Restriction Map of ORC1/YML065W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ORC1/YML065W on chromosome XIII from coordinates 142210 to 144954.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.3567

Hin4II* |AclI |MaeII || SetI || TaiI \\ \ ATGGCAAAAACGTTGAAGGATTTACAGGGTTGGGAGATAATAACAACTGATGAGCAGGGA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGTTTTTGCAACTTCCTAAATGTCCCAACCCTCTATTATTGTTGACTACTCGTCCCT // / || MaeII || AclI |TaiI |SetI Hin4II* M A K T L K D L Q G W E I I T T D E Q G W Q K R * R I Y R V G R * * Q L M S R E G K N V E G F T G L G D N N N * * A G K ----:----|----:----|----:----|----:----|----:----|----:----| X A F V N F S K C P Q S I I V V S S C P X P L F T S P N V P N P S L L L Q H A P H C F R Q L I * L T P L Y Y C S I L L S BccI | MnlI Ksp632I* Ksp632I* SetI | |TaqI | SetI |MnlI |CviRI* | |ClaI | | Hpy188I || MboII || MboII \ \\ \ \ \ \\ \ \\ \ AATATAATCGATGGAGGTCAGAAGAGATTACGCCGAAGAGGTGCAAAAACTGAACATTAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTATATTAGCTACCTCCAGTCTTCTCTAATGCGGCTTCTCCACGTTTTTGACTTGTAATG // / / / / // / / / || | SetI Ksp632I* | || SetI | MboII || ClaI Hpy188I | |Ksp632I* CviRI* || TaqI | MboII |MnlI MnlI BccI N I I D G G Q K R L R R R G A K T E H Y I * S M E V R R D Y A E E V Q K L N I T Y N R W R S E E I T P K R C K N * T L L ----:----|----:----|----:----|----:----|----:----|----:----| F I I S P P * F L N R R L P A F V S C * F Y L R H L D S S I V G F L H L F Q V N I Y D I S T L L S * A S S T C F S F M V HphI |FatI Hpy188I ||CviAII | TspEI ||| CviRI* MseI BccI | | MseI MaeI SetI ||| NlaIII \ \ \ \ \ \ \ \\\ \ TTAAAGAGAAGTTCTGATGGAATTAAACTAGGTCGTGGTGATAGTGTAGTCATGCACAAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTCTCTTCAAGACTACCTTAATTTGATCCAGCACCACTATCACATCAGTACGTGTTG / / / // // / / // MseI | Hpy188I || |MaeI | | |CviRI* BccI || SetI | | |FatI |MseI | | CviAII TspEI | NlaIII HphI L K R S S D G I K L G R G D S V V M H N * R E V L M E L N * V V V I V * S C T T K E K F * W N * T R S W * * C S H A Q R ----:----|----:----|----:----|----:----|----:----|----:----| K F L L E S P I L S P R P S L T T M C L S L S F N Q H F * V L D H H Y H L * A C * L S T R I S N F * T T T I T Y D H V V BinI* BslFI CviJI | MboI |AciI | | DpnI |BisI | | |PfoI ||BlsI | | |BssKI |||TauI | | |EcoRII |||BseYI | | |BstKTI |||NspBII* | | || ScrFI |||| TspGWI | | || BseBI |||| | GsaI | | || | BsmAI MseI MseI \\\\ \ \ \ \ \\ \ \ \ \ GAAGCCGCTGGGACTTACTCCGTTTATATGATCCAGGAGTTGAGACTTAATACATTAAAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGGCGACCCTGAATGAGGCAAATATACTAGGTCCTCAACTCTGAATTATGTAATTTA //// / / / // / / / / / / |||| BseYI | | || | | | BsmAI MseI MseI |||NspBII* | | || | | EcoRII |||TspGWI | | || | | BssKI |||AciI | | || | | PfoI |||GsaI | | || | BseBI ||BisI | | || | ScrFI |BlsI | | || MboI CviJI | | |DpnI TauI | | BstKTI | BslFI BinI* E A A G T Y S V Y M I Q E L R L N T L N K P L G L T P F I * S R S * D L I H * I S R W D L L R L Y D P G V E T * Y I K * ----:----|----:----|----:----|----:----|----:----|----:----| S A A P V * E T * I I W S N L S L V N F R L R Q S K S R K Y S G P T S V * Y M L F G S P S V G N I H D L L Q S K I C * I HphI | CviJI | | SduI | | HgiJII* AluI | | | SetI CviJI TaqI | | | |BccI | SetI \ \ \ \ \\ \ \ AATGTTGTCGAACTCTGGGCTCTCACCTATTTACGATGGTTTGAAGTCAATCCTTTAGCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAACAGCTTGAGACCCGAGAGTGGATAAATGCTACCAAACTTCAGTTAGGAAATCGA / / / / / / / / | | | | SetI BccI | CviJI | | | CviJI | AluI | | HgiJII* SetI | | SduI | HphI TaqI N V V E L W A L T Y L R W F E V N P L A M L S N S G L S P I Y D G L K S I L * L C C R T L G S H L F T M V * S Q S F S S ----:----|----:----|----:----|----:----|----:----|----:----| L T T S S Q A R V * K R H N S T L G K A Y H Q R V R P E * R N V I T Q L * D K L I N D F E P S E G I * S P K F D I R * S MseI TfiI |AhaIII* MseI Hpy178III* HgaI HinfI ||TspEI \ \ \ \ \\\ CATTATAGGCAGTTTAATCCTGACGCTAACATTTTGAATCGTCCTTTAAATTATTACAAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTAATATCCGTCAAATTAGGACTGCGATTGTAAAACTTAGCAGGAAATTTAATAATGTTA / / / / // / MseI Hpy178III* | HinfI || TspEI | TfiI |MseI HgaI AhaIII* H Y R Q F N P D A N I L N R P L N Y Y N I I G S L I L T L T F * I V L * I I T I L * A V * S * R * H F E S S F K L L Q * ----:----|----:----|----:----|----:----|----:----|----:----| * * L C N L G S A L M K F R G K F * * L E N Y A T * D Q R * C K S D D K L N N C M I P L K I R V S V N Q I T R * I I V I Tsp4CI* | BtsI | | SfeI* | | TspDTI | | | CviRI* | | | | PstI | | | | TspRI | | | | |TspEI Tsp4CI* | | | | || MwoI | Hpy188I | | | | || | PpiI | | CviRI* | | | | || | CviJI | | | PpiI | | | | || | | TspEI \ \ \ \ \ \ \ \ \\ \ \ \ AAACTGTTTTCTGAAACTGCAAATAAAAATGAACTGTATCTCACTGCAGAATTAGCCGAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGACAAAAGACTTTGACGTTTATTTTTACTTGACATAGAGTGACGTCTTAATCGGCTT / / // / / / / / /// / / | | |CviRI* | | | | | ||| | CviJI | | PpiI | | | | | ||| TspEI | Hpy188I | | | | | ||PpiI Tsp4CI* | | | | | |MwoI | | | | | SfeI* | | | | CviRI* | | | PstI | | TspDTI | TspRI | BtsI Tsp4CI* K L F S E T A N K N E L Y L T A E L A E N C F L K L Q I K M N C I S L Q N * P N T V F * N C K * K * T V S H C R I S R I ----:----|----:----|----:----|----:----|----:----|----:----| L S N E S V A F L F S S Y R V A S N A S Y V T K Q F Q L Y F H V T D * Q L I L R F Q K R F S C I F I F Q I E S C F * G F TseI CviRI* |BisI ||BlsI |||AluI MaeII |||CviJI | BccI |||| SetI | |SetI |||| | MseI | |TaiI |||| | | BbvI | ||BstXI BseGI FokI \\\\ \ \ \ \ \\\ \ \ TTGCAGCTATTTAACTTTATCAGGGTTGCCAACGTAATGGATGGAAGCAAATGGGAAGTA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTCGATAAATTGAAATAGTCCCAACGGTTGCATTACCTACCTTCGTTTACCCTTCAT ///// / / // // / / ||||CviJI MseI BbvI || |BccI BseGI FokI ||||TseI || MaeII ||||AluI |BstXI |||BisI TaiI ||BlsI SetI ||SetI |CviRI* TspEI L Q L F N F I R V A N V M D G S K W E V C S Y L T L S G L P T * W M E A N G K Y A A I * L Y Q G C Q R N G W K Q M G S I ----:----|----:----|----:----|----:----|----:----|----:----| N C S N L K I L T A L T I S P L L H S T I A A I * S * * P Q W R L P H F C I P L Q L * K V K D P N G V Y H I S A F P F Y BinI* | TaqI | |MboI | || DpnI | || |BstKTI | || ||Hpy178III* | || |||BsmAI Tsp4CI* CviJI \ \\ \\\\ \ \ TTGAAAGGAAATGTCGATCCAGAAAGAGACTTTACAGTTCGTTATATTTGTGAGCCGACT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTTCCTTTACAGCTAGGTCTTTCTCTGAAATGTCAAGCAATATAAACACTCGGCTGA / // / / / / / | || | | BsmAI Tsp4CI* CviJI | || | Hpy178III* | || MboI | |DpnI | BstKTI | TaqI BinI* L K G N V D P E R D F T V R Y I C E P T * K E M S I Q K E T L Q F V I F V S R L E R K C R S R K R L Y S S L Y L * A D W ----:----|----:----|----:----|----:----|----:----|----:----| N F P F T S G S L S K V T R * I Q S G V I S L F H R D L F L S * L E N Y K H A S Q F S I D I W F S V K C N T I N T L R S BseGI Hpy166II | HindIII BsrI | MseI | | AluI | ApoI | VspI | | CviJI | TspEI | |MnlI | | | SetI NlaIV | |BfiI | || SspI | | | |FokI |CviJI \ \\ \ \\ \ \ \ \ \\ \\ GGGGAGAAATTTGTGGACATTAATATTGAGGATGTCAAAGCTTACATAAAGAAAGTGGAG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCCCTCTTTAAACACCTGTAATTATAACTCCTACAGTTTCGAATGTATTTCTTTCACCTC / / / / / / / / / / / / // BsrI | | | | | SspI | | | | FokI |CviJI | | | | VspI | | | HindIII NlaIV | | | | MseI | | CviJI | | | MnlI | | AluI | | Hpy166II | SetI | TspEI BseGI | ApoI BfiI G E K F V D I N I E D V K A Y I K K V E G R N L W T L I L R M S K L T * R K W S G E I C G H * Y * G C Q S L H K E S G A ----:----|----:----|----:----|----:----|----:----|----:----| P S F N T S M L I S S T L A * M F F T S Q P S I Q P C * Y Q P H * L K C L S L P P L F K H V N I N L I D F S V Y L F H L CviJI |BssKI MboI |SecI* | MnlI |EcoRII | DpnI StyI || ScrFI | |BstKTI SecI* || BseBI SspI MseI BccI | ||MboII \ \\ \ \ \ \ \ \\\ CCAAGGGAAGCCCAGGAATATTTGAAAGATTTAACACTTCCATCAAAGAAGAAAGAGATC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTCCCTTCGGGTCCTTATAAACTTTCTAAATTGTGAAGGTAGTTTCTTCTTTCTCTAG / / /// / / / //// | | ||| SspI MseI BccI |||MboI | | ||EcoRII ||MboII | | ||BssKI |DpnI | | |SecI* BstKTI | | BseBI MnlI | | ScrFI | CviJI SecI* StyI P R E A Q E Y L K D L T L P S K K K E I Q G K P R N I * K I * H F H Q R R K R S K G S P G I F E R F N T S I K E E R D Q ----:----|----:----|----:----|----:----|----:----|----:----| G L S A W S Y K F S K V S G D F F F S I A L P L G P I N S L N L V E M L S S L S W P F G L F I Q F I * C K W * L L F L D AsuI* AvaII DraII PpuMI |BmgT120I ApoI Hpy188I ||SetI MnlI CviJI TspEI | BceAI \\\ \ \ \ \ \ AAAAGAGGTCCTCAAAAGAAAGATAAGGCTACTCAAACGGCACAAATTTCAGACGCAGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCTCCAGGAGTTTTCTTTCTATTCCGATGAGTTTGCCGTGTTTAAAGTCTGCGTCTT / // / / / / / | |PpuMI MnlI CviJI | | BceAI | |DraII | Hpy188I | |AvaII TspEI | |AsuI* ApoI | BmgT120I SetI K R G P Q K K D K A T Q T A Q I S D A E K E V L K R K I R L L K R H K F Q T Q K K R S S K E R * G Y S N G T N F R R R N ----:----|----:----|----:----|----:----|----:----|----:----| L L P G * F F S L A V * V A C I E S A S * F L D E F S L Y P * E F P V F K L R L F S T R L L F I L S S L R C L N * V C F MboII AluI Hin4I |TspDTI CviJI Hin4I ||Hpy188I |SfeI* TspGWI TfiI ||| TspGWI HgaI ||SetI MnlI Tsp4CI* HinfI ||| | TspDTI \ \\\ \ \ \ \\\ \ \ ACAAGAGCTACAGATATAACGGATAATGAGGACGGTAATGAAGATGAATCATCTGATTAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTCTCGATGTCTATATTGCCTATTACTCCTGCCATTACTTCTACTTAGTAGACTAATA /// / / / // / / // / ||| SfeI* MnlI | |Tsp4CI* | | || TspDTI ||CviJI | TspGWI | | |TspGWI ||AluI Hin4I | | Hpy188I |HgaI Hin4I | TspDTI SetI | MboII HinfI TfiI T R A T D I T D N E D G N E D E S S D Y Q E L Q I * R I M R T V M K M N H L I M K S Y R Y N G * * G R * * R * I I * L * ----:----|----:----|----:----|----:----|----:----|----:----| V L A V S I V S L S S P L S S S D D S * F L L * L Y L P Y H P R Y H L H I M Q N C S S C I Y R I I L V T I F I F * R I I Hpy188I | TspDTI | |EcoRV | || TaqI | || | MaeII | || | |MnlI | || | ||Hpy99I Hin4I | || | |||SetI AciI AciI Hin4I | || | |||TaiI NspBII* | HphI MnlI \ \ \\ \ \\\\ \ \ \ \ GAAAGTCCGTCAGATATCGACGTTAGCGAGGATATGGACAGCGGTGAAATATCCGCAGAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCAGGCAGTCTATAGCTGCAATCGCTCCTATACCTGTCGCCACTTTATAGGCGTCTA / // / / // / / / // / Hin4I || | | || MaeII | AciI || MnlI Hin4I || | | |MnlI NspBII* |AciI || | | TaqI HphI || | | TaiI || | | SetI || | Hpy99I || EcoRV |TspDTI Hpy188I E S P S D I D V S E D M D S G E I S A D K V R Q I S T L A R I W T A V K Y P Q M K S V R Y R R * R G Y G Q R * N I R R * ----:----|----:----|----:----|----:----|----:----|----:----| S L G D S I S T L S S I S L P S I D A S H F D T L Y R R * R P Y P C R H F I R L F T R * I D V N A L I H V A T F Y G C I MboII |BbvII* MboII MboII || MboII | AluI AluI |BbvII* || |Ksp632I* | CviJI CviJI || MboII || || MboII | MboII |SmlI || Bce83I* || || |BbvII* | |MaeI ||SetI || | MboII || || || MboII | ||SetI \\\ \\ \ \ \\ \\ \\ \ \ \\\ GAGCTTGAGGAAGAAGAAGACGAAGAAGAAGACGAAGACGAAGAAGAGAAAGAAGCTAGG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGAACTCCTTCTTCTTCTGCTTCTTCTTCTGCTTCTGCTTCTTCTCTTTCTTCGATCC / / / / // / / / / / / / /// / | | SmlI | || | | | | | | | ||| MaeI | CviJI | || | | | | | | | ||CviJI | AluI | || | | | | | | | ||AluI SetI | || | | | | | | | |MboII | || | | | | | | | SetI | || | | | | | | MboII | || | | | | | BbvII* | || | | | | | MboII | || | | | | Ksp632I* | || | | | BbvII* | || | | | MboII | || | | MboII | || | MboII | || BbvII* | || MboII | |MboII | Bce83I* MboII E L E E E E D E E E D E D E E E K E A R S L R K K K T K K K T K T K K R K K L G A * G R R R R R R R R R R R R E R S * A ----:----|----:----|----:----|----:----|----:----|----:----| S S S S S S S S S S S S S S S S F S A L H A Q P L L L R L L L R L R L L S L L * L K L F F F V F F F V F V F F L F F S P HphI | ApoI | TspEI | | BceAI | | | StyI | | | SecI* CviJI | | | | MnlI HaeIII MaeI SetI \ \ \ \ \ \ \ \ CATACAAATTCACCAAGGAAAAGAGGCCGTAAGATAAAACTAGGTAAAGATGATATTGAC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GTATGTTTAAGTGGTTCCTTTTCTCCGGCATTCTATTTTGATCCATTTCTACTATAACTG / / / / / / // HphI | | | SecI* HaeIII |MaeI | | | StyI CviJI SetI | | MnlI | BceAI TspEI ApoI H T N S P R K R G R K I K L G K D D I D I Q I H Q G K E A V R * N * V K M I L T Y K F T K E K R P * D K T R * R * Y * R ----:----|----:----|----:----|----:----|----:----|----:----| C V F E G L F L P R L I F S P L S S I S A Y L N V L S F L G Y S L V L Y L H Y Q M C I * W P F S A T L Y F * T F I I N V SetI | Hpy166II | | BinI* | | | SetI | | | | MboI TatI | | | | XhoII Bsp1407I | | | | | DpnI Hpy166II |HgaI | | | | | |BstKTI |SfaNI |Csp6I MnlI | | | | | ||HgaI || AciI ||RsaI SetI |MnlI | | | | | |||MaeI || | FnuDII* \\\ \ \\ \ \ \ \ \ \\\\ \\ \ \ GCTTCTGTACAACCTCCCCCCAAAAAAAGAGGTCGTAAACCTAAAGATCCTAGTAAACCG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGACATGTTGGAGGGGGGTTTTTTTCTCCAGCATTTGGATTTCTAGGATCATTTGGC ///// // / // / // / / // / ||||HgaI |MnlI SetI || | || | | || FnuDII* |||SetI MnlI || | || | | || SfaNI ||Bsp1407I || | || | | || AciI ||TatI || | || | | |Hpy166II |Csp6I || | || | | HgaI RsaI || | || | MaeI || | || XhoII || | || MboI || | |DpnI || | BstKTI || BinI* |SetI Hpy166II A S V Q P P P K K R G R K P K D P S K P L L Y N L P P K K E V V N L K I L V N R F C T T S P Q K K R S * T * R S * * T A ----:----|----:----|----:----|----:----|----:----|----:----| A E T C G G G L F L P R L G L S G L L G R K Q V V E G W F F L D Y V * L D * Y V S R Y L R G G F F S T T F R F I R T F R Hpy188I | BceAI | MboII | TspDTI | | EcoRV | | | FatI | | | |CviAII | | | || NlaIII ApoI |MwoI | | || | CviRI* TspEI \\ \ \ \\ \ \ \ CGTCAGATGCTATTGATATCTTCATGCCGTGCAAATAATACTCCTGTGATTAGGAAATTT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGTCTACGATAACTATAGAAGTACGGCACGTTTATTATGAGGACACTAATCCTTTAAA // // / / / // / / || || | | | |FatI CviRI* TspEI || || | | | CviAII ApoI || || | | NlaIII || || | EcoRV || || BceAI || |MboII || TspDTI |Hpy188I MwoI R Q M L L I S S C R A N N T P V I R K F V R C Y * Y L H A V Q I I L L * L G