Restriction Map of YLRWTy1-3



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YLRWTy1-3 on chromosome XII from coordinates 650824 to 656743.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.13617

MaeII |MaeIII || SetI || TaiI SpeI || | SpeI |MaeI || | |MaeI \\ \\ \ \\ TGTTGGAATAAAAATCAACTATCATCTACTAACTAGTATTTACGTTACTAGTATATTATC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| ACAACCTTATTTTTAGTTGATAGTAGATGATTGATCATAAATGCAATGATCATATAATAG // / / / // |SpeI | | | |SpeI MaeI | | | MaeI | | MaeIII | MaeII TaiI SetI C W N K N Q L S S T N * Y L R Y * Y I I V G I K I N Y H L L T S I Y V T S I L S L E * K S T I I Y * L V F T L L V Y Y H ----:----|----:----|----:----|----:----|----:----|----:----| X Q F L F * S D D V L * Y K R * * Y I I X N S Y F D V I M * * S T N V N S T Y * T P I F I L * * R S V L I * T V L I N D Hin4I Hin4I | MboII | AluI Tsp4CI* | | HgaI TspEI | CviJI \ \ \ \ \ \ \ ATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TATATGCCACAATCTTCTACTGCGTTTACTACTCTTTATCAGTAGATTTAATCACCTTCG / / / / // / / Tsp4CI* Hin4I MboII HgaI |TspEI | CviJI Hin4I | AluI SetI I Y G V R R * R K * * E I V I * I S G S Y T V L E D D A N D E K * S S K L V E A I R C * K M T Q M M R N S H L N * W K L ----:----|----:----|----:----|----:----|----:----|----:----| M Y P T L L H R L H H S I T M * I L P L * I R H * F I V C I I L F L * R F * H F Y V T N S S S A F S S F Y D D L N T S A MboI | DpnI | |BstKTI | || BinI* | || | SspI SetI | || | | MseI TspDTI \ \ \\ \ \ \ \ TGAAACGCAAGGATTGATAATGTAATAGGATCAATGAATATTAACATATAAAACGATGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ACTTTGCGTTCCTAACTATTACATTATCCTAGTTACTTATAATTGTATATTTTGCTACTA // / / / / / || MboI | | | TspDTI |DpnI | | MseI BstKTI | SspI BinI* * N A R I D N V I G S M N I N I * N D D E T Q G L I M * * D Q * I L T Y K T M I K R K D * * C N R I N E Y * H I K R * * ----:----|----:----|----:----|----:----|----:----|----:----| Q F A L I S L T I P D I F I L M Y F S S S F R L S Q Y H L L I L S Y * C I F R H S V C P N I I Y Y S * H I N V Y L V I I MnlI | AvaI | XhoI | SmlI TspEI | AbsI | CviRI* BsiYI* | PspXI | | TfiI | TfiI | |TaqI SspI TspEI | | HinfI | HinfI | |BmeT110I \ \ \ \ \ \ \ \ \\ AATAATATTTATAGAATTGTGTAGAATTGCAGATTCCCTTTTATGGATTCCTAAATCCTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTATAAATATCTTAACACATCTTAACGTCTAAGGGAAAATACCTAAGGATTTAGGAG / / // / / / / SspI TspEI || | BsiYI* | MnlI || HinfI HinfI || TfiI TfiI |CviRI* TspEI N N I Y R I V * N C R F P F M D S * I L I I F I E L C R I A D S L L W I P K S S * Y L * N C V E L Q I P F Y G F L N P R ----:----|----:----|----:----|----:----|----:----|----:----| L L I * L I T Y F Q L N G K I S E * I R Y Y Y K Y F Q T S N C I G K * P N R F G I I N I S N H L I A S E R K H I G L D E AccI |BssNAI |Hpy166II MaeI || SetI TfiI MnlI | BseRI || | SspI CviJI HinfI \ \ \ \\ \ \ \ \ GAGGAGAACTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTATCAACAATGGAAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTCTTGAAGATCATATAAGACATATGGATTATAATATCGGAAATAGTTGTTACCTTA // / / // / / / || MnlI BseRI |AccI SspI CviJI HinfI |PspXI MaeI |SetI TfiI |AbsI Hpy166II |SmlI BssNAI |XhoI |AvaI BmeT110I TaqI E E N F * Y I L Y T * Y Y S L Y Q Q W N R R T S S I F C I P N I I A F I N N G I G E L L V Y S V Y L I L * P L S T M E S ----:----|----:----|----:----|----:----|----:----|----:----| S S F K * Y I R Y V * Y * L R * * C H F R P S S R T Y E T Y R I N Y G K D V I S L L V E L I N Q I G L I I A K I L L P I FatI |CviAII ||TaqII ||| NlaIII ||| | Hin6I ||| | |GlaI ||| | ||HhaI TspEI ||| | |||HaeII MaeIII \ \\\ \ \\\\ \ CCCAACAATTATCTCAACACCCACACATTTCTCATGGTAGCGCCTGTGCTTCGGTTACTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTTGTTAATAGAGTTGTGGGTGTGTAAAGAGTACCATCGCGGACACGAAGCCAATGAA / / // //// / TspEI | || |||Hin6I MaeIII | || ||GlaI | || |HhaI | || HaeII | |FatI | CviAII NlaIII TaqII P N N Y L N T H T F L M V A P V L R L L P T I I S T P T H F S W * R L C F G Y F Q Q L S Q H P H I S H G S A C A S V T S ----:----|----:----|----:----|----:----|----:----|----:----| G L L * R L V W V N R M T A G T S R N S D W C N D * C G C M E * P L A Q A E T V G V I I E V G V C K E H Y R R H K P * K Hpy166II | TspGWI | | BinI* | | | Hpy178III* | | | | MboI | | | | XhoII MaeII AluI | | | | | DpnI | SetI CviJI DdeI | | | | | |BstKTI | TaiI | SetI Hin4II* \ \ \ \ \ \ \\ \ \ \ \ \ CTAAGGAAGTCCACACAAATCAAGATCCGTTAGACGTTTCAGCTTCCAAAACAGAAGAAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GATTCCTTCAGGTGTGTTTAGTTCTAGGCAATCTGCAAAGTCGAAGGTTTTGTCTTCTTA / / / / /// / / / / / / DdeI | | | ||| XhoII | | | CviJI Hin4II* | | | ||| MboI | | | AluI | | | ||DpnI | | SetI | | | |BstKTI | MaeII | | | | TaiI | | | | SetI | | | Hpy178III* | | BinI* | TspGWI Hpy166II L R K S T Q I K I R * T F Q L P K Q K N * G S P H K S R S V R R F S F Q N R R M K E V H T N Q D P L D V S A S K T E E C ----:----|----:----|----:----|----:----|----:----|----:----| R L F D V C I L I R * V N * S G F C F F E L S T W V F * S G N S T E A E L V S S * P L G C L D L D T L R K L K W F L L I AarI BspMI |MwoI || AluI || CviJI || PvuII MboII || NspBII* | CviJI DdeI CviJI TspDTI SetI || | SetI \ \ \ \ \ \ \\ \ \ GTGAGAAGGCTTCCACTAAGGCTAACTCTCAACAGACAACAACACCTGCTTCATCAGCTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CACTCTTCCGAAGGTGATTCCGATTGAGAGTTGTCTGTTGTTGTGGACGAAGTAGTCGAC / / / / / / / / / | CviJI | CviJI | SetI | | NspBII* MboII DdeI TspDTI | | BspMI | | PvuII | | CviJI | | AarI | | AluI | SetI MwoI V R R L P L R L T L N R Q Q H L L H Q L * E G F H * G * L S T D N N T C F I S C E K A S T K A N S Q Q T T T P A S S A V ----:----|----:----|----:----|----:----|----:----|----:----| T L L S G S L S V R L L C C C R S * * S H S F A E V L A L E * C V V V G A E D A H S P K W * P * S E V S L L V Q K M L Q MnlI BseRI | SetI |FatI | | MnlI ||CviAII | | | BspMI ||| NlaIII | | | |Csp6I PflMI ||| |BccI | | | ||RsaI BsiYI* ||| |Eco57I | | | ||| BceAI |MnlI Hpy178III* ||| |Eco57MI | | | ||| | SetI || AsuI* \ \\\ \\ \ \ \ \\\ \ \ \\ \ TTCCAGAGAACCCCCATCATGCCTCTCCTCAACCTGCTTCAGTACCACCTCCACAGAATG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTCTCTTGGGGGTAGTACGGAGAGGAGTTGGACGAAGTCATGGTGGAGGTGTCTTAC / / / // / / / //// / / / | | | || BccI MnlI MnlI |||| | | MnlI | | | |FatI SetI |||| | BsiYI* | | | Eco57MI |||| | PflMI | | | CviAII |||| BceAI | | | Eco57I |||SetI | | NlaIII ||BspMI | BseRI |Csp6I Hpy178III* RsaI F Q R T P I M P L L N L L Q Y H L H R M S R E P P S C L S S T C F S T T S T E W P E N P H H A S P Q P A S V P P P Q N G ----:----|----:----|----:----|----:----|----:----|----:----| N W L V G M M G R R L R S * Y W R W L I T G S F G W * A