Restriction Map of HMG1/YML075C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

HMG1/YML075C on chromosome XIII from coordinates 118898 to 115734.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 AciI BisI |BlsI ||TauI |||AciI |||BisI CviJI ||||BlsI | MfeI |||||TauI BccI BslFI | TspEI Hpy178III* \\\\\\ \ \ \ \ \ ATGCCGCCGCTATTCAAGGGACTGAAACAGATGGCAAAGCCAATTGCCTATGTTTCAAGA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGCGGCGATAAGTTCCCTGACTTTGTCTACCGTTTCGGTTAACGGATACAAAGTTCT /////// / / / / / ||||||AciI BccI | CviJI TspEI Hpy178III* |||||BisI BslFI MfeI ||||BlsI |||AciI |||TauI ||BisI |BlsI TauI M P P L F K G L K Q M A K P I A Y V S R C R R Y S R D * N R W Q S Q L P M F Q D A A A I Q G T E T D G K A N C L C F K I ----:----|----:----|----:----|----:----|----:----|----:----| X G G S N L P S F C I A F G I A * T E L X A A A I * P V S V S P L A L Q R H K L H R R * E L S Q F L H C L W N G I N * S AciI TspDTI TspEI | BsmI TspGWI \ \ \ \ \ TTTTCGGCGAAACGACCAATTCATATAATACTTTTTTCTCTAATCATATCCGCATTCGCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAGCCGCTTTGCTGGTTAAGTATATTATGAAAAAAGAGATTAGTATAGGCGTAAGCGA / / / / / TspDTI TspEI | | TspGWI | AciI BsmI F S A K R P I H I I L F S L I I S A F A F R R N D Q F I * Y F F L * S Y P H S L F G E T T N S Y N T F F S N H I R I R L ----:----|----:----|----:----|----:----|----:----|----:----| N E A F R G I * I I S K E R I M D A N A I K P S V V L E Y L V K K E L * I R M R K R R F S W N M Y Y K K R * D Y G C E S MaeI | TfiI | HinfI \ \ TATCTATCCGTCATTCAGTATTACTTCAATGGTTGGCAACTAGATTCAAATAGTGTTTTT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGATAGGCAGTAAGTCATAATGAAGTTACCAACCGTTGATCTAAGTTTATCACAAAAA / / | HinfI | TfiI MaeI Y L S V I Q Y Y F N G W Q L D S N S V F I Y P S F S I T S M V G N * I Q I V F L S I R H S V L L Q W L A T R F K * C F * ----:----|----:----|----:----|----:----|----:----|----:----| * R D T M * Y * K L P Q C S S E F L T K K D I R * E T N S * H N A V L N L Y H K I * G D N L I V E I T P L * I * I T N K MlyI Hpy178III* PleI HinfI | MmeI SfeI* \ \ \ \ \ GAAACTGCTCCAAATAAAGACTCCAACACTCTATTTCAAGAATGTTCCCATTACTACAGA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGACGAGGTTTATTTCTGAGGTTGTGAGATAAAGTTCTTACAAGGGTAATGATGTCT // / / / / |PleI HinfI | MmeI SfeI* MlyI Hpy178III* E T A P N K D S N T L F Q E C S H Y Y R K L L Q I K T P T L Y F K N V P I T T E N C S K * R L Q H S I S R M F P L L Q R ----:----|----:----|----:----|----:----|----:----|----:----| S V A G F L S E L V R N * S H E W * * L Q F Q E L Y L S W C E I E L I N G N S C F S S W I F V G V S * K L F T G M V V S AciI | Hin6I | FnuDII* | |GlaI | ||FatI | ||HhaI | |||CviAII | |||| MwoI BccI | |||| NlaIII | XbaI | |||| | AluI | |MaeI | |||| | CviJI MaeIII TfiI | |Hpy178III* | |||| | |MaeI | TspDTI HinfI | || MnlI HphI | |||| | ||SetI | | CviJI \ \ \\ \ \ \ \\\\ \ \\\ \ \ \ GATTCCTCTCTAGATGGTTGGGTATCAATCACCGCGCATGAAGCTAGTGAGTTACCAGCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGGAGAGATCTACCAACCCATAGTTAGTGGCGCGTACTTCGATCACTCAATGGTCGG / / /// / //// /// / / / / / | | ||MnlI HphI |||| ||| | MaeI | | CviJI | | |XbaI |||| ||| CviJI | MaeIII | | Hpy178III* |||| ||| AluI TspDTI | | MaeI |||| ||SetI | BccI |||| |FatI HinfI |||| CviAII TfiI |||MwoI ||NlaIII ||Hin6I |GlaI FnuDII* AciI HhaI D S S L D G W V S I T A H E A S E L P A I P L * M V G Y Q S P R M K L V S Y Q P F L S R W L G I N H R A * S * * V T S P ----:----|----:----|----:----|----:----|----:----|----:----| S E E R S P Q T D I V A C S A L S N G A L N R E L H N P I L * R A H L * H T V L I G R * I T P Y * D G R M F S T L * W G MlyI MseI SetI PleI HinfI TspDTI \ \ \ \ \ CCACACCATTACTATCTATTAAACCTGAACTTCAATAGTCCTAATGAAACTGACTCCATT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGTGGTAATGATAGATAATTTGGACTTGAAGTTATCAGGATTACTTTGACTGAGGTAA // // / / |SetI |PleI | TspDTI MseI MlyI HinfI P H H Y Y L L N L N F N S P N E T D S I H T I T I Y * T * T S I V L M K L T P F T P L L S I K P E L Q * S * * N * L H S ----:----|----:----|----:----|----:----|----:----|----:----| G C W * * R N F R F K L L G L S V S E M G V G N S D I L G S S * Y D * H F Q S W W V M V I * * V Q V E I T R I F S V G N CviRI* Hpy178III* | MboI | MaeI | BglII | | AluI | XhoII | | CviJI | | DpnI | | | SetI Tsp4CI* | | |BstKTI \ \ \ \ \ \ \ \\ CCAGAACTAGCTAACACGGTTTTTGAGAAAGATAATACAAAATATATTCTGCAAGAAGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTTGATCGATTGTGCCAAAAACTCTTTCTATTATGTTTTATATAAGACGTTCTTCTA / /// / / /// | ||CviJI Tsp4CI* CviRI* ||TspRI | ||AluI |DpnI | |MaeI BstKTI | SetI Hpy178III* P E L A N T V F E K D N T K Y I L Q E D Q N * L T R F L R K I I Q N I F C K K I R T S * H G F * E R * Y K I Y S A R R S ----:----|----:----|----:----|----:----|----:----|----:----| G S S A L V T K S F S L V F Y I R C S S E L V L * C P K Q S L Y Y L I Y E A L L W F * S V R N K L F I I C F I N Q L F I MboII | TspRI | | MboII | | BspCNI | | |BseMII | | || ApoI MseI MaeIII DdeI | | || TspEI BccI MnlI SetI Tsp45I \ \ \ \\ \ \ \ \ \ CTCAGTGTTTCCAAAGAAATTTCTTCTACTGATGGAACGAAATGGAGGTTAAGAAGTGAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTCACAAAGGTTTCTTTAAAGAAGATGACTACCTTGCTTTACCTCCAATTCTTCACTG / / / // / / / / / / | | MboII |BseMII | BccI MnlI SetI MseI Tsp45I | DdeI |MboII TspEI MaeIII XhoII BspCNI ApoI BglII MboI L S V S K E I S S T D G T K W R L R S D S V F P K K F L L L M E R N G G * E V T Q C F Q R N F F Y * W N E M E V K K * Q ----:----|----:----|----:----|----:----|----:----|----:----| R L T E L S I E E V S P V F H L