N L S D A I D I F M P C K * Y S C D * E I Y ----:----|----:----|----:----|----:----|----:----|----:----| R * I S N I D E H R A F L V G T I L F N A D S A I S I K M G H L Y Y E Q S * S I T L H * Q Y R * A T C I I S R H N P F K BbvI | MseI | |SwaI TaqI | |BsaBI MaeI AsuII | |AhaIII* \ \ \ \\ ACAAAAAAGAATGTTGCTAGGGCGAAAAAGAAATATACCCCGTTTTCGAAAAGATTTAAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTTTTCTTACAACGATCCCGCTTTTTCTTTATATGGGGCAAAAGCTTTTCTAAATTT / / // MaeI AsuII |MseI TaqI |BbvI AhaIII* BsaBI SwaI T K K N V A R A K K K Y T P F S K R F K Q K R M L L G R K R N I P R F R K D L N K K E C C * G E K E I Y P V F E K I * I ----:----|----:----|----:----|----:----|----:----|----:----| V F F F T A L A F F F Y V G N E F L N L * L F S H Q * P S F S I Y G T K S F I * C F L I N S P R F L F I G R K R F S K F SfeI* | TseI | AluI | CviJI | |BisI MboII BccI | ||BlsI SetI | ApoI Hpy188I | ||SetI TspDTI |ApoI | TspEI |TspEI | |||CviRI* | MseI |TspEI | | XmnI ||TspGWI \ \\\\ \ \ \\ \ \ \ \\\ TCTATAGCTGCAATACCAGATTTAACTTCATTACCTGAATTTTACGGAAATTCTTCGGAA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AGATATCGACGTTATGGTCTAAATTGAAGTAATGGACTTAAAATGCCTTTAAGAAGCCTT ////// / / / / / // /// |||||| TspDTI MseI SetI | MboII || ||BccI |||||CviRI* TspEI || |TspGWI |||||TseI ApoI || Hpy188I ||||BisI |TspEI |||BlsI |ApoI ||CviJI XmnI ||AluI |SfeI* SetI S I A A I P D L T S L P E F Y G N S S E L * L Q Y Q I * L H Y L N F T E I L R N Y S C N T R F N F I T * I L R K F F G I ----:----|----:----|----:----|----:----|----:----|----:----| D I A A I G S K V E N G S N * P F E E S I * L Q L V L N L K M V Q I K R F N K P R Y S C Y W I * S * * R F K V S I R R F SetI TspEI Hpy188I SfaNI | MseI | SfaNI \ \ \ \ \ TTGATGGCATCAAGGTTTGAAAACAAATTAAAAACAACCCAAAAGCATCAGATTGTAGAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AACTACCGTAGTTCCAAACTTTTGTTTAATTTTTGTTGGGTTTTCGTAGTCTAACATCTT / / / // / / TspEI SetI SfaNI |MseI Hpy188I SfaNI TspEI L M A S R F E N K L K T T Q K H Q I V E * W H Q G L K T N * K Q P K S I R L * K D G I K V * K Q I K N N P K A S D C R N ----:----|----:----|----:----|----:----|----:----|----:----| N I A D L N S F L N F V V W F C * I T S I S P M L T Q F C I L F L G F A D S Q L Q H C * P K F V F * F C G L L M L N Y F MboII TspEI Tsp4CI* Ksp632I* SspI \ \ \ \ ACAATTTTTTCTAAAGTCAAAAAACAGTTGAACTCTTCGTATGTCAAAGAAGAAATATTG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTAAAAAAGATTTCAGTTTTTTGTCAACTTGAGAAGCATACAGTTTCTTCTTTATAAC / / / / / TspEI Tsp4CI* Ksp632I* | MboII MboII SspI T I F S K V K K Q L N S S Y V K E E I L Q F F L K S K N S * T L R M S K K K Y * N F F * S Q K T V E L F V C Q R R N I E ----:----|----:----|----:----|----:----|----:----|----:----| V I K E L T L F C N F E E Y T L S S I N F L K K * L * F V T S S K T H * L L F I C N K R F D F F L Q V R R I D F F F Y Q Cfr10I ApoI CviRI* |HpaII XmnI TspEI | ApoI || CviJI TspEI | TspDTI MboII | TspEI || |MaeI EcoRI | | MnlI \ \ \ \\ \\ \ \ \ \ AAGTCTGCAAATTTCCAAGATTATTTACCGGCTAGGGAGAATGAATTCGCCTCAATTTAT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGACGTTTAAAGGTTCTAATAAATGGCCGATCCCTCTTACTTAAGCGGAGTTAAATA / / // / / / / / / | TspEI || MaeI | EcoRI | | MnlI | ApoI |Cfr10I | TspEI | TspEI CviRI* |CviJI | ApoI TspDTI HpaII XmnI K S A N F Q D Y L P A R E N E F A S I Y S L Q I S K I I Y R L G R M N S P Q F I V C K F P R L F T G * G E * I R L N L F ----:----|----:----|----:----|----:----|----:----|----:----| F D A F K W S * K G A L S F S N A E I * S T Q L N G L N N V P * P S H I R R L K L R C I E L I I * R S P L I F E G * N I BplI BplI | MaeII | |BsaAI MlyI | || SetI PleI | || TaiI HinfI | || MmeI CviRI* | Hpy188I | || | CviJI | BplI | |HinfI | || | | Csp6I | BplI | || PleI | || | | |RsaI | MwoI | || |MlyI | || | | || BssKI MseI | BstAPI | || ||AciI | || | | || EcoRII \ \ \ \ \\ \\\ \ \\ \ \ \\ \ TTAAGTGCATATAGTGCCATTGAGTCCGACTCCGCTACTACTATATACGTGGCTGGTACG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AATTCACGTATATCACGGTAACTCAGGCTGAGGCGATGATGATATATGCACCGACCATGC / // / // // / / / / // / // | || BstAPI || || | AciI BplI | || | |Csp6I | || MwoI || || HinfI BplI | || | RsaI | |BplI || || PleI | || CviJI | |BplI || || MlyI | |MaeII | CviRI* || |Hpy188I | BsaAI MseI || HinfI | MmeI |PleI TaiI MlyI SetI L S A Y S A I E S D S A T T I Y V A G T * V H I V P L S P T P L L L Y T W L V R K C I * C H * V R L R Y Y Y I R G W Y A ----:----|----:----|----:----|----:----|----:----|----:----| K L A Y L A M S D S E A V V I Y T A P V N L H M Y H W Q T R S R * * * I R P Q Y * T C I T G N L G V G S S S Y V H S T R ScrFI BseBI BsgI | EcoNI | MboII | | BsiYI* MseI Tsp4CI* | BbvII* \ \ \ \ \ \ \ CCTGGTGTAGGGAAAACTTTAACCGTAAGGGAAGTCGTAAAGGAACTACTATCGTCTTCT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GGACCACATCCCTTTTGAAATTGGCATTCCCTTCAGCATTTCCTTGATGATAGCAGAAGA //// / / / / / |||EcoNI | Tsp4CI* | | BbvII* ||EcoRII MseI | MboII ||BssKI BsgI |BsiYI* BseBI ScrFI P G V G K T L T V R E V V K E L L S S S L V * G K L * P * G K S * R N Y Y R L L W C R E N F N R K G S R K G T T I V F C ----:----|----:----|----:----|----:----|----:----|----:----| G P T P F V K V T L S T T F S S S D D E A Q H L S F K L R L P L R L P V V I T K R T Y P F S * G Y P F D Y L F * * R R R CviRI* \ GCACAACGAGAAATACCAGACTTTCTTTATGTGGAAATAAATGGATTGAAAATGGTAAAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGTTGCTCTTTATGGTCTGAAAGAAATACACCTTTATTTACCTAACTTTTACCATTTT / CviRI* A Q R E I P D F L Y V E I N G L K M V K H N E K Y Q T F F M W K * M D * K W * N T T R N T R L S L C G N K W I E N G K T ----:----|----:----|----:----|----:----|----:----|----:----| A C R S I G S K R * T S I F P N F I T F Q V V L F V L S E K H P F L H I S F P L C L S F Y W V K K I H F Y I S Q F H Y F MseI SetI |HpaI |HindII |Hpy166II || FatI || |CviAII || || NlaIII || || | TseI MaeIII || || | |BisI Tsp4CI* Hpy178III* || || | ||BlsI \ \ \\ \\ \ \\\ CCCACAGACTGTTACGAAACTTTATGGAACAAAGTGTCAGGAGAAAGGTTAACATGGGCA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTGTCTGACAATGCTTTGAAATACCTTGTTTCACAGTCCTCTTTCCAATTGTACCCGT / / / / /// // // | MaeIII | SetI ||| || |BisI Tsp4CI* | ||| || BlsI | ||| || SetI | ||| |FatI | ||| CviAII | ||NlaIII | |MseI | Hpy166II | HindII | HpaI Hpy178III* P T D C Y E T L W N K V S G E R L T W A P Q T V T K L Y G T K C Q E K G * H G Q H R L L R N F M E Q S V R R K V N M G S ----:----|----:----|----:----|----:----|----:----|----:----| G V S Q * S V K H F L T D P S L N V H A V W L S N R F K I S C L T L L F T L M P G C V T V F S * P V F H * S F P * C P C BbvI HinfI |MaeIII |Tsp45I AluI || MaeI CviJI || | PleI MseI | SetI || | |MlyI |AhaIII* MmeI \ \ \\ \ \\ \\ \ GCTTCAATGGAGTCACTAGAGTTTTACTTTAAAAGAGTTCCAAAAAATAAGAAGAAAACC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGTTACCTCAGTGATCTCAAAATGAAATTTTCTCAAGGTTTTTTATTCTTCTTTTGG / // / // // / CviJI || | |PleI |MseI MmeI TseI || | |MlyI AhaIII* AluI || | MaeI || Tsp45I || MaeIII |BbvI HinfI A S M E S L E F Y F K R V P K N K K K T L Q W S H * S F T L K E F Q K I R R K P F N G V T R V L L * K S S K K * E E N H ----:----|----:----|----:----|----:----|----:----|----:----| A E I S D S S N * K L L T G F F L F F V L K L P T V L T K S * F L E L F Y S S F S * H L * * L K V K F S N W F I L L F G FatI NcoI BcgI StyI | SmlI SecI* | | Hpy178III* DsaI* | | | TatI Bce83I* | | | Bsp1407I |CviAII | | | |Csp6I MboII || MaeIII | | | ||RsaI | BcgI SfaNI TaqI || NlaIII | | | ||| TspEI \ \ \ \ \\ \ \ \ \ \\\ \ ATTGTAGTCTTGTTGGACGAACTCGATGCCATGGTAACGAAATCTCAAGATATTATGTAC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TAACATCAGAACAACCTGCTTGAGCTACGGTACCATTGCTTTAGAGTTCTATAATACATG / / / / / / // // / /// | BcgI SfaNI | | | || |BcgI | ||Bsp1407I MboII | | | || MaeIII | ||TatI | | | |DsaI* | |Csp6I | | | |SecI* | RsaI | | | |StyI Hpy178III* | | | |NcoI SmlI | | | |FatI | | | CviAII | | NlaIII | Bce83I* TaqI I V V L L D E L D A M V T K S Q D I M Y L * S C W T N S M P W * R N L K I L C T C S L V G R T R C H G N E I S R Y Y V Q ----:----|----:----|----:----|----:----|----:----|----:----| M T T K N S S S S A M T V F D * S I I Y W Q L R T P R V R H W P L S I E L Y * T N Y D Q Q V F E I G H Y R F R L I N H V BsrDI MfeI | CviRI* TspEI | | CviJI \ \ \ \ AATTTTTTCAATTGGACTACTTACGAAAATGCCAAACTTATTGTCATTGCAGTAGCCAAT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAAAAAGTTAACCTGATGAATGCTTTTACGGTTTGAATAACAGTAACGTCATCGGTTA / / / / / / TspEI TspEI BsrDI | | BstXI MfeI | CviJI CviRI* N F F N W T T Y E N A K L I V I A V A N I F S I G L L T K M P N L L S L Q * P I F F Q L D Y L R K C Q T Y C H C S S Q Y ----:----|----:----|----:----|----:----|----:----|----:----| L K K L Q V V * S F A L S I T M A T A L C N K * N S * K R F H W V * Q * Q L L W I K E I P S S V F I G F K N D N C Y G I MaeII | SetI | TaiI | | AluI | | CviJI | | |MaeI Hpy178III* BstXI TsoI | | ||SetI | TspEI Hpy166II \ \ \ \ \\\ \ \ \ ACAATGGACTTACCAGAACGTCAGCTAGGCAATAAGATTACTTCAAGAATTGGGTTTACC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTACCTGAATGGTCTTGCAGTCGATCCGTTATTCTAATGAAGTTCTTAACCCAAATGG / / / / / / / / / TsoI | | | | MaeI | | Hpy166II | | | CviJI | TspEI | | | AluI Hpy178III* | | SetI | MaeII TaiI SetI T M D L P E R Q L G N K I T S R I G F T Q W T Y Q N V S * A I R L L Q E L G L P N G L T R T S A R Q * D Y F K N W V Y Q ----:----|----:----|----:----|----:----|----:----|----:----| V I S K G S R * S P L L I V E L I P N V Y L P S