E G * G A E T G G G C F E L S G G D H R E E V Q K L V V E V S H FatI BmgT120I CviRI* |CviJI |CviAII |HaeIII ||BtsI || Csp6I OliI ||TspRI CviJI BstXI || |RsaI MslI ||| NlaIII | EcoP15I |BccI \\ \\ \ \\\ \ \ \ \\ GGCCGTACCCACAGCAGTGCATGATGACCCAAAACCAAGCCAATCCATCTGGTTGGTCAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGCATGGGTGTCGTCACGTACTACTGGGTTTTGGTTCGGTTAGGTAGACCAACCAGTA // // / / / // / / / / || || | MslI | |FatI | | BstXI BccI || || | OliI | CviAII | EcoP15I || || TspRI CviRI* CviJI || |Csp6I NlaIII || RsaI BtsI |AsuI* BmgT120I HaeIII CviJI G R T H S S A * * P K T K P I H L V G H A V P T A V H D D P K P S Q S I W L V I P Y P Q Q C M M T Q N Q A N P S G W S F ----:----|----:----|----:----|----:----|----:----|----:----| P R V W L L A H H G L V L G I W R T P * P G Y G C C H M I V W F W A L G D P Q D A T G V A T C S S G F G L W D M Q N T M TspGWI | TspGWI | |TfiI | |BccI | |HinfI | || TaqII | || | AccI | || | |BssNAI TatI | || | |Hpy166II |Csp6I | || | || SetI ||RsaI \ \\ \ \\ \ \\\ TTTACGGACACCCATCTATGATTCCGTATACACCTTATCAAATGTCGCCTATGTACTTTC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAATGCCTGTGGGTAGATACTAAGGCATATGTGGAATAGTTTACAGCGGATACATGAAAG / / / / // / /// | | | | || SetI ||TatI | | | | |AccI |Csp6I | | | | Hpy166II RsaI | | | | BssNAI | | | TaqII | | | HinfI | | | TfiI | | BccI | TspGWI TspGWI F T D T H L * F R I H L I K C R L C T F L R T P I Y D S V Y T L S N V A Y V L S Y G H P S M I P Y T P Y Q M S P M Y F P ----:----|----:----|----:----|----:----|----:----|----:----| K V S V W R H N R I C R I L H R R H V K N * P C G D I I G Y V G * * I D G I Y K K R V G M * S E T Y V K D F T A * T S E BssKI EcoRII |SecI* ||ScrFI ||BseBI |||SetI DdeI ||||AsuI* BciVI |Hpy188I |||||BmgT120I Tsp4CI* |BccI || HphI ||||||CviJI | MmeI || BseMII || | SduI ||||||HaeIII | |AciI || |BspCNI || | HgiAI* \\\\\\\ \ \\ \\ \\ \\ \ \ CACCTGGGCCACAATCACAGTTTCCGCAGTATCCATCATCAGTTGGAACGCCTCTGAGCA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGACCCGGTGTTAGTGTCAAAGGCGTCATAGGTAGTAGTCAACCTTGCGGAGACTCGT / / /// / / / / /// / // // | | ||AsuI* | MmeI AciI | ||BspCNI | || |BspCNI | | |BmgT120I Tsp4CI* | |BseMII | || |MnlI | | |HaeIII | BccI | || BseMII | | |CviJI BciVI | |DdeI | | EcoRII | |HphI | | BssKI | HgiAI* | | SecI* | SduI | BseBI Hpy188I | ScrFI SetI H L G H N H S F R S I H H Q L E R L * A T W A T I T V S A V S I I S W N A S E H P G P Q S Q F P Q Y P S S V G T P L S T ----:----|----:----|----:----|----:----|----:----|----:----| W R P W L * L K R L I W * * N S R R Q A G G P G C D C N G C Y G D D T P V G R L V Q A V I V T E A T D M M L Q F A E S C TfiI HinfI | BseGI | | DdeI | | BbvCI | | Bpu10I | | |MlyI | | |PleI DdeI | | || AciI |SetI | | || Hin4I |BccI | | || Hin4I ||HinfI | | || NspBII* |||EcoNI | | || | FokI |||| BsiYI* | | || | |HinfI |||| | SetI | | || | || MnlI |||| | PleI | | || | || | Hpy188I |||| | |MlyI | | || | || | |BspCNI MnlI |||| | || FokI | | || | || | ||BseMII BseMII |||| | || |Hin4I | | || | || | |||Hin4I |BspCNI |||| | || ||TspDTI | | || | || | |||| BseGI \\ \\\\ \ \\ \\\ \ \ \\ \ \\ \ \\\\ \ CTCCATCACCTGAGTCAGGTAATACATTTACTGATTCATCCTCAGCGGACTCTGATATGA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GAGGTAGTGGACTCAGTCCATTATGTAAATGACTAAGTAGGAGTCGCCTGAGACTATACT / ///// / / / / / / / //// / / /// / SetI ||||| | | | FokI | | | |||| | | ||| BseGI ||||| | | TspDTI | | | |||| | | ||BseMII ||||| | PleI | | | |||| | | |Hpy188I ||||| | MlyI | | | |||| | | |BspCNI ||||| Hin4I | | | |||| | | Hin4I ||||SetI | | | |||| | | HinfI |||HinfI | | | |||| | | FokI ||EcoNI | | | |||| | MnlI |DdeI | | | |||| AciI BsiYI* | | | |||NspBII* BccI | | | ||Bpu10I | | | ||BbvCI | | | ||DdeI | | | |PleI | | | MlyI | | Hin4I | | Hin4I | HinfI | TfiI BseGI L H H L S Q V I H L L I H P Q R T L I * S I T * V R * Y I Y * F I L S G L * Y D P S P E S G N T F T D S S S A D S D M T ----:----|----:----|----:----|----:----|----:----|----:----| S W * R L * T I C K S I * G * R V R I H V G D G S D P L V N V S E D E A S E S I E M V Q T L Y Y M * Q N M R L P S Q Y S HphI | MseI | |HpaI Hin4I | |HindII Hin4I | |Hpy166II SetI | Hpy188I | || SetI | MnlI TspEI \ \ \ \\ \ \ \ \ CATCCACTAAAAAATATGTCAGACCACCACCAATGTTAACCTCACCTAATGACTTTCCAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTAGGTGATTTTTTATACAGTCTGGTGGTGGTTACAATTGGAGTGGATTACTGAAAGGTT / / / // / / Hin4I Hpy188I | |MseI SetI MnlI Hin4I | |SetI | Hpy166II | HindII | HpaI HphI H P L K N M S D H H Q C * P H L M T F Q I H * K I C Q T T T N V N L T * * L S K S T K K Y V R P P P M L T S P N D F P N ----:----|----:----|----:----|----:----|----:----|----:----| C G S F F I D S W W W H * G * R I V K W V D V L F Y T L G G G I N V E G L S K G M W * F I H * V V V L T L R V * H S E L TaqI ApoI | TfiI MseI TspEI | HinfI Hpy188I \ \ \ \ \ ATTGGGTTAAAACATACATCAAATTTTTACAAAACTCGAATCTCGGTGGTATTATTCCGA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TAACCCAATTTTGTATGTAGTTTAAAAATGTTTTGAGCTTAGAGCCACCATAATAAGGCT / / / / / / TspEI MseI TspEI | HinfI Hpy188I ApoI | TfiI TaqI I G L K H T S N F Y K T R I S V V L F R L G * N I H Q I F T K L E S R W Y Y S D W V K T Y I K F L Q N S N L G G I I P T ----:----|----:----|----:----|----:----|----:----|----:----| I P N F C V D F K * L V R I E T T N N R F Q T L V Y M L N K C F E F R P P I I G N P * F M C * I K V F S S D R H Y * E S SplI* |Csp6I ||RsaI |||MaeII ||||MmeI |||||TspGWI ||||||SetI ||||||TaiI ||||||| MboI ||||||| Hpy188I SetI Tsp4CI* ||||||| | DpnI HphI | TspDTI | Hpy166II ||||||| | |BstKTI TspRI | | Hin4II* \ \ \\\\\\\ \ \\ \ \ \ \ CAGTAAACGGAAAACCCGTACGTCAGATCACTGATGATGAACTCACCTTCTTGTATAACA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GTCATTTGCCTTTTGGGCATGCAGTCTAGTGACTACTACTTGAGTGGAAGAACATATTGT / / //// / // / / / / / | Hpy166II |||| | || MboI HphI SetI | Hin4II* Tsp4CI* |||| | |DpnI TspDTI |||| | BstKTI |||| | TspRI |||| Hpy188I |||MaeII ||SplI* |TspGWI |Csp6I MmeI RsaI TaiI SetI Q * T E N P Y V R S L M M N S P S C I T S K R K T R T S D H * * * T H L L V * H V N G K P V R Q I T D D E L T F L Y N T ----:----|----:----|----:----|----:----|----:----|----:----| C Y V S F G Y T L D S I I F E G E Q I V V T F P F G T R * I V S S S S V K K Y L L L R F V R V D S * Q H H V * R R T Y C SetI |FokI |BssKI |EcoRII ||SecI* |||ScrFI |||BseBI ||||SetI TspEI ||||Hin4I TspGWI SspI | MnlI ||||Hin4I | BseGI \ \ \ \\\\\ \ \ CTTTTCAAATATTTGCTCCCTCTCAATTCCTACCTACCTGGGTCAAAGACATCCTATCCG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAAGTTTATAAACGAGGGAGAGTTAAGGATGGATGGACCCAGTTTCTGTAGGATAGGC / / / // /// / / SspI | | || ||| | BseGI | | || ||| TspGWI | | || ||EcoRII | | || ||BssKI | | || ||SecI* | | || |FokI | | || BseBI | | || ScrFI | | |SetI | | Hin4I | | Hin4I | SetI TspEI MnlI L F K Y L L P L N S Y L P G S K T S Y P F S N I C S L S I P T Y L G Q R H P I R F Q I F A P S Q F L P T W V K D I L S V ----:----|----:----|----:----|----:----|----:----|----:----| S K L Y K S G R L E * R G P D F V D * G V K * I N A G E * N R G V Q T L S M R D K E F I Q E R E I G V * R P * L C G I R Hin4I Hin4I | EcoRV | | FatI | | BspHI | | |CviAII | | |Hpy178III* | | || NlaIII | | || | ApoI CviRI* | | || | TspEI | Hpy188I | | || | | TspGWI TspDTI | | MnlI \ \ \\ \ \ \ \ \ \ \ TTGATTATACGGATATCATGAAAATTCTTTCCAAAAGTATTGAAAAAATGCAATCTGATA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAATATGCCTATAGTACTTTTAAGAAAGGTTTTCATAACTTTTTTACGTTAGACTAT / / / // / / / / / / Hin4I | | || | | TspDTI | | MnlI Hin4I | | || | TspEI | Hpy188I | | || | ApoI CviRI* | | || TspGWI | | |BspHI | | |FatI | | Hpy178III* | | CviAII | NlaIII EcoRV L I I R I S * K F F P K V L K K C N L I * L Y G Y H E N S F Q K Y * K N A I * Y D Y T D I M K I L S K S I E K M Q S D T ----:----|----:----|----:----|----:----|----:----|----:----| N I I R I D H F N K G F T N F F H L R I T S * V S I M F I R E L L I S F I C D S Q N Y P Y * S F E K W F Y Q F F A I Q Y MaeIII Tsp45I TatI | BssKI |Csp6I | SecI* ||RsaI | EcoRII ||SfaNI | | ScrFI |||Hpy166II | | BseBI |||| SfeI* | | | ApoI |||| |SetI | | | TspEI CviRI* |||| ||CviRI* \ \ \ \ \ \\\\ \\\ CCCAAGAGGCAAACGACATTGTGACCCTGGCAAATTTGCAATATAATGGCAGTACACCTG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTTCTCCGTTTGCTGTAACACTGGGACCGTTTAAACGTTATATTACCGTCATGTGGAC / /// / / /// // / | ||| | CviRI* ||| || CviRI* | ||| TspEI ||| |PstI | ||| ApoI ||| SfaNI | ||EcoRII ||TatI | ||BssKI ||SetI | |SecI* |Hpy166II | BseBI |Csp6I | ScrFI RsaI Tsp45I MaeIII P K R Q T T L * P W Q I C N I M A V H L P R G K R H C D P G K F A I * W Q Y T C Q E A N D I V T L A N L Q Y N G S T P A ----:----|----:----|----:----|----:----|----:----|----:----| G L L C V V N H G Q C I Q L I I A T C R V W S A F S M T V R A F K C Y L P L V G G L P L R C Q S G P L N A I Y H C Y V Q PstI | AarI | BspMI | |CviRI* MaeIII | || EcoT22I Tsp45I TaqI TspDTI BsmI \ \\ \ \ \ \ \ CAGATGCATTTGAAACAAAAGTCACAAACATTATCGACAGACTGAACAATAATGGCATTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTACGTAAACTTTGTTTTCAGTGTTTGTAATAGCTGTCTGACTTGTTATTACCGTAAG / / / / / / / / | | | BspMI Tsp45I TaqI TspDTI BsmI | | | AarI MaeIII | | CviRI* | EcoT22I SfeI* Q M H L K Q K S Q T L S T D * T I M A F R C I * N K S H K H Y R Q T E Q * W H S D A F E T K V T N I I D R L N N N G I H ----:----|----:----|----:----|----:----|----:----|----:----| C I C K F C F D C V N D V S Q V I I A N A S A N S V F T V F M I S L S F L L P M L H M Q F L L * L C * R C V S C Y H C E SetI | FatI | |CviAII | ||Cac8I | ||| SphI | ||| NspI | ||| NlaIII | ||| | TspEI | ||| | | MseI | ||| | | VspI | ||| | | |TspEI ApoI | ||| | | || MnlI SetI TspEI \ \\\ \ \ \\ \ \ \ ATATCAATAACAAGGTCGCATGCCAATTAATTATGAGAGGTCTATCTGGCGAATATAAAT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TATAGTTATTGTTCCAGCGTACGGTTAATTAATACTCTCCAGATAGACCGCTTATATTTA / / /// // / / SetI | ||FatI || | SetI | |CviAII || TspEI | Cac8I |VspI NlaIII |MseI NspI |MnlI SphI TspEI I S I T R S H A N * L * E V Y L A N I N Y Q * Q G R M P I N Y E R S I W R I * I I N N K V A C Q L I M R G L S G E Y K F ----:----|----:----|----:----|----:----|----:----|----:----| M D I V L D C A L * N H S T * R A F I F * I L L L T A H W N I I L P R D P S Y L Y * Y C P R M G I L * S L D I Q R I Y I AflIII | MaeII | |BtrI | || SetI | || TaiI Tsp4CI* Tsp4CI* | || | TaqI | AlwNI | DdeI EcoRV \ \\ \ \ \ \ \ \ \ TTTTACGCTACACACGTCATCGACATCTAAATATGACAGTCGCTGAACTGTTCTTAGATA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AAAATGCGATGTGTGCAGTAGCTGTAGATTTATACTGTCAGCGACTTGACAAGAATCTAT / / // / / / / / / TspEI | || TaqI | AlwNI Tsp4CI* | EcoRV ApoI | |AflIII Tsp4CI* DdeI | |MaeII | BtrI TaiI SetI F Y A T H V I D I * I * Q S L N C S * I F T L H T S S T S K Y D S R * T V L R Y L R Y T R H R H L N M T V A E L F L D I ----:----|----:----|----:----|----:----|----:----|----:----| K * A V C T M S M * I H C D S F Q E * I N K R * V R * R C R F I V T A S S N K S K V S C V D D V D L Y S L R Q V T R L Y MboI MboII |TspDTI ||DpnI |||TaqI FatI |||BstKTI |CviAII ||||Hpy178III* SetI BseMII || NlaIII ||||| BinI* TspEI |BspCNI \\ \ \\\\\ \ \ \\ TCCATGCTATTTATGAAGAACAACAGGGATCGAGAAACAGCAAACCTAATTACAGGAGAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTACGATAAATACTTCTTGTTGTCCCTAGCTCTTTGTCGTTTGGATTAATGTCCTCTT / // / // /// / / /// | |FatI | || ||| BinI* SetI ||BspCNI | CviAII | || ||Hpy178III* |BseMII NlaIII | || |TaqI TspEI | || MboI | |DpnI | BstKTI TspDTI MboII S M L F M K N N R D R E T A N L I T G E P C Y L * R T T G I E K Q Q T * L Q E K H A I Y E E Q Q G S R N S K P N Y R R N ----:----|----:----|----:----|----:----|----:----|----:----| D M S N I F F L L S R S V A F R I V P S I W A I * S S C C P D L F L L G L * L L G H * K H L V V P I S F C C V * N C S F TfiI HinfI | MboII | | TseI | | |BisI | | ||BlsI | | |||AluI DdeI | | |||CviJI |Hpy188I | | |||| SetI BbvI \\ \ \ \\\\ \ \ ATCTGAGTGATGAGAAGAATGATTCTCGCAGCTATACGAATACAACCAAACCCAAAGTTA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TAGACTCACTACTCTTCTTACTAAGAGCGTCGATATGCTTATGTTGGTTTGGGTTTCAAT / / // /// / | DdeI || ||CviJI BbvI Hpy188I || ||TseI || ||AluI || |BisI || BlsI || SetI |MboII HinfI TfiI I * V M R R M I L A A I R I Q P N P K L S E * * E E * F S Q L Y E Y N Q T Q S Y L S D E K N D S R S Y T N T T K P K V I ----:----|----:----|----:----|----:----|----:----|----:----| I Q T I L L I I R A A I R I C G F G F N F R L S S F F S E R L * V F V V L G L T D S H H S S H N E C S Y S Y L W V W L * TstI BssKI CviJI EcoRII AluI |SecI* CviJI ||ScrFI | SetI MnlI ||BseBI | | Hpy188I | TspEI ||| CviJI | | |TfiI | | TaqI ||| | SduI | | |HinfI | | AsuII TaqI ||| | HgiJII* \ \ \\ \ \ \ \ \\\ \ \ TAGCTCGGAATCCTCAAAAAACAAATAATTCGAAATCGAAAACAGCCAGGGCTCACAATG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| ATCGAGCCTTAGGAGTTTTTTGTTTATTAAGCTTTAGCTTTTGTCGGTCCCGAGTGTTAC / / / / / / / / / / //// | | | HinfI MnlI | AsuII | TstI | |||CviJI | | | TfiI | TaqI TaqI | ||EcoRII | | Hpy188I TspEI | ||BssKI | CviJI | ||SecI* | AluI | |HgiJII* SetI | |SduI | BseBI | ScrFI CviJI * L G I L K K Q I I R N R K Q P G L T M S S E S S K N K * F E I E N S Q G S Q C A R N P Q K T N N S K S K T A R A H N V ----:----|----:----|----:----|----:----|----:----|----:----| Y S P I R L F C I I R F R F C G P S V I I A R F G * F V F L E F D F V A L A * L L E S D E F F L Y N S I S F L W P E C H TspGWI TstI | BdaI | BseYI TfiI | BdaI