N L L S D * H K W L F K K * Q H F S I S T L F H E T N G F F N R R S I S R F P P * S T V TaqI | MaeII | | Hpy99I | | | MaeII | | |SetI | SetI | | |TaiI | TaiI Hpy188I \ \ \\ \ \ \ AGAAAAAGTCTTTTCGACGTAAAGACGTTAGCATATTCTCTCTACGATGTATTTTCAGAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTTTCAGAAAAGCTGCATTTCTGCAATCGTATAAGAGAGATGCTACATAAAAGTCTT / / / / / / | | | | MaeII Hpy188I | | | TaiI | | | SetI | | MaeII | TaqI | TaiI | SetI Hpy99I R K S L F D V K T L A Y S L Y D V F S E E K V F S T * R R * H I L S T M Y F Q K K K S F R R K D V S I F S L R C I F R K ----:----|----:----|----:----|----:----|----:----|----:----| L F L R K S T F V N A Y E R * S T N E S C F F D K R R L S T L M N E R R H I K L S F T K E V Y L R * C I R E V I Y K * F AcyI MaeII |ZraI ||TsoI |||SetI |||TaiI BsiYI* MaeIII |||AatII | MaeIII SetI \ \\\\ \ \ \ AATGTAACCCAAGCAGACCCGTTTGACGTCCTTATTATGGTTACTGCCTACCTAATGATG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTACATTGGGTTCGTCTGGGCAAACTGCAGGAATAATACCAATGACGGATGGATTACTAC / //// / / / MaeIII |||| BsiYI* | SetI |||MaeII MaeIII |||AcyI ||ZraI |TsoI AatII TaiI SetI N V T Q A D P F D V L I M V T A Y L M M M * P K Q T R L T S L L W L L P T * * C C N P S R P V * R P Y Y G Y C L P N D V ----:----|----:----|----:----|----:----|----:----|----:----| F T V W A S G N S T R I I T V A * R I I F H L G L L G T Q R G * * P * Q R G L S I Y G L C V R K V D K N H N S G V * H H BssKI |HpaII ||ScrFI Ksp632I* ||CauII* |MnlI ||Tth111I || MnlI |||BbvII* MboII || |FatI |||| ApoI | CviJI || ||CviAII |||| TspEI | HaeIII || ||| NlaIII |||| MboII \ \ \\ \\\ \ \\\\ \ TTCTACACCATATTCGGCCTCTTCAATGACATGAGGAAGACCGGGTCAAATTTTTGGTTG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAGATGTGGTATAAGCCGGAGAAGTTACTGTACTCCTTCTGGCCCAGTTTAAAAACCAAC / / / /// // / / / / MboII HaeIII | ||| |FatI | | | TspEI CviJI | ||| CviAII | | | ApoI | ||NlaIII | | BbvII* | |Ksp632I* | | MboII | MnlI | BssKI MnlI Tth111I CauII* HpaII ScrFI F Y T I F G L F N D M R K T G S N F W L S T P Y S A S S M T * G R P G Q I F G * L H H I R P L Q * H E E D R V K F L V E ----:----|----:----|----:----|----:----|----:----|----:----| N * V M N P R K L S M L F V P D F K Q N T R C W I R G R * H C S S S R T L N K T E V G Y E A E E I V H P L G P * I K P Q Hin6I |GlaI ||HhaI |||HaeII |||| SfeI* |||| | Tsp4CI* |||| | | MnlI |||| | | | TspRI SfaNI MaeIII |||| | | | |TspEI CviRI* | DdeI HphI Tsp45I \\\\ \ \ \ \\ \ \ \ \ \ AGCGCCTCTACAGTGGTCAATTCTGCATCATCACTTTTCTTAGCATTGTATGTCACCCAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCGGAGATGTCACCAGTTAAGACGTAGTAGTGAAAAGAATCGTAACATACAGTGGGTT //// / // / / / / / / / |||| | || MnlI | CviRI* | | HphI Tsp45I |||| | |SfeI* TspEI | DdeI MaeIII |||| | Tsp4CI* SfaNI |||| TspRI |||Hin6I ||GlaI |HhaI HaeII S A S T V V N S A S S L F L A L Y V T Q A P L Q W S I L H H H F S * H C M S P N R L Y S G Q F C I I T F L S I V C H P M ----:----|----:----|----:----|----:----|----:----|----:----| L A E V T T L E A D D S K K A N Y T V W S R R * L P * N Q M M V K R L M T H * G A G R C H D I R C * * K E * C Q I D G L MaeI TspDTI | TaqII AciI MseI Hin4II* | SetI \ \ \ \ \ \ \ TGTATTCTAGGCAAAGAAGTTTCCGCATTAACTCTTTTTGAAGGTTTGCCTTTCATTGTA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| ACATAAGATCCGTTTCTTCAAAGGCGTAATTGAGAAAAACTTCCAAACGGAAAGTAACAT // / / / // |MaeI AciI | | |SetI TaqII | | TspDTI | Hin4II* MseI C I L G K E V S A L T L F E G L P F I V V F * A K K F P H * L F L K V C L S L * Y S R Q R S F R I N S F * R F A F H C S ----:----|----:----|----:----|----:----|----:----|----:----| H I R P L S T E A N V R K S P K G K M T I Y E L C L L K R M L E K Q L N A K * Q T N * A F F N G C * S K K F T Q R E N Y Hpy178III* | BsrI | | MwoI | | | BssKI | | | SecI* | | | EcoRII | | | | ScrFI ApoI | BfiI | | | BseBI TspEI \ \ \ \ \ \ \ GTTGTTGTTGGTTTCAAGCACAAAATCAAGATTGCCCAGTATGCCCTGGAGAAATTTGAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CAACAACAACCAAAGTTCGTGTTTTAGTTCTAACGGGTCATACGGGACCTCTTTAAACTT / / / /// / | | MwoI ||EcoRII TspEI | BsrI ||BssKI ApoI Hpy178III* |SecI* BfiI BseBI ScrFI V V V G F K H K I K I A Q Y A L E K F E L L L V S S T K S R L P S M P W R N L K C C W F Q A Q N Q D C P V C P G E I * K ----:----|----:----|----:----|----:----|----:----|----:----| T T T P K L C L I L I A W Y A R S F N S L Q Q Q N * A C F * S Q G T H G P S I Q N N N T E L V F D L N G L I G Q L F K F HinfI TfiI | GsuI HinfI | Eco57MI |TspDTI | | PleI || Ksp632I* | | |MlyI TspGWI || |MnlI \ \ \\ \ \\ \\ AGAGTCGGTTTATCTAAAAGGATTACTACCGATGAAATCGTTTTTGAATCCGTGAGCGAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCAGCCAAATAGATTTTCCTAATGATGGCTACTTTAGCAAAAACTTAGGCACTCGCTT / / / / / / / | PleI TspGWI | | | Ksp632I* | MlyI | | MnlI Eco57MI | HinfI HinfI | TfiI GsuI TspDTI R V G L S K R I T T D E I V F E S V S E E S V Y L K G L L P M K S F L N P * A K S R F I * K D Y Y R * N R F * I R E R R ----:----|----:----|----:----|----:----|----:----|----:----| L T P K D L L I V V S S I T K S D T L S F L R N I * F S * * R H F R K Q I R S R S D T * R F P N S G I F D N K F G H A F MboII | TfiI | HinfI Hpy188I | | Hpy178III* SfaNI | BseGI \ \ \ \ \ \ GAGGGTGGTCGTTTGATTCAAGACCATTTGCTTTGTATTTTTGCCTTTATCGGATGCTCT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCCACCAGCAAACTAAGTTCTGGTAAACGAAACATAAAAACGGAAATAGCCTACGAGA / / / / / / / MboII | Hpy178III* | | | HphI HinfI | | BseGI TfiI | Hpy188I SfaNI E G G R L I Q D H L L C I F A F I G C S R V V V * F K T I C F V F L P L S D A L G W S F D S R P F A L Y F C L Y R M L Y ----:----|----:----|----:----|----:----|----:----|----:----| S P P R K I * S W K S Q I K A K I P H E L P H D N S E L G N A K Y K Q R * R I S L T T T Q N L V M Q K T N K G K D S A R HphI MfeI BbvII* | FokI TspEI | MboII CviRI* TspEI \ \ \ \ \ \ \ ATGTATGCTCACCAATTGAAGACTTTGACAAACTTCTGCATATTATCAGCATTTATCCTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TACATACGAGTGGTTAACTTCTGAAACTGTTTGAAGACGTATAATAGTCGTAAATAGGAT / / / / / FokI TspEI BbvII* CviRI* Hin4I MfeI MboII M Y A H Q L K T L T N F C I L S A F I L C M L T N * R L * Q T S A Y Y Q H L S * V C S P I E D F D K L L H I I S I Y P N ----:----|----:----|----:----|----:----|----:----|----:----| I Y A * W N F V K V F K Q M N D A N I R * T H E G I S S K S L S R C I I L M * G H I S V L Q L S Q C V E A Y * * C K D * DdeI |MwoI || Hin6I || |GlaI || |Eco47III || ||HhaI Hin4I || |||DdeI | TspEI MseI Hin4I || |||HaeII BsrI \ \ \ \ \\ \\\\ \ ATTTTTGAATTGATTTTAACTCCTACATTTTATTCTGCTATCTTAGCGCTTAGACTGGAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAACTTAACTAAAATTGAGGATGTAAAATAAGACGATAGAATCGCGAATCTGACCTT / / / / / //// / / TspEI TspEI MseI Hin4I MwoI |||| DdeI BsrI |||Hin6I ||Eco47III ||GlaI |HhaI HaeII DdeI I F E L I L T P T F Y S A I L A L R L E F L N * F * L L H F I L L S * R L D W K F * I D F N S Y I L F C Y L S A * T G N ----:----|----:----|----:----|----:----|----:----|----:----| I K S N I K V G V N * E A I K A S L S S L K Q I S K L E * M K N Q * R L A * V P N K F Q N * S R C K I R S D * R K S Q F MboI BglII XhoII Tsp4CI* TspDTI |BbvII* | DpnI || MboII | |BstKTI || | MboII \ \\ \\ \ \ ATGAATGTTATCCACAGATCTACTATTATCAAGCAAACATTAGAAGAAGACGGTGTTGTT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTACAATAGGTGTCTAGATGATAATAGTTCGTTTGTAATCTTCTTCTGCCACAACAA / // / / / / | || XhoII | | BbvII* | || BglII | | MboII | || MboI | MboII | |DpnI Tsp4CI* | BstKTI TspDTI M N V I H R S T I I K Q T L E E D G V V * M L S T D L L L S S K H * K K T V L F E C Y P Q I Y Y Y Q A N I R R R R C C S ----:----|----:----|----:----|----:----|----:----|----:----| I F T I W L D V I I L C V N S S S P T T F S H * G C I * * * * A F M L L L R H Q H I N D V S R S N D L L C * F F V T N N TfiI SfeI* HinfI | BccI | XmnI TspGWI MboII MseI \ \ \ \ \ \ \ CCATCTACAGCAAGAATCATTTCTAAAGCAGAAAAGAAATCCGTATCTTCTTTCTTAAAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGATGTCGTTCTTAGTAAAGATTTCGTCTTTTCTTTAGGCATAGAAGAAAGAATTTA // // / / / / |BccI |XmnI TspGWI MboII | TspRI SfeI* HinfI MseI TfiI P S T A R I I S K A E K K S V S S F L N H L Q Q E S F L K Q K R N P Y L L S * I I Y S K N H F * S R K E I R I F F L K S ----:----|----:----|----:----|----:----|----:----|----:----| G D V A L I M E L A S F F D T D E K K F E M * L L F * K * L L F S I R I K K R L W R C C S D N R F C F L F G Y R R E * I TspRI | BspCNI | |BseMII | || MslI | || |FatI TspDTI | || |BspHI | Tsp4CI* | || ||CviAII | |MboII | || ||Hpy178III* | |TspDTI DdeI | || ||| NlaIII | |BbvII* \ \ \\ \\\ \ \ \\ CTCAGTGTGGTTGTCATTATCATGAAACTCTCTGTCATACTGTTGTTTGTCTTCATCAAC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTCACACCAACAGTAATAGTACTTTGAGAGACAGTATGACAACAAACAGAAGTAGTTG / // // // / // / DdeI || || |BspHI | || BbvII* || || |FatI | |MboII || || Hpy178III* | Tsp4CI* || || CviAII | TspDTI || |NlaIII TspDTI || MslI |BseMII BspCNI L S V V V I I M K L S V I L L F V F I N S V W L S L S * N S L S Y C C L S S S T Q C G C H Y H E T L C H T V V C L H Q L ----:----|----:----|----:----|----:----|----:----|----:----| R L T T T M I M F S E T M S N N T K M L D * H P Q * * * S V R Q * V T T Q R * * E T H N D N D H F E R D Y Q Q K D E D V Hin4II* | TatI CviRI* | |Csp6I | TspEI | ||RsaI PsiI | | SfaNI TspDTI TspEI | ||| TaqI \ \ \ \ \ \ \ \\\ \ TTTTATAACTTTGGTGCAAATTGGGTCAATGATGCCTTCAATTCATTGTACTTCGATAAG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AAAATATTGAAACCACGTTTAACCCAGTTACTACGGAAGTTAAGTAACATGAAGCTATTC / / / / / // /// / PsiI | | | TspDTI || ||| TaqI | | SfaNI || ||TatI | TspEI || |Csp6I CviRI* || RsaI |Hin4II* TspEI F Y N F G A N W V N D A F N S L Y F D K F I T L V Q I G S M M P S I H C T S I R L * L W C K L G Q * C L Q F I V L R * G ----:----|----:----|----:----|----:----|----:----|----:----| K * L K P A F Q T L S A K L E N Y K S L S K Y S Q H L N P * H H R * N M T S R Y K I V K T C I P D I I G E I * Q V E I L BsmI MnlI MaeII | Hpy188I AflIII | | MnlI | SetI TaqI | | | MseI | TaiI SetI | | | |AhaIII* Cac8I \ \ \ \ \ \ \\ \ GAACGTGTTTCTCTACCAGATTTTATTACCTCGAATGCCTCTGAAAACTTTAAAGAGCAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGCACAAAGAGATGGTCTAAAATAATGGAGCTTACGGAGACTTTTGAAATTTCTCGTT / / / / / // / / // / | | AflIII SetI | || | | |MseI Cac8I | MaeII | || | | AhaIII* SetI TaiI | || | MnlI SetI | || Hpy188I | |MnlI | BsmI TaqI E R V S L P D F I T S N A S E N F K E Q N V F L Y Q I L L P R M P L K T L K S K T C F S T R F Y Y L E C L * K L * R A S ----:----|----:----|----:----|----:----|----:----|----:----| S R T E R G S K I V E F A E S F K L S C P V H K E V L N * * R S H R Q F S * L A F T N R * W I K N G R I G R F V K F L L AluI CviJI | SetI MaeIII | | HphI Tsp45I MseI MnlI \ \ \ \ \ \ GCTATTGTTAGTGTCACCCCATTATTATATTACAAACCCATTAAGTCCTACCAACGCATT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CGATAACAATCACAGTGGGGTAATAATATAATGTTTGGGTAATTCAGGATGGTTGCGTAA / / / / / | HphI Tsp45I MseI MnlI CviJI MaeIII AluI A I V S V T P L L Y Y K P I K S Y Q R I L L L V S P H Y Y I T N P L S P T N A L Y C * C H P I I I L Q T H * V L P T H * ----:----|----:----|----:----|----:----|----:----|----:----| A I