V L V D A L C Y S * K L F Q T * C H V * W F T L * A I L N S * S N P K G Hpy166II | BsrI | TspRI | |AccI | ||BssNAI | ||Hpy166II | ||| SapI | ||| BfiI | ||| Ksp632I* | ||| | MwoI | ||| | | AluI | ||| | | CviJI MseI TspEI | ||| | | | SetI MboII | Hin4II* \ \ \\\ \ \ \ \ \ \ \ AGAATTATGTTCACTGGGTATACGCACGAAGAGCTAAAAAATATCATTGATTTAAGACTG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTAATACAAGTGACCCATATGCGTGCTTCTCGATTTTTTATAGTAACTAAATTCTGAC / / / / /// // / / / // | | | | ||| || | CviJI MboII |MseI | | | | ||| || | AluI Hin4II* | | | | ||| || SetI | | | | ||| |MwoI | | | | ||| Ksp632I* | | | | ||| SapI | | | | ||BfiI | | | | |AccI | | | | Hpy166II | | | | BssNAI | | | BsrI | | Hpy166II | TspRI TspEI R I M F T G Y T H E E L K N I I D L R L E L C S L G I R T K S * K I S L I * D * N Y V H W V Y A R R A K K Y H * F K T E ----:----|----:----|----:----|----:----|----:----|----:----| L I I N V P Y V C S S S F F I M S K L S W F * T * Q T Y A R L A L F Y * Q N L V S N H E S P I R V F L * F I D N I * S Q MlyI Eco57I SfaNI PleI HinfI Eco57MI BsrI BsrDI \ \ \ \ \ AAGGGGTTGAACGACTCATTTTTCTATGTTGATACAAAAACTGGCAATGCTATTTTGATT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCCCAACTTGCTGAGTAAAAAGATACAACTATGTTTTTGACCGTTACGATAAAACTAA // // / / / |PleI |Eco57MI BsrI BsrDI SfaNI MlyI |Eco57I HinfI K G L N D S F F Y V D T K T G N A I L I R G * T T H F S M L I Q K L A M L F * L G V E R L I F L C * Y K N W Q C Y F D * ----:----|----:----|----:----|----:----|----:----|----:----| F P N F S E N K * T S V F V P L A I K I S P T S R S M K R H Q Y L F Q C H * K S L P Q V V * K E I N I C F S A I S N Q N MnlI AclI | MaeII AciI MaeII | |BtrI |BisI | MwoI | || SetI ||BlsI SfeI* | BstAPI | || TaiI |||TauI | Tsp4CI* | |SetI | || BbvII* |||CviJI | | MseI | |TaiI | || | MboII \\\\ \ \ \ \ \\ \ \\ \ \ GATGCGGCTGGAAACGACACTACAGTTAAGCAAACGTTGCCTGAAGACGTGAGGAAAGTT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGCCGACCTTTGCTGTGATGTCAATTCGTTTGCAACGGACTTCTGCACTCCTTTCAA //// // / / / / / // / / |||CviJI || MseI | MaeII | | || | Eco57MI ||BisI |SfeI* | AclI | | || | Eco57I ||AciI Tsp4CI* BstAPI | | || BbvII* |BlsI MwoI | | || MboII TauI TaiI | | |MaeII SetI | | BtrI | TaiI | SetI MnlI D A A G N D T T V K Q T L P E D V R K V M R L E T T L Q L S K R C L K T * G K F C G W K R H Y S * A N V A * R R E E S S ----:----|----:----|----:----|----:----|----:----|----:----| S A A P F S V V T L C V N G S S T L F T Q H P Q F R C * L * A F T A Q L R S S L I R S S V V S C N L L R Q R F V H P F N Eco57I AluI Eco57MI CviJI |SmlI | SetI |AflII | |TaqI ||MseI SfaNI | ||Hpy178III* SfaNI \\\ \ \ \\\ \ CGCTTAAGAATGAGTGCTGATGCCATTGAAATAGCTTCGAGAAAAGTAGCAAGTGTTAGT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GCGAATTCTTACTCACGACTACGGTAACTTTATCGAAGCTCTTTTCATCGTTCACAATCA // / / / // / |AflII SfaNI | | |Hpy178III* SfaNI |SmlI | | TaqI MseI | CviJI | AluI SetI R L R M S A D A I E I A S R K V A S V S A * E * V L M P L K * L R E K * Q V L V L K N E C * C H * N S F E K S S K C * W ----:----|----:----|----:----|----:----|----:----|----:----| R K L I L A S A M S I A E L F T A L T L E S L F S H Q H W Q F L K S F L L L H * A * S H T S I G N F Y S R S F Y C T N T TseI |BisI ||BlsI |||AluI |||CviJI SapI |||PvuII Ksp632I* |||NspBII* |CviRI* |||| SetI || MwoI |||| | TspEI || HphI MboII |||| | | MwoI || | Hin4II* | SetI |||| | | | BbvI TsoI \\ \ \ \ \ \\\\ \ \ \ \ \ GGTGATGCAAGAAGAGCATTGAAGGTTTGTAAAAGAGCAGCTGAAATTGCTGAAAAACAC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTACGTTCTTCTCGTAACTTCCAAACATTTTCTCGTCGACTTTAACGACTTTTTGTG / // / / / /// / / / | || | Hin4II* MboII ||| MwoI | BbvI | || HphI SetI ||NspBII* | TsoI | |MwoI ||PvuII TspEI | Ksp632I* ||CviJI | SapI ||TseI CviRI* ||AluI |BisI BlsI SetI G D A R R A L K V C K R A A E I A E K H V M Q E E H * R F V K E Q L K L L K N T * C K K S I E G L * K S S * N C * K T L ----:----|----:----|----:----|----:----|----:----|----:----| P S A L L A N F T Q L L A A S I A S F C H H H L F L M S P K Y F L L Q F Q Q F V T I C S S C Q L N T F S C S F N S F F V TsoI | CviJI | |DdeI | |EspI* | || FatI | || |CviAII | || || NlaIII | || || |MslI BccI Tsp4CI* MnlI MboII \ \\ \\ \\ \ \ \ \ TATATGGCTAAGCATGGTTATGGATATGATGGAAAGACGGTTATTGAAGATGAAAATGAG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| ATATACCGATTCGTACCAATACCTATACTACCTTTCTGCCAATAACTTCTACTTTTACTC / / // /// / / / / | | || ||MslI BccI Tsp4CI* MnlI MboII | | || |FatI | | || CviAII | | |NlaIII | | EspI* | | DdeI | CviJI TsoI Y M A K H G Y G Y D G K T V I E D E N E I W L S M V M D M M E R R L L K M K M R Y G * A W L W I * W K D G Y * R * K * G ----:----|----:----|----:----|----:----|----:----|----:----| * I A L C P * P