BciVI | | GsaI HinfI | BccI \ \ \ \ \ \ \ TATCCACATCTAATAACTCTCCCAGCACGGACAACGATTCCATCAGTAAATCAACTACTG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGGTGTAGATTATTGAGAGGGTCGTGCCTGTTGCTAAGGTAGTCATTTAGTTGATGAC / / / / // / / | TstI | BseYI || | BccI BciVI GsaI || BdaI || BdaI |TspGWI HinfI TfiI Y P H L I T L P A R T T I P S V N Q L L I H I * * L S Q H G Q R F H Q * I N Y * S T S N N S P S T D N D S I S K S T T E ----:----|----:----|----:----|----:----|----:----|----:----| Y G C R I V R G A R V V I G D T F * S S T D V D L L E G L V S L S E M L L D V V I W M * Y S E W C P C R N W * Y I L * Q DdeI SauI* |SetI || Hin4II* || | BssKI XmnI || | CviJI |TfiI || | EcoRII |HinfI BdaI || | HaeIII || MfeI BdaI || | | ScrFI TfiI || TspEI | HphI SetI || | | BseBI HinfI \\ \ \ \ \ \\ \ \ \ \ AACCGATTCAATTGAACAATAAGCACGACCTTCACCTTAGGCCAGGAACTTACTGAATCT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGCTAAGTTAACTTGTTATTCGTGCTGGAAGTGGAATCCGGTCCTTGAATGACTTAGA / / / / / / / // / / / / | | TspEI | | SetI SetI || | | EcoRII HinfI | | MfeI | HphI || | | BssKI TfiI | HinfI BdaI || | BseBI | TfiI BdaI || | ScrFI XmnI || HaeIII || CviJI |SauI* |DdeI Hin4II* N R F N * T I S T T F T L G Q E L T E S T D S I E Q * A R P S P * A R N L L N L P I Q L N N K H D L H L R P G T Y * I Y ----:----|----:----|----:----|----:----|----:----|----:----| F R N L Q V I L V V K V K P W S S V S D S G I * N F L L C S R * R L G P V * Q I V S E I S C Y A R G E G * A L F K S F R Hpy178III* |TaqI BssKI || TfiI SecI* || MnlI EcoRII || HinfI MslI | ScrFI TspDTI || | Hin4II* Tsp4CI* |Hpy188I | BseBI | SetI || | |Hpy178III* \ \\ \ \ \ \ \\ \ \\ ACGGTAAATCACACTAATCATTCTGATGATGAACTCCCTGGACACCTCCTTCTCGATTCA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TGCCATTTAGTGTGATTAGTAAGACTACTACTTGAGGGACCTGTGGAGGAAGAGCTAAGT / / ///// // // Tsp4CI* Hpy188I ||||SetI || |HinfI MslI |||TspDTI || |TfiI ||EcoRII || Hin4II* ||BssKI |TaqI |SecI* Hpy178III* BseBI MnlI ScrFI T V N H T N H S D D E L P G H L L L D S R * I T L I I L M M N S L D T S F S I Q G K S H * S F * * * T P W T P P S R F R ----:----|----:----|----:----|----:----|----:----|----:----| V T F * V L * E S S S S G P C R R R S E * P L D C * D N Q H H V G Q V G G E R N R Y I V S I M R I I F E R S V E K E I * PsiI | HphI | MboI | BglII SfaNI | XhoII BspCNI Hpy178III* | | DpnI |BseMII | SfaNI | | |BstKTI DdeI || Hpy178III* \ \ \ \ \\ \ \\ \ GGAGCATCACGAACCCTTATAAGATCTGCTCACCACATACACTCAGCATCATCTAATCCT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CCTCGTAGTGCTTGGGAATATTCTAGACGAGTGGTGTATGTGAGTCGTAGTAGATTAGGA / / / / / // / / // // | | | | | || XhoII DdeI || |Hpy178III* | | | | | || BglII || SfaNI | | | | | || MboI |BseMII | | | | | |DpnI BspCNI | | | | | BstKTI | | | | HphI | | | PsiI | | SfaNI | Hpy178III* Hpy178III* G A S R T L I R S A H H I H S A S S N P E H H E P L * D L L T T Y T Q H H L I L S I T N P Y K I C S P H T L S I I * S * ----:----|----:----|----:----|----:----|----:----|----:----| P A D R V R I L D A * W M C E A D D L G L L M V F G * L I Q E G C V S L M M * D S C * S G K Y S R S V V Y V * C * R I R SfaNI | MaeII MaeIII | | SetI TspEI Tsp45I | | TaiI | MseI BstEII SetI \ \ \ \ \ \ \ GACATAAACGTAGTTGATGCTCAAAAAAGAAATATACCAATTAACGCTATTGGTGACCTA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTATTTGCATCAACTACGAGTTTTTTCTTTATATGGTTAATTGCGATAACCACTGGAT / / // / / | MaeII |MseI | BstEII | SfaNI TspEI | Tsp45I TaiI | MaeIII SetI SetI D I N V V D A Q K R N I P I N A I G D L T * T * L M L K K E I Y Q L T L L V T Y H K R S * C S K K K Y T N * R Y W * P T ----:----|----:----|----:----|----:----|----:----|----:----| S M F T T S A * F L F I G I L A I P S R Q C L R L Q H E F F F Y V L * R * Q H G V Y V Y N I S L F S I Y W N V S N T V * PfoI BssKI EcoRII TspEI | ScrFI SetI | HphI | BseBI | CviRI* \ \ \ \ \ \ CAATTTCACTTCCAGGACAACACCAAAACATCAATAAAGGTATTGCACACTCCTAACATA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAAAGTGAAGGTCCTGTTGTGGTTTTGTAGTTATTTCCATAACGTGTGAGGATTGTAT / / / / / / | TspEI | EcoRII SetI CviRI* HphI | BssKI | PfoI BseBI ScrFI Q F H F Q D N T K T S I K V L H T P N I N F T S R T T P K H Q * R Y C T L L T * I S L P G Q H Q N I N K G I A H S * H S ----:----|----:----|----:----|----:----|----:----|----:----| C N * K W S L V L V D I F T N C V G L M V I E S G P C C W F M L L P I A C E * C L K V E L V V G F C * Y L Y Q V S R V Y TspEI |BspCNI ||BseMII ||| TseI ||| CviJI ||| |BisI ||| |SfeI* FatI ||| ||BlsI |CviAII ||| |||CviRI* ||Cac8I ||| |||| PstI ||| SphI ||| |||| | TspDTI ||| NspI CviJI DdeI BbvI ||| |||| | | EcoRV ||| NlaIII \ \ \ \\\ \\\\ \ \ \ \\\ \ GCCTATGACTTACTCAGTTTGAATGAATTGGCTGCAGTAGATATCACAGCATGCTTTACC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CGGATACTGAATGAGTCAAACTTACTTAACCGACGTCATCTATAGTGTCGTACGAAATGG / / / // / //// / / / /// CviJI DdeI | || | |||| | EcoRV | ||FatI | || | |||| TspDTI | |CviAII | || | |||| SfeI* | Cac8I | || | |||CviRI* NlaIII | || | |||TseI NspI | || | ||BisI SphI | || | |BlsI | || | |PstI | || | CviJI | || TspEI | |BseMII | BspCNI BbvI A Y D L L S L N E L A A V D I T A C F T P M T Y S V * M N W L Q * I S Q H A L P L * L T Q F E * I G C S R Y H S M L Y Q ----:----|----:----|----:----|----:----|----:----|----:----| A * S K S L K F S N A A T S I V A H K V L R H S V * N S H I P Q L L Y * L M S * G I V * E T Q I F Q S C Y I D C C A K G TatI Tsp4CI* |Csp6I ||RsaI MaeII |||TspRI | SetI |||| CviRI* | TaiI Tsp4CI* |||| | BceAI | |DdeI | Hpy188I |||| | | SetI BsmAI \ \\ \ \ \\\\ \ \ \ \ AAAAACGTCTTAGAACGGTCTGACGGCACTGTACTTGCACCTATCGTAAAATATGGAGAC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTGCAGAATCTTGCCAGACTGCCGTGACATGAACGTGGATAGCATTTTATACCTCTG / / / / / / / /// // / / | | | | | | | ||| || BceAI BsmAI | | | | | | | ||| |SetI | | | | | | | ||| CviRI* | | | | | | | ||TatI | | | | | | | |Csp6I | | | | | | | RsaI | | | | | | Tsp4CI* | | | | | TspRI | | | | Hpy188I | | | Tsp4CI* | | DdeI | MaeII TaiI SetI K N V L E R S D G T V L A P I V K Y G D K T S * N G L T A L Y L H L S * N M E T K R L R T V * R H C T C T Y R K I W R L ----:----|----:----|----:----|----:----|----:----|----:----| L F T K S R D S P V T S A G I T F Y P S W F R R L V T Q R C Q V Q V * R L I H L F V D * F P R V A S Y K C R D Y F I S V TatI |Csp6I ||RsaI TspGWI Csp6I BsrI BfiI ||ScaI | BccI |RsaI \ \ \\\ \ \ \\ TTTTACTGGGTATCTAAAAAGTACTTGCTTCCATCAAATATCTCCGTACCCACCATCAAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| AAAATGACCCATAGATTTTTCATGAACGAAGGTAGTTTATAGAGGCATGGGTGGTAGTTA / / /// / / // BsrI BfiI ||TatI TspGWI BccI |Csp6I |Csp6I RsaI ScaI RsaI F Y W V S K K Y L L P S N I S V P T I N F T G Y L K S T C F H Q I S P Y