T L T V G N N Y * L G M L D * W R M L * Q * H * G M I I N C V W * T R G V C S N N T D G W * * I V F G N L G V L A N Hpy178III* MboII TspRI | SetI \ \ \ \ GAGGATATGGTTCTTCTATTGCTTCGTAATGTCAGTGTTGCCATTCGTGATAGGTTCGTC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTATACCAAGAAGATAACGAAGCATTACAGTCACAACGGTAAGCACTATCCAAGCAG / / / / MboII TspRI | SetI Hpy178III* E D M V L L L L R N V S V A I R D R F V R I W F F Y C F V M S V L P F V I G S S G Y G S S I A S * C Q C C H S * * V R Q ----:----|----:----|----:----|----:----|----:----|----:----| S S I T R R N S R L T L T A M R S L N T Q P Y P E E I A E Y H * H Q W E H Y T R L I H N K * Q K T I D T N G N T I P E D TspEI AciI BtsI | EciI | DdeI CviRI* TspRI MslI BbvI \ \ \ \ \ \ \ \ AGTAAATTAGTTCTTTCCGCCTTAGTATGCAGTGCTGTCATCAATGTGTATTTATTGAAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTTAATCAAGAAAGGCGGAATCATACGTCACGACAGTAGTTACACATAAATAACTTA / / / / / / / / / / | TspEI AciI | | | BtsI MslI BbvI TspDTI EciI | | CviRI* | TspRI DdeI S K L V L S A L V C S A V I N V Y L L N V N * F F P P * Y A V L S S M C I Y * M * I S S F R L S M Q C C H Q C V F I E C ----:----|----:----|----:----|----:----|----:----|----:----| L L N T R E A K T H L A T M L T Y K N F * Y I L E K R R L I C H Q * * H T N I S T F * N K G G * Y A T S D D I H I * Q I TseI TspDTI |BisI ||BlsI ||BsmI SfeI* ||| MaeI | CviRI* ||| | ApoI | | PstI HphI ||| | TspEI | | | MfeI MaeIII ||| | EcoRI BsrI | | | TspEI HphI Tsp45I \\\ \ \ \ \ \ \ \ \ \ GCTGCTAGAATTCATACCAGTTATACTGCAGACCAATTGGTGAAAACTGAAGTCACCAAG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGATCTTAAGTATGGTCAATATGACGTCTGGTTAACCACTTTTGACTTCAGTGGTTC //// / / / / / / / / / / |||| MaeI | BsrI | | SfeI* TspEI HphI HphI Tsp45I |||TseI EcoRI | CviRI* MfeI MaeIII ||BisI TspEI PstI |BlsI ApoI BsmI A A R I H T S Y T A D Q L V K T E V T K L L E F I P V I L Q T N W * K L K S P R C * N S Y Q L Y C R P I G E N * S H Q E ----:----|----:----|----:----|----:----|----:----|----:----| A A L I * V L * V A S W N T F V S T V L H Q * F E Y W N Y Q L G I P S F Q L * W S S S N M G T I S C V L Q H F S F D G L TatI Tsp4CI* Bsp1407I | Hin4I Eco57I |Csp6I | Hin4I Eco57MI ||RsaI CviJI BsrI MseI | |TsoI \ \\\ \ \ \ \ \\ AAGTCTTTTACTGCTCCTGTACAAAAGGCTTCTACACCAGTTTTAACCAATAAAACAGTC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGAAAATGACGAGGACATGTTTTCCGAAGATGTGGTCAAAATTGGTTATTTTGTCAG / /// / / / / / / Eco57MI ||| CviJI BsrI MseI | | TsoI Eco57I ||Bsp1407I | Tsp4CI* ||TatI Hin4I |Csp6I Hin4I RsaI K S F T A P V Q K A S T P V L T N K T V S L L L L L Y K R L L H Q F * P I K Q S V F Y C S C T K G F Y T S F N Q * N S H ----:----|----:----|----:----|----:----|----:----|----:----| F D K V A G T C F A E V G T K V L L V T S T K * Q E Q V F P K * V L K L W Y F L L R K S S R Y L L S R C W N * G I F C D Hin4I Hin4I | Hin6I | |GlaI | |MstI* | ||HhaI | ||| TaqI | ||| | AluI | ||| | CviJI | ||| | Ecl136II | ||| | | SetI | ||| | | SduI | ||| | | SacI | ||| | | HgiAI* | ||| | | HgiJII* | ||| | | |TspDTI | ||| | | || Hpy178III* Hpy178III* | ||| | | || | AsuI* | MboI | ||| | | || | AvaII | | DpnI | ||| | | || | DraII | | |TaqI | ||| | | || | PpuMI | | |BstKTI | ||| | | || | |BmgT120I | | || BinI* | ||| | | || | || SetI \ \ \\ \ \ \\\ \ \ \\ \ \\ \ ATTTCTGGATCGAAAGTCAAAAGTTTATCATCTGCGCAATCGAGCTCATCAGGACCTTCA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGACCTAGCTTTCAGTTTTCAAATAGTAGACGCGTTAGCTCGAGTAGTCCTGGAAGT /// // / / /// / // //// ||| || BinI* Hin4I ||Hin6I | |TspDTI |||PpuMI ||| |TaqI Hin4I |MstI* | | |||DraII ||| MboI |GlaI | | |||AvaII ||DpnI HhaI | | |||AsuI* |BstKTI | | ||BmgT120I Hpy178III* | | |SetI | | Hpy178III* | Ecl136II | CviJI | AluI HgiJII* HgiAI* TaqI SacI SduI SetI I S G S K V K S L S S A Q S S S S G P S F L D R K S K V Y H L R N R A H Q D L H F W I E S Q K F I I C A I E L I R T F I ----:----|----:----|----:----|----:----|----:----|----:----| M E P D F T L L K D D A C D L E D P G E * K Q I S L * F N I M Q A I S S M L V K N R S R F D F T * * R R L R A * * S R * TfiI HinfI | AciI HindIII MnlI | |MboII | AluI MaeII | MaeI | ||FnuDII* | CviJI | SetI | Hin4II* | ||| FauI | | SetI | TaiI \ \ \ \\\ \ \ \ \ \ \ TCATCTAGTGAGGAAGATGATTCCCGCGATATTGAAAGCTTGGATAAGAAAATACGTCCT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGATCACTCCTTCTACTAAGGGCGCTATAACTTTCGAACCTATTCTTTTATGCAGGA / / / / / / / / / / / / | | MaeI | | | | | | HindIII | MaeII | Hin4II* | | | | | CviJI TaiI MnlI | | | | | AluI SetI | | | | SetI | | | FauI | | FnuDII* | | AciI | MboII HinfI TfiI S S S E E D D S R D I E S L D K K I R P H L V R K M I P A I L K A W I R K Y V L I * * G R * F P R Y * K L G * E N T S F ----:----|----:----|----:----|----:----|----:----|----:----| D D L S S S S E R S I S L K S L F I R G M M * H P L H N G R Y Q F S P Y S F V D * R T L F I I G A I N F A Q I L F Y T R MfeI BbvI TspEI MboII MseI TspEI MnlI MboII \ \ \ \ \ \ TTAGAAGAATTAGAAGCATTATTAAGTAGTGGAAATACAAAACAATTGAAGAACAAAGAG 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTTCTTAATCTTCGTAATAATTCATCACCTTTATGTTTTGTTAACTTCTTGTTTCTC / / / / / / // | MboII MseI | MnlI | |MboII TspEI TspEI | |TsoI MfeI | SetI BbvI L E E L E A L L S S G N T K Q L K N K E * K N * K H Y * V V E I Q N N * R T K R R R I R S I I K * W K Y K T I E E Q R G ----:----|----:----|----:----|----:----|----:----|----:----| K S S N S A N N L L P F V F C N F F L S K L L I L L M I L Y H F Y L V I S S C L * F F * F C * * T T S I C F L Q L V F L TsoI |SetI || TseI || |BisI || ||BlsI SetI || ||| StyI Tsp4CI* | Csp6I || ||| SecI* | MaeIII | |RsaI TspEI SetI \\ \\\ \ \ \ \ \\ \ \ GTCGCTGCCTTGGTTATTCACGGTAAGTTACCTTTGTACGCTTTGGAGAAAAAATTAGGT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCGACGGAACCAATAAGTGCCATTCAATGGAAACATGCGAAACCTCTTTTTTAATCCA /// / / / / // / ||TseI SecI* Tsp4CI* | | |Csp6I TspEI |BisI StyI | | RsaI SetI BlsI | MaeIII SetI V A A L V I H G K L P L Y A L E K K L G S L P W L F T V S Y L C T L W R K N * V R C L G Y S R * V T F V R F G E K I R * ----:----|----:----|----:----|----:----|----:----|----:----| T A A K T I * P L N G K Y A K S F F N P P R Q R P * E R Y T V K T R K P S F I L D S G Q N N V T L * R Q V S Q L F F * T AciI | Csp6I | |RsaI | ||MaeII | ||Hin4II* | |||BsaAI HphI | |||SnaBI AluI | AciI | |||| SetI CviJI | BsrBI | |||| TaiI CviJI TspEI | SetI \ \ \ \\\\ \ \ \ \ \ GATACTACGAGAGCGGTTGCGGTACGTAGGAAGGCTCTTTCAATTTTGGCAGAAGCTCCT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGATGCTCTCGCCAACGCCATGCATCCTTCCGAGAAAGTTAAAACCGTCTTCGAGGA / / / / //// / / / / | | AciI | |||MaeII CviJI TspEI | CviJI | BsrBI | ||SnaBI | AluI HphI | ||BsaAI SetI | |Csp6I | Hin4II* | RsaI | TaiI | SetI AciI D T T R A V A V R R K A L S I L A E A P I L R E R L R Y V G R L F Q F W Q K L L Y Y E S G C G T * E G S F N F G R S S C ----:----|----:----|----:----|----:----|----:----|----:----| S V V L A T A T R L F A R E I K A S A G H Y * S L P Q P V Y S P E K L K P L L E I S R S R N R Y T P L S K * N Q C F S R AciI McrI* MboI | FnuDII* Hpy188I | | MwoI | DpnI | | | Hin6I | |BstKTI | | | |GlaI | ||SfaNI | | | ||HhaI | ||| Hpy166II TspEI | | | |||HaeII \ \\\ \ \ \ \ \ \\\\ GTATTAGCATCTGATCGTTTACCATATAAAAATTATGACTACGACCGCGTATTTGGCGCT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CATAATCGTAGACTAGCAAATGGTATATTTTTAATACTGATGCTGGCGCATAAACCGCGA / // / // / / / / //// | || | |SfaNI TspEI | | MwoI |||Hin6I | || | Hpy166II | FnuDII* ||GlaI | || MboI | AciI |HhaI | |DpnI McrI* HaeII | BstKTI Hpy188I V L A S D R L P Y K N Y D Y D R V F G A Y * H L I V Y H I K I M T T T A Y L A L I S I * S F T I * K L * L R P R I W R L ----:----|----:----|----:----|----:----|----:----|----:----| T N A D S R K G Y L F * S * S R T N P A Q I L M Q D N V M Y F N H S R G R I Q R Y * C R I T * W I F I I V V V A Y K A S TsoI | AsuI* | DraII | |CviJI | |HaeIII | |BmgT120I MaeIII | ||NlaIV | SetI | ||| StyI | | FatI | ||| SecI* | | |CviAII | ||| | Hin4I | | || NspI | ||| | Hin4I | | || NlaIII | ||| | | BccI \ \ \\ \ \ \\\ \ \ \ TGTTGTGAAAATGTTATAGGTTACATGCCTTTGCCCGTTGGTGTTATAGGCCCCTTGGTT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| ACAACACTTTTACAATATCCAATGTACGGAAACGGGCAACCACAATATCCGGGGAACCAA / // // / /// / / SetI || |FatI TsoI ||| | BccI || CviAII ||| SecI* |MaeIII ||| StyI NlaIII ||DraII NspI ||AsuI* |BmgT120I |NlaIV HaeIII CviJI Hin4I Hin4I C C E N V I G Y M P L P V G V I G P L V V V K M L * V T C L C P L V L * A P W L L * K C Y R L H A F A R W C Y R P L G Y ----:----|----:----|----:----|----:----|----:----|----:----| Q Q S F T I P * M G K G T P T I P G K T K N H F H * L N C A K A R Q H * L G R P T T F I N Y T V H R Q G N T N Y A G Q N AluI TaqI Csp6I Hin4I MnlI CviJI ClaI |RsaI Hin4I | SfeI* | SetI \ \\ \ \ \ \ \ ATCGATGGTACATCTTATCATATACCAATGGCAACTACAGAGGGTTGTTTGGTAGCTTCT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTACCATGTAGAATAGTATATGGTTACCGTTGATGTCTCCCAACAAACCATCGAAGA / // / / / / / ClaI |Csp6I Hin4I MnlI SfeI* | CviJI TaqI RsaI Hin4I | AluI SetI I D G T S Y H I P M A T T E G C L V A S S M V H L I I Y Q W Q L Q R V V W * L L R W Y I L S Y T N G N Y R G L F G S F C ----:----|----:----|----:----|----:----|----:----|----:----| I S P V D * * I G I A V V S P Q K T A E * R H Y M K D Y V L P L * L P N N P L K D I T C R I M Y W H C S C L T T Q Y S R FatI MwoI Tsp4CI* |CviAII BstAPI | MseI || NlaIII | Cac8I | | BccI || | CviJI | | AciI CviRI* | | |DdeI \\ \ \ \ \ \ \ \ \ \\ GCCATGCGTGGCTGTAAGGCAATCAATGCTGGCGGTGGTGCAACAACTGTTTTAACTAAG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTACGCACCGACATTCCGTTAGTTACGACCGCCACCACGTTGTTGACAAAATTGATTC / // / / / / / / / / / | |FatI CviJI BstAPI | AciI CviRI* | | | DdeI | CviAII MwoI Cac8I | | BccI NlaIII | MseI Tsp4CI* A M R G C K A I N A G G G A T T V L T K P C V A V R Q S M L A V V Q Q L F * L R H A W L * G N Q C W R W C N N C F N * G ----:----|----:----|----:----|----:----|----:----|----:----| A M R P Q L A I L A P P P A V V T K V L Q W A H S Y P L * H Q R H H L L Q K L * G H T A T L C D I S A T T C C S N * S L BfiI MboI FokI BglII | AsuI* XhoII | TspGWI | DpnI | |CviJI | |BstKTI | |HaeIII | || HgiCI* BseGI | |BmgT120I | || | NlaIV |MnlI | || BsrI | || | | TsoI \\ \ \\ \ \ \\ \ \ \ GATGGTATGACAAGAGGCCCAGTAGTCCGTTTCCCAACTTTGAAAAGATCTGGTGCCTGT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCATACTGTTCTCCGGGTCATCAGGCAAAGGGTTGAAACTTTTCTAGACCACGGACA / / / / /// // / /// | MnlI | | ||AsuI* || | ||HgiCI* BseGI | | |BmgT120I || | |TsoI | | HaeIII || | NlaIV | | CviJI || XhoII | | FokI || BglII | | BsrI || MboI | TspGWI |DpnI BfiI BstKTI D G M T R G P V V R F P T L K R S G A C M V * Q E A Q * S V S Q L * K D L V P V W Y D K R P S S P F P N F E K I W C L * ----:----|----:----|----:----|----:----|----:----|----:----| S P I V L P G T T R K G V K F L D P A Q P H Y S L L G L L G N G L K S F I Q H R I T H C S A W Y D T E W S Q F S R T G T BspCNI HinfI |BseMII HindIII |Ksp632I* || MboII | AluI ||MnlI || | TspEI | CviJI MlyI ||DdeI || | | MseI | | SetI PleI ||| Hpy188I || | | BslFI | | | MseI \ \\\ \ \\ \ \ \ \ \ \ \ AAGATATGGTTAGACTCAGAAGAGGGACAAAACGCAATTAAAAAAGCTTTTAACTCTACA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTATACCAATCTGAGTCTTCTCCCTGTTTTGCGTTAATTTTTTCGAAAATTGAGATGT // / /// // / // / / / / / |PleI | ||DdeI || MboII || | | | | MseI MlyI | |Ksp632I* |BseMII || | | | HindIII | |Hpy188I BspCNI || | | CviJI | HinfI || | | AluI MnlI || | SetI || BslFI |MseI TspEI K I W L D S E E G Q N A I K K A F N S T R Y G * T Q K R D K T Q L K K L L T L H D M V R L R R G T K R N * K S F * L Y I ----:----|----:----|----:----|----:----|----:----|----:----| L I H N S E S S P C F A I L F A K L E V Y S I T L S L L P V F R L * F L K * S * L Y P * V * F L S L V C N F F S K V R C Hpy178III* | CviRI* FatI | | MaeII BspHI | | |BtrI |CviAII | | || SetI BplI |Hpy178III* | | || TaiI BplI MboII ||Ksp632I* | | || | CviRI* | MaeI TspDTI ||| NlaIII \ \ \\ \ \ \ \ \ \\\ \ TCAAGATTTGCACGTCTGCAACATATTCAAACTTGTCTAGCAGGAGATTTACTCTTCATG 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTCTAAACGTGCAGACGTTGTATAAGTTTGAACAGATCGTCCTCTAAATGAGAAGTAC / // // / / / // / // | || || CviRI* BplI | |MboII | |BspHI | || |MaeII BplI | TspDTI | |FatI | || BtrI MaeI | Hpy178III* | |TaiI | CviAII | |SetI NlaIII | CviRI* Hpy178III* S R F A R L Q H I Q T C L A G D L L F M Q D L H V C N I F K L V * Q E I Y S S * K I C T S A T Y S N L S S R R F T L H E ----:----|----:----|----:----|----:----|----:----|----:----| D L N A R R C C I * V Q R A P S K S K M M L I Q V D A V Y E F K D L L L N V R * * S K C T Q L M N L S T * C S I * E E H MaeIII HgaI TspDTI BplI Tsp45I HphI | SetI BplI | BsrI |BsrDI | | TaqI \ \ \ \\ \ \ \ AGATTTAGAACAACTACTGGTGACGCAATGGGTATGAATATGATTTCTAAAGGTGTCGAA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAAATCTTGTTGATGACCACTGCGTTACCCATACTTATACTAAAGATTTCCACAGCTT // / / / / / / / |BplI BsrI | BsrDI HgaI | SetI TaqI |BplI | HphI TspDTI Ksp632I* Tsp45I MaeIII R F R T T T G D A M G M N M I S K G V E D L E Q L L V T Q W V * I * F L K V S N I * N N Y W * R N G Y E Y D F * R C R I ----:----|----:----|----:----|----:----|----:----|----:----| L N L V V V P S A I P I F I I E L P T S S I * F L * Q H R L P Y S Y S K * L H R S K S C S S T V C H T H I H N R F T D F BseYI CviJI | MboII | | GsaI | | |BplI TspGWI | | |BplI | MboII BaeI MseI Ksp632I* | | || MnlI | |SetI BsmAI \ \ \ \ \\ \ \ \\ \ TACTCATTAAAGCAAATGGTAGAAGAGTATGGCTGGGAAGATATGGAGGTTGTCTCCGTT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAGTAATTTCGTTTACCATCTTCTCATACCGACCCTTCTATACCTCCAACAGAGGCAA / / // / / / / / / MseI Ksp632I* || | MnlI | | | BaeI || BseYI | | MboII |MboII | SetI CviJI TspGWI GsaI BplI BplI Y S L K Q M V E E Y G W E D M E V V S V T H * S K W * K S M A G K I W R L S P F L I K A N G R R V W L G R Y G G C L R F ----:----|----:----|----:----|----:----|----:----|----:----| Y E N F C I T S S Y P Q S S I S T T E T I S M L A F P L L T H S P L Y P P Q R R V * * L L H Y F L I A P F I H L N D G N BaeI |TseI |AluI |CviJI |PvuII |NspBII* ||BisI |||BlsI |||SetI |||| Hin4I |||| Hin4I |||| | PflMI |||| | BsiYI* |||| | | BccI |||| | | Hin4II* MaeIII |||| | | |MboI | BplI |||| | | || DpnI | BplI |||| | | || BsrI | | Tsp4CI* |||| | | || |TaqI | | |Csp6I |||| | | || |BstKTI | | ||RsaI |||| | | || || BinI* | | ||| BbvI |||| | | || || | SetI \ \ \\\ \ \\\\ \ \ \\ \\ \ \ TCTGGTAACTACTGTACCGACAAAAAACCAGCTGCCATCAACTGGATCGAAGGTCGTGGT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| AGACCATTGATGACATGGCTGTTTTTTGGTCGACGGTAGTTGACCTAGCTTCCAGCACCA / / / / // / / / //// / / /// /// / | BplI | | |Csp6I | | | |||| | | ||| ||| BinI* | BplI | | RsaI | | | |||| | | ||| ||SetI BsmAI | Tsp4CI* | | | |||| | | ||| |TaqI MaeIII | | | |||| | | ||| MboI | | | |||| | | ||DpnI | | | |||| | | |BstKTI | | | |||| | | BccI | | | |||| | | BsrI | | | |||| | Hin4II* | | | |||| BsiYI* | | | |||| PflMI | | | |||TseI | | | ||BisI | | | |BlsI | | | NspBII* | | | PvuII | | | CviJI | | | Hin4I | | | Hin4I | | | AluI | | SetI | BaeI BbvI S G N Y C T D K K P A A I N W I E G R G L V T T V P T K N Q L P S T G S K V V V W * L L Y R Q K T S C H Q L D R R S W * ----:----|----:----|----:----|----:----|----:----|----:----| E P L * Q V S L F G A A M L Q I S P R P K Q Y S S Y R C F V L Q W * S S R L D H R T V V T G V F F W S G D V P D F T T T Hin4I Hin4I | Hpy99I BssKI | | AluI EcoRII | | CviJI | ScrFI HphI | | | SetI | BseBI Hpy188I MseI \ \ \ \ \ \ \ \ AAGAGTGTCGTCGCAGAAGCTACTATTCCTGGTGATGTTGTCAGAAAAGTGTTAAAAAGT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTCACAGCAGCGTCTTCGATGATAAGGACCACTACAACAGTCTTTTCACAATTTTTCA / / / / / / / / | Hpy99I | CviJI | EcoRII Hpy188I MseI Hin4I | AluI | BssKI HphI Hin4I SetI BseBI ScrFI K S V V A E A T I P G D V V R K V L K S R V S S Q K L L F L V M L S E K C * K V E C R R R S Y Y S W * C C Q K S V K K * ----:----|----:----|----:----|----:----|----:----|----:----| L L T T A S A V I G P S T T L F T N F L Y S H R R L L * * E Q H H Q * F L T L F L T D D C F S S N R T I N D S F H * F T MboI XhoII | DpnI | |BstKTI | || CviRI* | || | BinI* DdeI | || | | BseYI MmeI | ApoI | || | | CviJI AciI | BsrDI | TspEI | || | | |BsrDI \ \ \ \ \ \ \\ \ \ \\ GATGTTTCCGCATTGGTTGAGTTGAACATTGCTAAGAATTTGGTTGGATCTGCAATGGCT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CTACAAAGGCGTAACCAACTCAACTTGTAACGATTCTTAAACCAACCTAGACGTTACCGA / / / / / // / / / // AciI | BsrDI DdeI TspEI || | | | |CviJI MmeI ApoI || | | | |GsaI || | | | BsrDI || | | BinI* || | CviRI* || XhoII || MboI |DpnI BstKTI D V S A L V E L N I A K N L V G S A M A M F P H W L S * T L L R I W L D L Q W L C F R I G * V E