Y S P F V T I S S S F S S Y P * A H N H I H H F S P * Q L H F H I H S L M T I S I I S L R N N F I F I L BbvII* |MboI |XhoII || DpnI || |BstKTI || ||MboII || |||TspDTI || |||| BinI* TspDTI BseRI || |||| | MaeIII CviJI \ \ \\ \\\\ \ \ \ GAGCAAATATACGATGATGAAGACAAGGATCTTATTGAAAGTAACAAAGCCAAAGACGAT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGTTTATATGCTACTACTTCTGTTCCTAGAATAACTTTCATTGTTTCGGTTTCTGCTA / / //// / / / TspDTI BseRI |||| BinI* | CviJI |||XhoII MaeIII |||MboI ||TspDTI ||BbvII* ||MboII |DpnI BstKTI E Q I Y D D E D K D L I E S N K A K D D S K Y T M M K T R I L L K V T K P K T I A N I R * * R Q G S Y * K * Q S Q R R * ----:----|----:----|----:----|----:----|----:----|----:----| S C I Y S S S S L S R I S L L L A L S S P A F I R H H L C P D * Q F Y C L W L R L L Y V I I F V L I K N F T V F G F V I MaeII | PsrI BccI Csp6I Tsp4CI* | |SetI | PsrI |RsaI | Hpy166II | |TaiI \ \ \\ \ \ \ \\ AATGATGACGATGATGACAATGATGGGGTACAAACAGTTCACATCACGCACGTTATGAAA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTACTGCTACTACTGTTACTACCCCATGTTTGTCAAGTGTAGTGCGTGCAATACTTT / / // / / / / / | BccI || | | | | MaeII PsrI || | | | TaiI || | | | SetI || | | PsrI || | Hpy166II || Tsp4CI* |Csp6I RsaI N D D D D D N D G V Q T V H I T H V M K M M T M M T M M G Y K Q F T S R T L * K * * R * * Q * W G T N S S H H A R Y E S ----:----|----:----|----:----|----:----|----:----|----:----| L S S S S S L S P T C V T * M V C T I F Y H H R H H C H H P V F L E C * A R * S I I V I I V I I P Y L C N V D R V N H F TspDTI | MseI | |AhaIII* | || FatI | || |CviAII | || || NlaIII | || || |TspEI | || || || MaeII | || || || | SetI | || || || | TaiI | || || || | | TspDTI CviJI | ||ApoI || || | | | FnuDII* | MseI | ||TspEI || || | | | | HgaI \ \ \ \\\ \\ \\ \ \ \ \ \ GCCTTAAACGAAACTTTAAATTCTCATGTAATTACGTTTATGACGCGACTTTCATTTACA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAATTTGCTTTGAAATTTAAGAGTACATTAATGCAAATACTGCGCTGAAAGTAAATGT / / / // / / // / / / / / | | TspDTI || | | |FatI | | | FnuDII* HgaI | MseI || | | | | | TspDTI CviJI || | | | | MaeII || | | | TspEI || | | | TaiI || | | | SetI || | | CviAII || | NlaIII || TspEI || ApoI |MseI AhaIII* A L N E T L N S H V I T F M T R L S F T P * T K L * I L M * L R L * R D F H L Q L K R N F K F S C N Y V Y D A T F I Y S ----:----|----:----|----:----|----:----|----:----|----:----| A K F S V K F E * T I V N I V R S E N V L R L R F K L N E H L * T * S A V K M * G * V F S * I R M Y N R K H R S K * K C MboI XhoII | DpnI | |BstKTI | |TspDTI | ||SmlI CviRI* | ||| Hpy178III* | EcoT22I | ||| | BinI* Tsp4CI* | | MseI Bce83I* | ||| | | TspGWI \ \ \ \ \ \ \\\ \ \ \ GCAAAACTGTTTATTTATGCATTATTAAACTTGATGAAAAAGAACGGATCTCAAGAGCAA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTTGACAAATAAATACGTAATAATTTGAACTACTTTTTCTTGCCTAGAGTTCTCGTT / / / / / // / // / Tsp4CI* | CviRI* MseI Bce83I* || | || TspGWI EcoT22I || | |BinI* || | Hpy178III* || | SmlI || XhoII || MboI |DpnI TspDTI BstKTI A K L F I Y A L L N L M K K N G S Q E Q Q N C L F M H Y * T * * K R T D L K S K K T V Y L C I I K L D E K E R I S R A R ----:----|----:----|----:----|----:----|----:----|----:----| A F S N I * A N N F K I F F F P D * S C L L V T * K H M I L S S S F S R I E L A C F Q K N I C * * V Q H F L V S R L L L BfiI MaeIII BsrI | TaqI | TspDTI \ \ \ \ \ GAACTGGGCGATATTGTCGATGAAATCAAGTTACTTATTGAAGTAAATGGCAGTAATAAG 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGACCCGCTATAACAGCTACTTTAGTTCAATGAATAACTTCATTTACCGTCATTATTC / / / // BsrI BfiI TaqI |MaeIII TspDTI E L G D I V D E I K L L I E V N G S N K N W A I L S M K S S Y L L K * M A V I S T G R Y C R * N Q V T Y * S K W Q * * V ----:----|----:----|----:----|----:----|----:----|----:----| S S P S I T S S I L N S I S T F P L L L L V P R Y Q R H F * T V * Q L L H C Y Y F Q A I N D I F D L * K N F Y I A T I L FatI MmeI |CviAII Hpy188I || NlaIII | MfeI || |AjuI CviJI TsoI AjuI SspI | TspEI \\ \\ \ \ \ \ \ \ TTTGTCATGGAGATAGCCAAAACATTGTTCCAACAGGGAAGTGATAATATTTCTGAACAA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| AAACAGTACCTCTATCGGTTTTGTAACAAGGTTGTCCCTTCACTATTATAAAGACTTGTT / // / / / / // | |FatI CviJI TsoI AjuI | |Hpy188I | CviAII | MmeI NlaIII SspI AjuI F V M E I A K T L F Q Q G S D N I S E Q L S W R * P K H C S N R E V I I F L N N C H G D S Q N I V P T G K * * Y F * T I ----:----|----:----|----:----|----:----|----:----|----:----| N T M S I A L V N N W C P L S L I E S C T Q * P S L W F M T G V P F H Y Y K Q V K D H L Y G F C Q E L L S T I I N R F L AciI FatI FnuDII* MseI |CviAII MaeIII | HgaI |PmeI TspEI || NlaIII | FauI | |SspI |AhaIII* \ \\ \ \ \ \ \\ \\ TTGAGAATTATATCATGGGATTTCGTTCTCAATCAGTTACTTGACGCGGGAATATTGTTT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCTTAATATAGTACCCTAAAGCAAGAGTTAGTCAATGAACTGCGCCCTTATAACAAA / / / // // / / / / / TspEI | | |FatI |FauI | AciI | | AhaIII* MfeI | | CviAII | | | | PmeI | NlaIII | | | HgaI TspEI | | SspI | FnuDII* MaeIII L R I I S W D F V L N Q L L D A G I L F * E L Y H G I S F S I S Y L T R E Y C L E N Y I M G F R S Q S V T * R G N I V * ----:----|----:----|----:----|----:----|----:----|----:----| N L I I D H S K T R L * N S S A P I N N I S F * I M P N R E * D T V Q R P F I T Q S N Y * P I E N E I L * K V R S Y Q K AluI MboII CviJI |TspDTI | SetI \\ \ \ AAACAAACTATGAAGAACGATAGAATATGTTGTGTCAAGCTAAATATATCAGTAGAAGAA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGTTTGATACTTCTTGCTATCTTATACAACACAGTTCGATTTATATAGTCATCTTCTT / / / / MseI TspDTI | CviJI MboII | AluI SetI K Q T M K N D R I C C V K L N I S V E E N K L * R T I E Y V V S S * I Y Q * K K T N Y E E R * N M L C Q A K Y I S R R S ----:----|----:----|----:----|----:----|----:----|----:----| L C V I F F S L I H Q T L S F I D T S S * V F * S S R Y F I N H * A L Y I L L L F L S H L V I S Y T T D L * I Y * Y F F MwoI MboII | CviJI | |FatI BseGI | ||MnlI |TspDTI | ||CviAII || FokI | ||| NlaIII || | ApoI CviJI | ||| | BsmAI || | TspEI \ \ \\\ \ \ \\ \ \ GCCAAAAGAGCCATGAATGAGGATGAGACATTGAGAAATTTATAG 2710 2720 2730 2740 ----:----|----:----|----:----|----:----|----: CGGTTTTCTCGGTACTTACTCCTACTCTGTAACTCTTTAAATATC / / / // // / // / / | | | || |FatI | |TspDTI | TspEI | | | || CviAII | BseGI | ApoI | | | |NlaIII BsmAI FokI | | | |MnlI | | | CviJI | | MboII | MwoI CviJI A K R A M N E D E T L R N L * P K E P * M R M R H * E I Y X Q K S H E * G * D I E K F I X ----:----|----:----|----:----|----:----|----: A L L A M F S S S V N L F K Y L W F L W S H P H S M S F N I G F S G H I L I L C Q S I * L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 7 BspACI,SsiI AclI 2 Psp1406I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 5 DraI AjuI 1 AluI 13 AluBI ApoI 10 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 6 BpiI,BpuAI,BstV2I,BbsI BccI 8 Bce83I* 3 BpuEI BceAI 3 BcgI 1 BfiI 3 BmrI,BmuI BinI* 5 AlwI,BspPI,AclWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmgT120I 1 BplI 2 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseRI 1 BseYI 1 BsgI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI Bsp1407I 2 BsrGI,BstAUI BsrDI 2 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 2 BstKTI 6 BstXI 2 BtrI 1 BmgBI,AjiI BtsI 1 Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 9 CviJI 31 CviKI-1 CviRI* 13 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 6 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI Eco57I 2 AcuI Eco57MI 2 EcoNI 1 BstENI,XagI EcoRI 1 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 2 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 9 FauI 1 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GsaI 1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 6 CseI HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 2 Hin4II* 3 HpyAV HindII 1 HincII HindIII 1 HinfI 6 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 11 Hpy99I 1 Ksp632I* 6 Eam1104I,EarI,Bst6I MaeI 8 FspBI,BfaI,XspI MaeII 9 HpyCH4IV MaeIII 6 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 26 MfeI 2 MunI MlyI 4 SchI MmeI 3 MnlI 15 MseI 23 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 8 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 3 MspA1I PfoI 1 PleI 4 PpsI PmeI 1 MssI PpiI 1 PpuMI 1 Psp5II,PspPPI PsrI 1 PstI 1 PvuII 1 RsaI 4 AfaI SapI 2 LguI,PciSI,BspQI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 35 SfaNI 7 LweI SfeI* 4 BstSFI,SfcI,BfmI SmlI 4 SmoI SspI 5 StyI 3 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 9 TaqI 8 TatI 2 TauI 2 TfiI 2 PfeI TseI 4 ApeKI TsoI 4 Tsp45I 1 NmuCI Tsp4CI* 11 HpyCH4III,TaaI,Bst4CI TspDTI 15 TspEI 26 TasI,Tsp509I,Sse9I TspGWI 5 TspRI 2 TscAI VspI 1 PshBI,AseI XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflIII AgeI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BamHI BarI BbvCI BciVI BclI BdaI BetI* BglI BglII BmeT110I BmtI Bpu10I BsaXI BseMII BsePI BseSI BsiI* BsmI Bsp120I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BstEII BtgZI Cac8I CauII* Cfr9I CfrI CspCI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoP15I EgeI EheI Esp3I FalI FseI FspAI GlaI GsuI HaeII HgiAI* HgiCI* HhaI Hin6I HinP1I HspAI KasI KpnI MauBI McrI* MluI MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NspI OliI PacI PasI PflMI PmaCI PshAI PsiI PspOMI PspXI PvuI RsrII SacI SacII SalI SanDI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI TaqII TspMI TstI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769