P P S I L L G I * K V L A S I K Y L R T H H Q * ----:----|----:----|----:----|----:----|----:----|----:----| K * Q T D L F Y K S G D F I E T G V M L S K S P I * F T S A E M L Y R R V W W * K V P Y R F L V Q K W * I D G Y G G D I TatI |Csp6I TaqI ||RsaI TspDTI |AlfI BsmI BccI MslI |||Hpy166II | TspDTI |AlfI Cac8I \ \ \\\\ \ \ \\ \ AATGTCCATACAAGTGAAAGTACACGCAAATATCCTTATCCTTTCATTCATCGAATGCTT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAGGTATGTTCACTTTCATGTGCGTTTATAGGAATAGGAAAGTAAGTAGCTTACGAA / / /// / / / / / / BccI MslI ||TatI | TspDTI | | | Cac8I |Hpy166II TspDTI | | BsmI |Csp6I | TaqI RsaI AlfI AlfI N V H T S E S T R K Y P Y P F I H R M L M S I Q V K V H A N I L I L S F I E C L C P Y K * K Y T Q I S L S F H S S N A C ----:----|----:----|----:----|----:----|----:----|----:----| L T W V L S L V R L Y G * G K M * R I S Y H G Y L H F Y V C I D K D K * E D F A I D M C T F T C A F I R I R E N M S H K Hin6I |GlaI |MstI* ||FatI ||HhaI |||CviAII MaeII ||||Cac8I |BsaAI ||||| SphI TspEI || SetI ||||| NspI | TaqI || TaiI ||||| NlaIII | | AlfI || BccI ||||| |MslI CviRI* | | AlfI MseI || | MseI \\\\\ \\ \ \ \ \ \ \\ \ \ GCGCATGCCAATGCACAGACAATTCGATACTCACTTAAAAATAACACCATCACGTATTTT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CGCGTACGGTTACGTGTCTGTTAAGCTATGAGTGAATTTTTATTGTGGTAGTGCATAAAA /// //// / / / / / // / ||| |||MslI CviRI* | TaqI MseI | || BccI ||| ||FatI TspEI | |MaeII ||| |CviAII AlfI | BsaAI ||| Cac8I AlfI TaiI ||NlaIII SetI ||Hin6I ||NspI ||SphI |MstI* |GlaI HhaI A H A N A Q T I R Y S L K N N T I T Y F R M P M H R Q F D T H L K I T P S R I L A C Q C T D N S I L T * K * H H H V F * ----:----|----:----|----:----|----:----|----:----|----:----| A C A L A C V I R Y E S L F L V M V Y K Q A H W H V S L E I S V * F Y C W * T N R M G I C L C N S V * K F I V G D R I K TfiI HinfI | Hpy188I | | SalI | | |TaqI | | |AccI | | ||HindII | | ||Hpy166II | | ||| BsrI Hpy178III* | | ||| |MaeI | MseI \ \ \\\ \\ \ \ AACGAATCAGATGTCGACTGGTCTAGTGCTATTGACTATCAATGTCCTGATTGTTTAATC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTTAGTCTACAGCTGACCAGATCACGATAACTGATAGTTACAGGACTAACAAATTAG / // /// / / / / MseI || ||| BsrI MaeI | MseI || ||SalI Hpy178III* || |AccI || |TaqI || Hpy166II || HindII |Hpy188I HinfI TfiI N E S D V D W S S A I D Y Q C P D C L I T N Q M S T G L V L L T I N V L I V * S R I R C R L V * C Y * L S M S * L F N R ----:----|----:----|----:----|----:----|----:----|----:----| L S D S T S Q D L A I S * * H G S Q K I * R I L H R S T * H * Q S D I D Q N N L V F * I D V P R T S N V I L T R I T * D SetI |Hpy166II ||Hpy178III* ApoI ||| TspDTI TspEI \\\ \ \ GGCAAAAGCACCAAACACAGACATATCAAAGGTTCACGACTAAAATACCAAAATTCATAC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTTTTCGTGGTTTGTGTCTGTATAGTTTCCAAGTGCTGATTTTATGGTTTTAAGTATG / / / / / SetI | | TspDTI TspEI | Hpy178III* ApoI Hpy166II G K S T K H R H I K G S R L K Y Q N S Y A K A P N T D I S K V H D * N T K I H T Q K H Q T Q T Y Q R F T T K I P K F I R ----:----|----:----|----:----|----:----|----:----|----:----| P L L V L C L C I L P E R S F Y W F E Y R C F C W V C V Y * L N V V L I G F N M A F A G F V S M D F T * S * F V L I * V AsuI* AvaII |BmgT120I || Hpy166II || | SetI XmnI SetI || BsrI | |FokI ApaLI \ \ \\ \ \ \\ \ GAACCCTTTCAATACCTACATACTGACATATTTGGTCCAGTTCACAACCTACCAAATAGT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGGGAAAGTTATGGATGTATGACTGTATAAACCAGGTCAAGTGTTGGATGGTTTATCA / / /// / / / / XmnI SetI ||| | SetI | HgiAI* ||| Hpy166II | BseSI ||AvaII | SduI ||AsuI* FokI |BmgT120I BsrI E P F Q Y L H T D I F G P V H N L P N S N P F N T Y I L T Y L V Q F T T Y Q I V T L S I P T Y * H I W S S S Q P T K * C ----:----|----:----|----:----|----:----|----:----|----:----| S G K * Y R C V S M N P G T * L R G F L R V R E I G V Y Q C I Q D L E C G V L Y F G K L V * M S V Y K T W N V V * W I T CviRI* Hpy166II | SduI | BseSI | TspDTI TspGWI | HgiAI* | ApoI | |BseGI BccI BsmAI | TspEI \ \\ \ \ \ \ GCACCATCCTATTTCATCTCATTTACTGATGAGACAACAAAATTCCGTTGGGTTTATCCA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGGTAGGATAAAGTAGAGTAAATGACTACTCTGTTGTTTTAAGGCAACCCAAATAGGT /// / / / / ||ApaLI BccI | TspGWI TspEI |BseGI BsmAI ApoI Hpy166II CviRI* TspDTI A P S Y F I S F T D E T T K F R W V Y P H H P I S S H L L M R Q Q N S V G F I H T I L F H L I Y * * D N K I P L G L S I ----:----|----:----|----:----|----:----|----:----|----:----| A G D * K M E N V S S V V F N R Q T * G H V M R N * R M * Q H S L L I G N P K D C W G I E D * K S I L C C F E T P N I W MnlI McrI* |Tsp4CI* || MlyI || PleI || Hpy178III* || |NruI || |Hpy99I MaeI || |FnuDII* | AluI || ||BsiYI* | CviJI || ||| HinfI TaqI MnlI | | SetI MseI \\ \\\ \ \ \ \ \ \ \ TTACACGACCGTCGCGAGGACTCTATCCTCGATGTTTTTACTACGATACTAGCTTTTATT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTGCTGGCAGCGCTCCTGAGATAGGAGCTACAAAAATGATGCTATGATCGAAAATAA /// //// / / / /// ||| |||| HinfI TaqI MnlI ||CviJI ||| |||Hpy178III* ||AluI ||| ||FnuDII* |MaeI ||| ||NruI SetI ||| ||PleI ||| |MlyI ||| BsiYI* ||Tsp4CI* ||Hpy99I |MnlI McrI* L H D R R E D S I L D V F T T I L A F I Y T T V A R T L S S M F L L R Y * L L L T R P S R G L Y P R C F Y Y D T S F Y * ----:----|----:----|----:----|----:----|----:----|----:----| N C S R R S S E I R S T K V V I S A K I M V R G D R P S * G R H K * * S V L K * * V V T A L V R D E I N K S R Y * S K N AsuI* AvaII |BmgT120I ||BseMII |||SecI* |||DsaI* |||BspCNI ||||Tsp4CI* ||||| DdeI BsiYI* ||||| |Hpy188I | CviJI ||||| || AccI | HaeIII DdeI ||||| || |BssNAI BsrI | |BsrI TspRI ||||| || |Hpy166II \ \ \\ \ \\\\\ \\ \\ AAAAACCAGTTTCAGGCCAGTGTCTTAGTTATACAAATGGACCGTGGTTCTGAGTATACT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTGGTCAAAGTCCGGTCACAGAATCAATATGTTTACCTGGCACCAAGACTCATATGA / / / // / //// / / / // | BsrI | |HaeIII DdeI |||| | | | |AccI MseI | |CviJI |||| | | | Hpy166II | TspRI |||| | | | BssNAI | BsrI |||| | | DdeI BsiYI* |||| | Hpy188I |||| DsaI* |||| SecI* |||Tsp4CI* |||AvaII |||AsuI* ||BmgT120I |BspCNI BseMII K N Q F Q A S V L V I Q M D R G S E Y T K T S F R P V S * L Y K W T V V L S I L K P V S G Q C L S Y T N G P W F * V Y * ----:----|----:----|----:----|----:----|----:----|----:----| L F W N * A L T K T I C I S R P E S Y V * F G T E P W H R L * V F P G H N Q T Y F V L K L G T D * N Y L H V T T R L I S FatI ApoI |CviAII TspEI || NlaIII \ \\ \ AACAGAACTCTCCATAAATTCCTTGAAAAAAAAATGGTATAACTCCATGCTATACAACCA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTCTTGAGAGGTATTTAAGGAACTTTTTTTTTACCATATTGAGGTACGATATGTTGGT / / // TspEI | |FatI ApoI | CviAII NlaIII N R T L H K F L E K K M V * L H A I Q P T E L S I N S L K K K W Y N S M L Y N H Q N S P * I P * K K N G