H C * E F G W I C N G W ----:----|----:----|----:----|----:----|----:----|----:----| S T E A N T S N F M A L F K T P D A I A H H K R M P Q T S C Q * S N P Q I Q L P I N G C Q N L Q V N S L I Q N S R C H S FatI |CviAII || TseI || NspI || MwoI || CviRI* || NlaIII || |BisI || ||BlsI AluI || |||AluI CviJI || |||CviJI MaeIII PvuII || |||| SetI Tsp45I NspBII* GsaI MseI || |||| TspEI |BbvI | SetI BsgI \ \ \\ \\\\ \ \\ \ \ \ GGGTCTGTTGGTGGATTTAACGCACATGCAGCTAATTTAGTGACAGCTGTTTTCTTGGCA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| CCCAGACAACCACCTAAATTGCGTGTACGTCGATTAAATCACTGTCGACAAAAGAACCGT / / // ///// / / / / BseYI MseI || ||||CviJI TspEI | NspBII* BsgI || ||||TseI | PvuII || ||||AluI | CviJI || |||BisI | AluI || ||BlsI Tsp45I || ||SetI MaeIII || |CviRI* BbvI || |FatI SetI || CviAII |MwoI NlaIII NspI G S V G G F N A H A A N L V T A V F L A G L L V D L T H M Q L I * * Q L F S W H V C W W I * R T C S * F S D S C F L G I ----:----|----:----|----:----|----:----|----:----|----:----| P D T P P N L A C A A L K T V A T K K A Q T Q Q H I * R V H L * N L S L Q K R P P R N T S K V C M C S I * H C S N E Q C BinI* | MboI | XhoII | | DpnI | | |BstKTI | | || CviRI* Tsp4CI* MmeI \ \ \\ \ \ \ TTAGGACAAGATCCTGCACAAAATGTTGAAAGTTCCAACTGTATAACATTGATGAAAGAA 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| AATCCTGTTCTAGGACGTGTTTTACAACTTTCAAGGTTGACATATTGTAACTACTTTCTT / // / / / / | || | CviRI* Tsp4CI* MmeI | || XhoII | || MboI | |DpnI | BstKTI BinI* L G Q D P A Q N V E S S N C I T L M K E * D K I L H K M L K V P T V * H * * K K R T R S C T K C * K F Q L Y N I D E R S ----:----|----:----|----:----|----:----|----:----|----:----| N P C S G A C F T S L E L Q I V N I F S M L V L D Q V F H Q F N W S Y L M S S L * S L I R C L I N F T G V T Y C Q H F F FatI |CviAII || NlaIII || |BseGI || || BciVI || || | TaqI || || | |BccI Hpy166II || || | || BccI | TspDTI || || | || | Acc65I | Tsp4CI* || || | || | HgiCI* | | TspGWI || || | || | |Csp6I | | | ApoI || || | || | ||RsaI | | | TspEI || || | || | ||SetI | | | | HphI || || | || | ||NlaIV | | | | | FokI || || | || | ||| KpnI \ \ \ \ \ \ \\ \\ \ \\ \ \\\ \ GTGGACGGTGATTTGAGAATTTCCGTATCCATGCCATCCATCGAAGTAGGTACCATCGGT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTGCCACTAAACTCTTAAAGGCATAGGTACGGTAGGTAGCTTCATCCATGGTAGCCA / // / / / / / // / / / / /// | || TspGWI | | | | || BciVI | | | ||HgiCI* | |Tsp4CI* | | | | |FatI | | | ||Acc65I | TspDTI | | | | CviAII | | | |Csp6I Hpy166II | | | | BseGI | | | NlaIV | | | NlaIII | | | RsaI | | FokI | | KpnI | TspEI | BccI | ApoI | SetI HphI BccI TaqI V D G D L R I S V S M P S I E V G T I G W T V I * E F P Y P C H P S K * V P S V G R * F E N F R I H A I H R S R Y H R W ----:----|----:----|----:----|----:----|----:----|----:----| T S P S K L I E T D M G D M S T P V M P L P R H N S F K R I W A M W R L L Y W R H V T I Q S N G Y G H W G D F Y T G D T BccI | Csp6I HgiCI* AsuI* | |RsaI DraIII |CviJI | || Tsp4CI* | SetI |HaeIII | || | XbaI | NlaIV |BmgT120I | || | |MaeI | | FatI || AciI | || | |Hpy178III* | | |CviAII MnlI || Cac8I | || | ||MmeI | | || NlaIII | SetI || | FatI \ \\ \ \\\ \ \ \\ \ \ \ \\ \ \ GGTGGTACTGTTCTAGAACCACAAGGTGCCATGTTGGACTTATTAGGTGTAAGAGGCCCG 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCATGACAAGATCTTGGTGTTCCACGGTACAACCTGAATAATCCACATTCTCCGGGC / /// / // // / / // // /// / | ||| | |XbaI || | | |FatI |MnlI ||| NlaIII | ||| | | || | | CviAII SetI ||| AciI | ||| | | || | HgiCI* ||| NspI | ||| | | || | NlaIII ||| SphI | ||| | | || NlaIV ||AsuI* | ||| | | |SetI ||Cac8I | ||| | | DraIII |BmgT120I | ||| | Hpy178III* HaeIII | ||| | MaeI CviJI | ||| MmeI | ||Tsp4CI* | |Csp6I | RsaI BccI G G T V L E P Q G A M L D L L G V R G P V V L F * N H K V P C W T Y * V * E A R W Y C S R T T R C H V G L I R C K R P A ----:----|----:----|----:----|----:----|----:----|----:----| P P V T R S G C P A M N S K N P T L P G H H Y Q E L V V L H W T P S I L H L L G T T S N * F W L T G H Q V * * T Y S A R CviAII |Cac8I || SphI || NspI || NlaIII || |FauI || || AciI || || | BsrBI || || | | BssKI || || | | EcoRII || || | | | ScrFI || || | | | BseBI || || | | | | Acc65I || || | | | | HgiCI* MaeII || || | | | | |Csp6I |BtrI || || | | | | ||RsaI || SetI || || | | | | ||NlaIV || TaiI AarI || || | | | | ||| KpnI || |TspEI BceAI BspMI \\ \\ \ \ \ \ \\\ \ \\ \\ \ \ CATGCTACCGCTCCTGGTACCAACGCACGTCAATTAGCAAGAATAGTTGCCTGTGCCGTC 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| GTACGATGGCGAGGACCATGGTTGCGTGCAGTTAATCGTTCTTATCAACGGACACGGCAG /// / / ////// / // / / // ||| | | |||||| | |MaeII TspEI BceAI |BspMI ||| | | |||||| | BtrI |AarI ||| | | |||||| TaiI MwoI ||| | | |||||| SetI BglI ||| | | |||||HgiCI* ||| | | |||||Acc65I ||| | | ||||Csp6I ||| | | |||NlaIV ||| | | |||RsaI ||| | | ||EcoRII ||| | | ||BssKI ||| | | |KpnI ||| | | BseBI ||| | | ScrFI ||| | BsrBI ||| | AciI ||| FauI ||FatI |CviAII Cac8I H A T A P G T N A R Q L A R I V A C A V M L P L L V P T H V N * Q E * L P V P S C Y R S W Y Q R T S I S K N S C L C R L ----:----|----:----|----:----|----:----|----:----|----:----| C A V A G P V L A R * N A L I T A Q A T A H * R E Q Y W R V D I L L F L Q R H R M S G S R T G V C T L * C S Y N G T G D TseI |BisI ||BlsI ||| MaeI ||| MwoI ||| | TseI ||| | MwoI ||| | |BisI ||| | ||BlsI ||| | |||MroNI ||| | |||CviJI ||| | |||Cfr10I ||| | ||||HpaII ||| | |||||CfrI ||| | |||||NaeI ||| | |||||Cac8I SetI ||| | |||||| CviJI BglI |TspEI ||| | |||||| HaeIII EcoP15I MwoI || BbvI HphI ||| | |||||| | BbvI | NdeI \ \\ \ \ \\\ \ \\\\\\ \ \ \ \ TTGGCAGGTGAATTATCCTTATGTGCTGCCCTAGCAGCCGGCCATTTGGTTCAAAGTCAT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGTCCACTTAATAGGAATACACGACGGGATCGTCGGCCGGTAAACCAAGTTTCAGTA / / / / /// / / /// /// / / / SetI | | HphI ||| | | ||| ||| CfrI | EcoP15I | BbvI ||| | | ||| ||Cfr10I BbvI TspEI ||| | | ||| ||HaeIII ||| | | ||| ||MroNI ||| | | ||| ||CviJI ||| | | ||| |HpaII ||| | | ||| Cac8I ||| | | ||| NaeI ||| | | ||CviJI ||| | | ||TseI ||| | | |BisI ||| | | BlsI ||| | MaeI ||| MwoI ||MwoI ||TseI |BisI BlsI L A G E L S L C A A L A A G H L V Q S H W Q V N Y P Y V L P * Q P A I W F K V I G R * I I L M C C P S S R P F G S K S Y ----:----|----:----|----:----|----:----|----:----|----:----| K A P S N D K H A A R A A P W K T * L * R P L H I I R I H Q G L L R G N P E F D Q C T F * G * T S G * C G A M Q N L T M SetI HgaI BsiYI* SetI BspMI | TspEI AcyI | TspRI \ \ \ \ \ \ \ \ ATGACCCACAACAGGAAACCTGCTGAACCAACAAAACCTAACAATTTGGACGCCACTGAT 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGGGTGTTGTCCTTTGGACGACTTGGTTGTTTTGGATTGTTAAACCTGCGGTGACTA / / / / / / // NdeI BsiYI* SetI | SetI | |AcyI BspMI | TspRI TspEI M T H N R K P A E P T K P N N L D A T D * P T T G N L L N Q Q N L T I W T P L I D P Q Q E T C * T N K T * Q F G R H * Y ----:----|----:----|----:----|----:----|----:----|----:----| I V W L L F G A S G V F G L L K S A V S Y S G C C S V Q Q V L L V * C N P R W Q H G V V P F R S F W C F R V I Q V G S I BccI | TspGWI | | HphI | | | AsuI* | | | AvaII SetI | | | |NlaIV |CviRI* | | | |BmgT120I || MseI | | | || MaeIII || | AarI BsaBI | | | || Tsp45I || | BspMI \ \ \ \ \\ \ \\ \ \ ATAAATCGTTTGAAAGATGGGTCCGTCACCTGCATTAAATCCTAA 3130 3140 3150 3160 ----:----|----:----|----:----|----:----|----: TATTTAGCAAACTTTCTACCCAGGCAGTGGACGTAATTTAGGATT // // / /// / / / / / |HgaI |BccI | ||| | | | | BspMI BsaBI TspGWI | ||| | | | | AarI | ||| | | | MseI | ||| | | CviRI* | ||| | Tsp45I | ||| | MaeIII | ||| SetI | ||AvaII | ||AsuI* | |BmgT120I | NlaIV HphI I N R L K D G S V T C I K S * * I V * K M G P S P A L N P X K S F E R W V R H L H * I L X ----:----|----:----|----:----|----:----|----: I F R K F S P D T V Q M L D * Y L D N S L H T R * R C * I R Y I T Q F I P G D G A N F G L # Enzymes that cut Frequency Isoschizomers AarI 2 AatII 1 Acc65I 2 Asp718I AciI 14 BspACI,SsiI AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AhaIII* 1 DraI AluI 12 AluBI ApoI 6 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BbvI 6 BseXI,BstV1I,Lsp1109I BbvII* 4 BpiI,BpuAI,BstV2I,BbsI BccI 11 BceAI 1 BciVI 1 BfuI BfiI 2 BmrI,BmuI BglI 1 BglII 3 BinI* 4 AlwI,BspPI,AclWI BisI 8 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 8 BmgT120I 5 BplI 4 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 3 BseYI 2 BsgI 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 3 BspHI 2 CciI,PagI,RcaI BspMI 3 BfuAI,Acc36I,BveI BsrBI 2 AccBSI,MbiI BsrDI 3 BseMI,Bse3DI BsrI 7 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstAPI 1 BstKTI 8 BtrI 2 BmgBI,AjiI BtsI 1 Cac8I 5 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 9 CviQI,RsaNI CviAII 10 CviJI 25 CviKI-1 CviRI* 13 HpyCH4V DdeI 9 BstDEI,HpyF3I DpnI 8 MalI DraII 2 EcoO109I DraIII 1 AdeI EciI 1 Ecl136II 1 EcoICRI Eco47III 1 Aor51HI,AfeI Eco57I 1 AcuI Eco57MI 2 EcoP15I 1 EcoRI 1 EcoRII 3 AjnI,Psp6I,PspGI FatI 10 FauI 2 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 5 GsaI 2 GsuI 1 BpmI HaeII 3 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 4 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 5 BstHHI,CfoI,AspLEI Hin4I 7 Hin4II* 5 HpyAV Hin6I 5 HinP1I,HspAI HindIII 2 HinfI 10 HpaII 2 HapII,BsiSI,MspI HphI 12 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 13 Hpy188III Hpy188I 6 Hpy99I 2 KpnI 2 Ksp632I* 5 Eam1104I,EarI,Bst6I MaeI 10 FspBI,BfaI,XspI MaeII 8 HpyCH4IV MaeIII 13 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 18 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 4 MunI MlyI 4 SchI MmeI 4 MnlI 16 MroNI 1 NgoMIV MseI 16 Tru1I,Tru9I MslI 2 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 9 HpyF10VI,BstMWI NaeI 1 PdiI NdeI 1 FauNDI NlaIII 10 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 3 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 4 PpsI PpuMI 1 Psp5II,PspPPI PsiI 1 AanI PstI 1 PvuII 2 RsaI 9 AfaI SacI 1 Psp124BI,SstI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 41 SfaNI 4 LweI SfeI* 5 BstSFI,SfcI,BfmI SnaBI 1 Eco105I,BstSNI SphI 1 PaeI,BbuI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 8 TaqI 9 TaqII 1 TatI 2 TauI 2 TfiI 6 PfeI TseI 6 ApeKI TsoI 5 Tsp45I 7 NmuCI Tsp4CI* 11 HpyCH4III,TaaI,Bst4CI TspDTI 14 TspEI 26 TasI,Tsp509I,Sse9I TspGWI 7 TspRI 6 TscAI Tth111I 1 PflFI,PsyI,AspI XbaI 2 XhoII 5 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AbsI AccI AclI AflII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvaI AvrII BalI BamHI BarI BbvCI Bce83I* BcgI BclI BdaI BetI* BmeT110I BmtI Bpu10I BsaXI BsePI BseRI BseSI BsiI* Bsp120I BspLU11I* BspMII* BspOI BssNAI Bst1107I BstEII BstXI BstZ17I BtgZI Cfr9I CspCI DinI DrdI DsaI* Eam1105I Eco31I EcoNI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FseI FspAI HindII HpaI KasI MauBI MluI Mph1103I NarI NcoI NheI NmeAIII NotI NruI NsiI OliI PacI PasI PfoI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PvuI RsrII SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SpeI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TspMI TstI VspI XcmI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769