI TspEI \ \ \ \ \ \\\\ \\ \ \ TATAAAGAATCATTGCAACGAACGGAGTCTCTGCTTAAGGACAGAGACTTGAAGAAATTG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTTCTTAGTAACGTTGCTTGCCTCAGAGACGAATTCCTGTCTCTGAACTTCTTTAAC // / / / ////// / / || | CviRI* HinfI |||||| BsmAI TspEI || HinfI |||||PpiI || TfiI ||||AflII |BsrDI ||||SmlI PpiI |||MseI ||BsmAI |TspGWI PleI MlyI Y K E S L Q R T E S L L K D R D L K K L I K N H C N E R S L C L R T E T * R N W * R I I A T N G V S A * G Q R L E E I G ----:----|----:----|----:----|----:----|----:----|----:----| * L S D N C R V S D R S L S L S K F F N S Y L I M A V F P T E A * P C L S S S I I F F * Q L S R L R Q K L V S V Q L F Q MboI | DpnI | |BstKTI | || EcoP15I | || |BssKI | || || HpaII TseI | || || ScrFI |BisI CviJI | || || CauII* ||BlsI | MboII BcgI TspEI Hpy188I | || || | BcgI |||CviJI \ \ \ \ \ \ \\ \\ \ \ \\\\ GCTTTCTTTCAGCAGTTCAATTCCGATACAACTGCGATCAACCCGGACTTACAGACGCAG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAAGAAAGTCGTCAAGTTAAGGCTATGTTGACGCTAGTTGGGCCTGAATGTCTGCGTC // / // // / / /// /// |MboII BcgI |Hpy188I || | | ||BssKI ||CviJI CviJI TspEI || | | |HpaII ||TseI || | | |BcgI |BisI || | | CauII* BlsI || | | ScrFI || | EcoP15I || MboI |DpnI BstKTI A F F Q Q F N S D T T A I N P D L Q T Q L S F S S S I P I Q L R S T R T Y R R S F L S A V Q F R Y N C D Q P G L T D A A ----:----|----:----|----:----|----:----|----:----|----:----| A K K * C N L E S V V A I L G S K C V C P K R E A T * N R Y L Q S * G P S V S A S E K L L E I G I C S R D V R V * L R L BbvI BccI BsgI MnlI HgaI |CviRI* CviRI* |BseGI FokI |CviRI* \ \\ \ \\ \ \\ CCAACCAATGCAAACATTTTGTTGCACAGGATGGAAGCAGACAGGGAACTGCACAAGAGG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTGGTTACGTTTGTAAAACAACGTGTCCTACCTTCGTCTGTCCCTTGACGTGTTCTCC / / / // // / / / / | | BbvI |BccI |BseGI | | | SetI | CviRI* CviRI* BsgI | | CviRI* HgaI | MnlI FokI P T N A N I L L H R M E A D R E L H K R Q P M Q T F C C T G W K Q T G N C T R G N Q C K H F V A Q D G S R Q G T A Q E V ----:----|----:----|----:----|----:----|----:----|----:----| G V L A F M K N C L I S A S L S S C L L A L W H L C K T A C S P L L C P V A C S W G I C V N Q Q V P H F C V P F Q V L P BsrI | TfiI | HinfI AsuI* | | BseGI DraII | | | Hpy188I TaqI Csp6I |CviJI | | | |ApoI SetI |RsaI |HaeIII XcmI | | | |TspEI BsmAI || TaqI |BmgT120I MnlI | | | ||MmeI \ \\ \ \\ \ \ \ \ \\\ TCGAAAGAGACAAGTTGGTACATCGAAAGGCCCTCCAACGATATACTGGATGAATCCGAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTTTCTCTGTTCAACCATGTAGCTTTCCGGGAGGTTGCTATATGACCTACTTAGGCTT / / // / /// / / / /// | BsmAI || TaqI ||DraII MnlI | | ||MmeI TaqI |Csp6I ||AsuI* XcmI | | |Hpy188I RsaI |BmgT120I | | HinfI HaeIII | | TfiI CviJI | BseGI BsrI S K E T S W Y I E R P S N D I L D E S E R K R Q V G T S K G P P T I Y W M N P N E R D K L V H R K A L Q R Y T G * I R I ----:----|----:----|----:----|----:----|----:----|----:----| D F S V L Q Y M S L G E L S I S S S D S T S L S L N T C R F A R W R Y V P H I R R F L C T P V D F P G G V I Y Q I F G F FokI |MseI ||AhaIII* ||| TspDTI TfiI ||| |HindIII HinfI ||| || AluI | BetI* ||| || CviJI | BspMII* ||| || | SetI | |HpaII ||| || | | Hpy166II HgaI | |Hpy178III* \\\ \\ \ \ \ \ \ \\ TTTAAAAGCTTGTGGACGCATTTTGAAACTACTGATTCCGGATTTGATAAGGACGATTAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTTTCGAACACCTGCGTAAAACTTTGATGACTAAGGCCTAAACTATTCCTGCTAATG ///// / / / / / // ||||| | | Hpy166II HgaI | |BspMII* ||||| | HindIII | |BetI* ||||| CviJI | Hpy178III* ||||| AluI | HpaII ||||SetI HinfI |||FokI TfiI ||MseI |AhaIII* |TspDTI TspEI ApoI F K S L W T H F E T T D S G F D K D D Y L K A C G R I L K L L I P D L I R T I T * K L V D A F * N Y * F R I * * G R L Q ----:----|----:----|----:----|----:----|----:----|----:----| N L L K H V C K S V V S E P N S L S S * I * F S T S A N Q F * Q N R I Q Y P R N K F A Q P R M K F S S I G S K I L V I V CviJI | MseI | |AhaIII* | || BarI | || |BsrDI | || ||Hin4II* SfaNI \ \\ \\\ \ AAAAATATCAAGGCTTTAAATGACATTGCGAAGGCATCTTACATATATTAG 850 860 870 880 890 ----:----|----:----|----:----|----:----|----:----|- TTTTTATAGTTCCGAAATTTACTGTAACGCTTCCGTAGAATGTATATAATC / // / / / / | || | Hin4II* | BarI | || BsrDI SfaNI | |MseI | AhaIII* | BarI CviJI K N I K A L N D I A K A S Y I Y * K I S R L * M T L R R H L T Y I X K Y Q G F K * H C E G I L H I L X ----:----|----:----|----:----|----:----|----:----|- L F I L A K F S M A F A D * M Y * C F Y * P K L H C Q S P M K C I N F I D L S * I V N R L C R V Y I L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 2 DraI AluI 5 AluBI AlwNI 1 CaiI ApoI 1 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BarI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BccI 3 Bce83I* 1 BpuEI BcgI 1 BetI* 1 BsaWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 3 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BsgI 2 BsmAI 4 Alw26I,BstMAI BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 2 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstKTI 1 BstXI 1 BtgZI 1 CauII* 1 BcnI,BpuMI,NciI,AsuC2I Csp6I 2 CviQI,RsaNI CviAII 2 CviJI 11 CviKI-1 CviRI* 6 HpyCH4V DpnI 1 MalI DraII 2 EcoO109I Eco57I 1 AcuI Eco57MI 1 EcoP15I 1 EcoRII 2 AjnI,Psp6I,PspGI FatI 2 FokI 2 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 6 CseI Hin4I 3 Hin4II* 1 HpyAV HindII 1 HincII HindIII 1 HinfI 7 HpaII 2 HapII,BsiSI,MspI Hpy166II 2 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 3 Hpy99I 2 MaeI 2 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 2 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MlyI 2 SchI MmeI 1 MnlI 5 MseI 4 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I PleI 2 PpsI PpiI 1 PpuMI 1 Psp5II,PspPPI RsaI 2 AfaI SalI 1 ScrFI 3 BmrFI,MspR9I,Bme1390I SetI 11 SexAI 1 MabI SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI TaiI 1 TaqI 4 TfiI 4 PfeI TseI 2 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 4 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI XcmI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AflIII AgeI AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BbvCI BbvII* BceAI BciVI BclI BdaI BfiI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseMII BsePI BseRI BseSI BseYI BsiI* BsiYI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstZ17I BtrI BtsI Cac8I Cfr10I Cfr9I CfrI ClaI CspCI DdeI DinI DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgiAI* HgiCI* HgiJII* HhaI Hin6I HinP1I HpaI HphI HspAI KasI KpnI Ksp632I* MauBI McrI* MfeI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* ScaI SduI SecI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqII TatI TauI TspMI TstI Tth111I VspI XbaI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769