I T P C Y T T T ----:----|----:----|----:----|----:----|----:----|----:----| L L V R W L N R S F F I T Y S W A I C G * C F E G Y I G Q F F F P I V G H * V V V S S E M F E K F F F H Y L E M S Y L W AciI NspBII* | TfiI | HinfI | | AvaI | | Hpy178III* | | |BmeT110I | | || FatI Tsp4CI* | | || SduI |Csp6I | | || HgiAI* ||RsaI | | || |CviAII PleI ||| BceAI | | || || NlaIII |MlyI ||| | SetI | | || || |HinfI || CviJI ||| | BceAI \ \ \\ \\ \\ \\ \ \\\ \ \ CAGCGGATTCCCGAGCACATGGAGTCGCTGAACGGCTAAACCGTACCTTATTAGATGACT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGCCTAAGGGCTCGTGTACCTCAGCGACTTGCCGATTTGGCATGGAATAATCTACTGA / / / /// / // / / / / // / / | | | ||| | || HinfI | CviJI | || | BceAI | | | ||| | |FatI PleI | || BceAI | | | ||| | CviAII MlyI | |Csp6I | | | ||| NlaIII | RsaI | | | ||AvaI | SetI | | | |BmeT110I Tsp4CI* | | | |HgiAI* | | | |SduI | | | Hpy178III* | | HinfI | | TfiI | AciI NspBII* Q R I P E H M E S L N G * T V P Y * M T S G F P S T W S R * T A K P Y L I R * L A D S R A H G V A E R L N R T L L D D C ----:----|----:----|----:----|----:----|----:----|----:----| C R I G S C M S D S F P * V T G * * I V V A S E R A C P T A S R S F R V K N S S L P N G L V H L R Q V A L G Y R I L H S CviRI* | TaqI Csp6I | | ApoI |RsaI CviRI* BsrDI Hpy166II | | TspEI \\ \ \ \ \ \ \ GCCGTACTCAACTGCAATGTAGTGGTTTACCGAACCATTTATGGTTCTCTGCAATCGAAT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCATGAGTTGACGTTACATCACCAAATGGCTTGGTAAATACCAAGAGACGTTAGCTTA // / / / / / |Csp6I | BsrDI Hpy166II | TaqI RsaI CviRI* CviRI* A V L N C N V V V Y R T I Y G S L Q S N P Y S T A M * W F T E P F M V L C N R I R T Q L Q C S G L P N H L W F S A I E F ----:----|----:----|----:----|----:----|----:----|----:----| A T S L Q L T T T * R V M * P E R C D F Q R V * S C H L P K G F W K H N E A I S G Y E V A I Y H N V S G N I T R Q L R I ApoI TspEI | HphI | | MaeI | | | AluI | | | CviJI FatI | | | | SetI SetI CviRI* |CviAII \ \ \ \ \ \ \ \\ TTTCTACTATTGTGAGAAATTCACTAGCTTCACCTAAAAGCAAAAAATCTGCAAGACAAC 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGATGATAACACTCTTTAAGTGATCGAAGTGGATTTTCGTTTTTTAGACGTTCTGTTG / / /// / / / TspEI | ||| SetI CviRI* NlaIII ApoI | ||CviJI NspI | ||AluI | |MaeI | SetI TspEI ApoI HphI F L L L * E I H * L H L K A K N L Q D N F Y Y C E K F T S F T * K Q K I C K T T S T I V R N S L A S P K S K K S A R Q H ----:----|----:----|----:----|----:----|----:----|----:----| K R S N H S I * * S * R F A F F R C S L N E V I T L F E S A E G L L L F D A L C K * * Q S F N V L K V * F C F I Q L V V EcoRV | TatI | |Csp6I NspI | ||RsaI NlaIII | ||ScaI | Cac8I | ||| TaqII | | Hin4I | ||| |MaeIII | | Hin4I | ||| || Hin4I HindII | | CviJI | ||| || Hin4I Hpy166II | | | MwoI | ||| || | SetI | SetI \ \ \ \ \ \\\ \\ \ \ \ \ ATGCTGGCTTGGCAGGACTTGATATCAGTACTTTGTTACCTTTCGGTCAACCTGTTATCG 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TACGACCGAACCGTCCTGAACTATAGTCATGAAACAATGGAAAGCCAGTTGGACAATAGC // /// / /// / / / // / || ||CviJI EcoRV ||| | | MaeIII |SetI BsaXI || |MwoI ||| | SetI Hpy166II || Cac8I ||| Hin4I HindII |FatI ||| Hin4I CviAII ||TaqII Hin4I ||TatI Hin4I |Csp6I ScaI RsaI M L A W Q D L I S V L C Y L S V N L L S C W L G R T * Y Q Y F V T F R S T C Y R A G L A G L D I S T L L P F G Q P V I V ----:----|----:----|----:----|----:----|----:----|----:----| M S A Q C S K I D T S Q * R E T L R N D C A P K A P S S I L V K N G K P * G T I H Q S P L V Q Y * Y K T V K R D V Q * R BseGI | MnlI | |BssKI | |SecI* | |EcoRII | || FokI | || MwoI BsaXI FokI | || ScrFI | MboI | BseGI | || BseBI | BclI | | BsaXI | || | CviJI | | DpnI | | |MslI | || | SfaNI | | |BstKTI FokI | | |BsiI* | || | | TspGWI BseGI \ \ \\ \ \ \ \\ \ \\ \ \ \ \ TCAATGATCACAACCCTAACTCCAAAATACATCCTCGTGGCATCCCAGGCTACGCTCTAC 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTACTAGTGTTGGGATTGAGGTTTTATGTAGGAGCACCGTAGGGTCCGATGCGAGATG // / / / // / / // //// / / || BclI FokI | || | | || |||| | BseGI || MboI | || | | || |||| SfaNI |DpnI | || | | || |||TspGWI BstKTI | || | | || |||FokI | || | | || ||EcoRII | || | | || ||BssKI | || | | || ||CviJI | || | | || |SecI* | || | | || BseBI | || | | || ScrFI | || | | |MwoI | || | | MnlI | || | BsiI* | || | BseGI | || MslI | |FokI | BsaXI BseGI S M I T T L T P K Y I L V A S Q A T L Y Q * S Q P * L Q N T S S W H P R L R S T N D H N P N S K I H P R G I P G Y A L H ----:----|----:----|----:----|----:----|----:----|----:----| D I I V V R V G F Y M R T A D W A V S * T L S * L G L E L I C G R P M G P * A R * H D C G * S W F V D E H C G L S R E V Hpy178III* |TaqI || BsmAI || Esp3I MseI || | Hin4I MboII Hin4I Tsp4CI* || | Hin4I |TspGWI Hin4I |BbvII* \\ \ \ \\ \ \\ ATCCGTCTCGAAACTCTTATGGATATATCATCTATCTTCCGTCCTTAAAGAAGACAGTAG 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGCAGAGCTTTGAGAATACCTATATAGTAGATAGAAGGCAGGAATTTCTTCTGTCATC /// / / / / / ||| Esp3I TspGWI Hin4I MseI Tsp4CI* ||| BsmAI MboII Hin4I ||TaqI |Hpy178III* Hin4I Hin4I I R L E T L M D I S S I F R P * R R Q * S V S K L L W I Y H L S S V L K E D S R P S R N S Y G Y I I Y L P S L K K T V D ----:----|----:----|----:----|----:----|----:----|----:----| M R R S V R I S I D D I K R G * L L C Y C G D R F E * P Y I M * R G D K F F V T D T E F S K H I Y * R D E T R L S S L L TfiI HinfI | Hpy178III* | | MboI MboII | | | DpnI | Eco57I | | | |BstKTI | Eco57MI | | | ||TspEI | | MboII | | | ||| TspEI \ \ \ \ \ \ \\\ \ ATACAACTAACTATGTTATTCTTCAGGGCAAGGAATCCAGATTAGATCAATTCAATTACG 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| TATGTTGATTGATACAATAAGAAGTCCCGTTCCTTAGGTCTAATCTAGTTAAGTTAATGC / / / / / // / / // | | MboII | | || | | |Hpy99I | Eco57MI | | || | | TspEI | Eco57I | | || | TspEI BbvII* | | || MboI MboII | | |DpnI | | BstKTI | Hpy178III* HinfI TfiI I Q L T M L F F R A R N P D * I N S I T Y N * L C Y S S G Q G I Q I R S I Q L R T T N Y V I L Q G K E S R L D Q F N Y D ----:----|----:----|----:----|----:----|----:----|----:----| I C S V I N N K L A L F G S * I L E I V S V V L * T I R * P L S D L N S * N L * Y L * S H * E E P C P I W I L D I * N R MseI |BbvII* || MboII Hpy99I || Tsp4CI* | HgaI || |TspDTI TspDTI | | TaqI || || MseI | HgaI BsrDI \ \ \ \\ \\ \ \ \ \ ACGCACTCACTTTCGATGAAGACTTAAACCGTTTAACTGCTTCATATCATTCGTTCATTG 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| TGCGTGAGTGAAAGCTACTTCTGAATTTGGCAAATTGACGAAGTATAGTAAGCAAGTAAC // / / / / // |TaqI | | MseI TspDTI |HgaI HgaI | Tsp4CI* BsrDI | TspDTI | BbvII* | MboII MseI T H S L S M K T * T V * L L H I I R S L R T H F R * R L K P F N C F I S F V H C A L T F D E D L N R L T A S Y H S F I A ----:----|----:----|----:----|----:----|----:----|----:----| V C E S E I F V * V T * S S * I M R E N S A S V K S S S K F R K V A E Y * E N M R V * K R H L S L G N L Q K M D N T * Q TfiI BinI* HinfI | MboI | Hin4I | XhoII | Hin4I | | DpnI MboI | | Hpy188I | | |BstKTI | DpnI | | | FatI | | || TfiI | |BstKTI | | | |CviAII | | || HinfI | || MseI | | | || NlaIII \ \ \\ \ \ \\ \ \ \ \ \\ \ CGTCAAATGAGATCCAAGAATCCAATGATCTTAACATAGAATCTGACCATGACTTCCAAT 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGTTTACTCTAGGTTCTTAGGTTACTAGAATTGTATCTTAGACTGGTACTGAAGGTTA / // / / // / / / // / // | || XhoII HinfI || | | | || | |FatI | || MboI TfiI || | | | || | CviAII | |DpnI || | | | || NlaIII | BstKTI || | | | |Hpy188I BinI* || | | | HinfI || | | | TfiI || | | Hin4I || | | Hin4I || | MseI || MboI |DpnI BstKTI R Q M R S K N P M I L T * N L T M T S N V K * D P R I Q * S * H R I * P * L P I S N E I Q E S N D L N I E S D H D F Q S ----:----|----:----|----:----|----:----|----:----|----:----| R * I L D L F G I I K V Y F R V M V E L A D F S I W S D L S R L M S D S W S K W T L H S G L I W H D * C L I Q G H S G I BseMII |BspCNI || BseGI || Hin4I || Hin4I || | Hpy178III* AluI || | |DdeI CviJI FokI || | |Bpu10I | SetI |Hpy188I || | || MmeI | | HinfI \\ \\ \ \\ \ \ \ \ CCGACATTGAACTACATCCTGAGCAACCGAGAAATGTCCTTTCAAAAGCTGTGAGTCCAA 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| GGCTGTAACTTGATGTAGGACTCGTTGGCTCTTTACAGGAAAGTTTTCGACACTCAGGTT / / // / / // / / / | | || BseGI | |MmeI | CviJI HinfI | | |BspCNI | Bpu10I | AluI | | |Hin4I | DdeI SetI | | |Hin4I Hpy178III* | | BseMII | FokI Hpy188I P T L N Y I L S N R E M S F Q K L * V Q R H * T T S * A T E K C P F K S C E S N D I E L H P E Q P R N V L S K A V S P T ----:----|----:----|----:----|----:----|----:----|----:----| G V N F * M R L L R S I D K * F S H T W D S M S S C G S C G L F T R E F A T L G R C Q V V D Q A V S F H G K L L Q S D L TfiI HinfI | TaqI | AsuII PleI | | MaeII |MlyI HindII | | AflIII ||TfiI Hpy166II | | |MboII ||HinfI | MmeI | | || SetI Eco57I |||TspGWI SetI | |MnlI | | || TaiI Eco57MI SspI \\\\ \ \ \\ \ \ \\ \ \ \ CCGATTCCACACCTCCGTCAACTCATACTGAAGATTCGAAACGTGTTTCTAAAACCAATA 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| GGCTAAGGTGTGGAGGCAGTTGAGTATGACTTCTAAGCTTTGCACAAAGATTTTGGTTAT / / / / / / / // / / / / | | SetI | MnlI | | || | | Eco57MI SspI | HinfI Hpy166II | | || | | Eco57I | TfiI HindII | | || | AflIII TspGWI MmeI | | || MaeII PleI | | |MboII MlyI | | TaiI | | SetI | AsuII | TaqI HinfI TfiI P I P H L R Q L I L K I R N V F L K P I R F H T S V N S Y * R F E T C F * N Q Y D S T P P S T H T E D S K R V S K T N I ----:----|----:----|----:----|----:----|----:----|----:----| G I G C R R * S M S F I R F T N R F G I V S E V G G D V * V S S E F R T E L V L R N W V E T L E Y Q L N S V H K * F W Y Hpy188I Hin6I |TfiI FnuDII* HindII |HinfI |GlaI Hpy166II || MboII Ksp632I* ||HhaI | TaqII || | SspI | BccI \\\ \ \ \\ \ \ \ \ TTCGCGCACCCAGAGAAGTTGACCCCAACATATCTGAATCTAATATTCTTCCATCAAAGA 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCGCGTGGGTCTCTTCAACTGGGGTTGTATAGACTTAGATTATAAGAAGGTAGTTTCT /// // / // / / / ||Hin6I |TaqII | || SspI | BccI |GlaI Hpy166II | |HinfI Ksp632I* FnuDII* HindII | |TfiI HhaI | MboII Hpy188I F A H P E K L T P T Y L N L I F F H Q R S R T Q R S * P Q H I * I * Y S S I K E R A P R E V D P N I S E S N I L P S K K ----:----|----:----|----:----|----:----|----:----|----:----| N A C G S F N V G V Y R F R I N K W * L I R A G L S T S G L M D S D L I R G D F E R V W L L Q G W C I Q I * Y E E M L S TaqI MboI |Hpy178III* BglII || Csp6I XhoII || |RsaI | DpnI || ||AgeI CviRI* | |BstKTI || ||BetI* | PpiI | ||MaeI ApoI || ||Cfr10I | EcoT22I | ||| MboII TspEI PpiI || |||HpaII | | TspEI \ \\\ \ \ \ \\ \\\\ \ \ \ AGAGATCTAGCACCCCCCAAATTTCCAATATCGAGAGTACCGGTTCGGGTGGTATGCATA 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTAGATCGTGGGGGGTTTAAAGGTTATAGCTCTCATGGCCAAGCCCACCATACGTAT // / // / / // // // // / || | |MboII | TspEI || || |Cfr10I || CviRI* || | MaeI | ApoI || || |BetI* |EcoT22I || XhoII PpiI || || |AgeI PpiI || BglII || || HpaII || MboI || |Csp6I |DpnI || RsaI BstKTI |Hpy178III* TaqI R D L A P P K F P I S R V P V R V V C I E I * H P P N F Q Y R E Y R F G W Y A * R S S T P Q I S N I E S T G S G G M H K ----:----|----:----|----:----|----:----|----:----|----:----| L S R A G G L N G I D L T G T R T T H M F L D L V G W I E L I S L V P E P P I C S I * C G G F K W Y R S Y R N P H Y A Y FatI PleI FatI |CviAII Hpy99I |CviAII || HinfI |MlyI MseI BslFI || NlaIII || NlaIII ||Cac8I \ \ \\ \ \\ \ \\\ AATTAAATGTTCCTTTACTTGCTCCCATGTCCCAATCTAACACACATGAGTCGTCGCACG 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| TTAATTTACAAGGAAATGAACGAGGGTACAGGGTTAGATTGTGTGTACTCAGCAGCGTGC // / / // / // / /// |MseI BslFI | |FatI | || | ||BsrI TspEI | CviAII | || | |Cac8I NlaIII | || | PleI | || | MlyI | || Hpy99I | || HinfI | |FatI | CviAII NlaIII N * M F L Y L L P C P N L T H M S R R T I K C S F T C S H V P I * H T * V V A R L N V P L L A P M S Q S N T H E S S H A ----:----|----:----|----:----|----:----|----:----|----:----| F * I N R * K S G H G L R V C M L R R V L N F T G K S A G M D W D L V C S D D C I L H E K V Q E W T G I * C V H T T A R Hpy188I | MlyI | PleI | | DdeI | | | Hpy188I | | | |HinfI | | | || Csp6I | | | || |BdaI | | | || |BdaI | | | || |RsaI | | | || || BspCNI | | | || || Tsp4CI* | | | || || |BseMII | | | || || || BsmAI | | | || || || | TspRI BsrI | | | || || || | | BaeI \ \ \ \ \\ \\ \\ \ \ \ CCAGTAAATCTAAAGATTTCAGACACTCAGACTCGTACAGTGAAAATGAGACTAATCATA 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCATTTAGATTTCTAAAGTCTGTGAGTCTGAGCATGTCACTTTTACTCTGATTAGTAT / // // ////// / / | || || |||||| | BsmAI | || || |||||| BaeI | || || |||||Tsp4CI* | || || |||||BseMII | || || ||||BspCNI | || || ||||Csp6I | || || |||RsaI | || || ||TspRI | || || |BdaI | || || |BdaI | || || HinfI | || |DdeI | || Hpy188I | |PleI | MlyI Hpy188I P V N L K I S D T Q T R T V K M R L I I Q * I * R F Q T L R L V Q * K * D * S Y S K S K D F R H S D S Y S E N E T N H T ----:----|----:----|----:----|----:----|----:----|----:----| G T F R F I E S V * V R V T F I L S I M A L L D L S K L C E S E Y L S F S V L * W Y I * L N * V S L S T C H F H S * D Y MaeII | Csp6I Acc65I | |RsaI HgiCI* | |SetI BsrI |Csp6I | |TaiI | Csp6I ||RsaI MaeIII | || BdaI | |RsaI ||NlaIV Tsp4CI* Tsp45I | || BdaI | || BaeI ||| KpnI | AciI | BsmAI \ \\ \ \ \\ \ \\\ \ \ \ \ \ CAAACGTACCAATATCCAGTACGGGTGGTACCAACAACAAAACTGTTCCGCAGATAAGTG 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTGCATGGTTATAGGTCATGCCCACCATGGTTGTTGTTTTGACAAGGCGTCTATTCAC / /// / / // / /// / / // | ||Csp6I | | |Csp6I | ||HgiCI* | AciI |BspCNI | ||BdaI | | RsaI | ||Acc65I Tsp4CI* BseMII | ||BdaI | BaeI | |Csp6I | |RsaI BsrI | NlaIV | MaeII | RsaI TaiI KpnI SetI Q T Y Q Y P V R V V P T T K L F R R * V K R T N I Q Y G W Y Q Q Q N C S A D K * N V P I S S T G G T N N K T V P Q I S D ----:----|----:----|----:----|----:----|----:----|----:----| C V Y W Y G T R T T G V V F S N R L Y T V F T G I D L V P P V L L L V T G C I L L R V L I W Y P H Y W C C F Q E A S L H Tsp4CI* BtgZI | Hpy166II TaqI |BetI* BseMII | | SfaNI ClaI ||HpaII |BspCNI DdeI HphI | | | SetI | Hin4II* |||TspDTI \\ \ \ \ \ \ \ \ \ \\\\ ACCAAGAGACTGAGAAAAGGATTATACACCGTTCACCTTCAATCGATGCTTCTCCACCGG 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTCTCTGACTCTTTTCCTAATATGTGGCAAGTGGAAGTTAGCTACGAAGAGGTGGCC / / / / / // / / / // | BsmAI DdeI HphI | |SetI SfaNI Hin4II* | |BetI* Tsp45I | Hpy166II ClaI | HpaII MaeIII Tsp4CI* TaqI | BtgZI TspDTI T K R L R K G L Y T V H L Q S M L L H R P R D * E K D Y T P F T F N R C F S T G Q E T E K R I I H R S P S I D A S P P E ----:----|----:----|----:----|----:----|----:----|----:----| V L L S L F P N Y V T * R * D I S R W R S W S V S F L I I C R E G E I S A E G G G L S Q S F S * V G N V K L R H K E V P Tsp4CI* | Hpy188I TspEI SspI AjuI | | MnlI \ \ \ \ \ \ AAAATAATTCATCGCACAATATTGTTCCTATCAAAACGCCAACTACTGTTTCTGAACAGA 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTATTAAGTAGCGTGTTATAACAAGGATAGTTTTGCGGTTGATGACAAAGACTTGTCT / / / / / // TspEI SspI AjuI | | |AjuI | | MnlI | Hpy188I Tsp4CI* K I I H R T I L F L S K R Q L L F L N R K * F I A Q Y C S Y Q N A N Y C F * T E N N S S H N I V P I K T P T T V S E Q N ----:----|----:----|----:----|----:----|----:----|----:----| F I I * R V I N N R D F R W S S N R F L S F L E D C L I T G I L V G V V T E S C F Y N M A C Y Q E * * F A L * Q K Q V S MboI | DpnI | |BstKTI | || GsuI | || Eco57MI | || | MboI | || | | DpnI | || | | |BstKTI BtgZI | || | | || SetI | AjuI | || | | || |Hpy178III* | SecI* | || | | || || TfiI | | TfiI | || | | || || HinfI | | HinfI | || | | || || | MnlI \ \ \ \ \\ \ \ \\ \\ \ \ ATACCGAGGAATCTATCATCGCTGATCTCCCACTCCCTGATCTACCTCCAGAATCTCCTA 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| TATGGCTCCTTAGATAGTAGCGACTAGAGGGTGAGGGACTAGATGGAGGTCTTAGAGGAT / / / // / / // // / / | | HinfI || | Eco57MI || |SetI | HinfI | | TfiI || | GsuI || MboI | MnlI | SecI* || MboI |DpnI | TfiI BtgZI |DpnI BstKTI Hpy178III* BstKTI I P R N L S S L I S H S L I Y L Q N L L Y R G I Y H R * S P T P * S T S R I S Y T E E S I I A D L P L P D L P P E S P T ----:----|----:----|----:----|----:----|----:----|----:----| I G L F R D D S I E W E R I * R W F R R F V S S D I M A S R G S G S R G G S D G Y R P I * * R Q D G V G Q D V E L I E * TspEI ApoI MseI |TaqII TspEI |AhaIII* ApoI || BsrI EcoRI || Hin4I TspEI || Hin4I \ \\ \ \ \\ \ CCGAATTCCCTGACCCATTTAAAGAACTCCCACCGATAAATTCTCGTCAAACTAATTCCA 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| GGCTTAAGGGACTGGGTAAATTTCTTGAGGGTGGCTATTTAAGAGCAGTTTGATTAAGGT / // / // // EcoRI |Hin4I TspEI || |TspEI TspEI |MseI ApoI || BsrI ApoI AhaIII* |Hin4I TaqII P N S L T H L K N S H R * I L V K L I P R I P * P I * R T P T D K F S S N * F Q E F P D P F K E L P P I N S R Q T N S S ----:----|----:----|----:----|----:----|----:----|----:----| G F E R V W K F F E W R Y I R T L S I G V S N G S G N L S S G G I F E R * V L E R I G Q G M * L V G V S L N E D F * N W MlyI PleI | MaeIII MboI | Tsp45I | DpnI | | HinfI HphI Tsp4CI* | |BstKTI \ \ \ \ \ \ \\ GTTTGGGTGGTATTGGTGACTCTAATGCCTATACTACTATCAACAGTAAGAAAAGATCAT 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| CAAACCCACCATAACCACTGAGATTACGGATATGATGATAGTTGTCATTCTTTTCTAGTA // // / / // / |PleI || HphI Tsp4CI* || MboI MlyI |HinfI |DpnI Tsp45I BstKTI MaeIII V W V V L V T L M P I L L S T V R K D H F G W Y W * L * C L Y Y Y Q Q * E K I I L G G I G D S N A Y T T I N S K K R S L ----:----|----:----|----:----|----:----|----:----|----:----| T Q T T N T V R I G I S S D V T L F S * L K P P I P S E L A * V V I L L L F L D N P H Y Q H S * H R Y * * * C Y S F I M MboII | TspEI | | MseI | | | TspDTI | | | | SetI | | | | BsmAI | | | | | BsiI* | | | | | Hpy178III* | | | | | | FatI | | | | | | |CviAII | | | | | | || NlaIII | | | | | | || | DdeI \ \ \ \ \ \ \\ \ \ TAGAAGATAATGAAACTGAAATTAAGGTATCACGAGACACATGGAATACTAAGAATATGC 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| ATCTTCTATTACTTTGACTTTAATTCCATAGTGCTCTGTGTACCTTATGATTCTTATACG / // // / / // / MboII |MseI || | | |FatI DdeI |SetI || | | CviAII TspDTI || | NlaIII TspEI || BsiI* |Hpy178III* BsmAI * K I M K L K L R Y H E T H G I L R I C R R * * N * N * G I T R H M E Y * E Y A E D N E T E I K V S R D T W N T K N M R ----:----|----:----|----:----|----:----|----:----|----:----| * F I I F S F N L Y * S V C P I S L I H N S S L S V S I L T D R S V H F V L F I L L Y H F Q F * P I V L C M S Y * S Y A SetI | Hpy188I TseI | | MboI CviRI* | | | DpnI |BisI | | | |TaqI ||BlsI | | | |BstKTI |||AluI | | | || HphI |||CviJI | | | || | ApoI |||PvuII | | | || | TspEI |||NspBII* | | | || | EcoRI |||| SetI | | | || | | MboII |||| | MwoI | | | ||MnlI | | | SetI |||| | | BbvI \ \ \ \\\ \ \ \ \ \\\\ \ \ \ GTAGTTTAGAACCTCCGAGATCGAAGAAACGAATTCACCTGATTGCAGCTGTAAAAGCAG 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| CATCAAATCTTGGAGGCTCTAGCTTCTTTGCTTAAGTGGACTAACGTCGACATTTTCGTC / / ///// / /// //// / SetI | ||||| HphI ||SetI |||| MwoI | ||||TaqI |EcoRI |||NspBII* | |||MboI |TspEI |||PvuII | ||MnlI |ApoI |||CviJI | |DpnI MboII |||TseI | BstKTI |||AluI Hpy188I ||BisI |BlsI |SetI CviRI* V V * N L R D R R N E F T * L Q L * K Q * F R T S E I E E T N S P D C S C K S S S L E P P R S K K R I H L I A A V K A V ----:----|----:----|----:----|----:----|----:----|----:----| T T * F R R S R L F S N V Q N C S Y F C R L K S G G L D F F R I * R I A A T F A Y N L V E S I S S V F E G S Q L Q L L L MnlI TspGWI SetI | HphI SetI \ \ \ \ TAAAATCAATCAAACCAATACGGACAACCTTACGATACGATGAGGCAATCACCTATAATA 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| ATTTTAGTTAGTTTGGTTATGCCTGTTGGAATGCTATGCTACTCCGTTAGTGGATATTAT / / // / / BbvI SetI |MnlI HphI SetI TspGWI * N Q S N Q Y G Q P Y D T M R Q S P I I K I N Q T N T D N L T I R * G N H L * * K S I K P I R T T L R Y D E A I T Y N K ----:----|----:----|----:----|----:----|----:----|----:----| Y F * D F W Y P C G * S V I L C D G I I T F D I L G I R V V K R Y S S A I V * L L I L * V L V S L R V I R H P L * R Y Y MseI MnlI TaqI Tsp4CI* \ \ \ \ AAGATATTAAAGAAAAAGAAAAATATATCGAGGCATACCACAAAGAAGTCAATCAACTGT 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTATAATTTCTTTTTCTTTTTATATAGCTCCGTATGGTGTTTCTTCAGTTAGTTGACA / / / / MseI MnlI TaqI Tsp4CI* K I L K K K K N I S R H T T K K S I N C R Y * R K R K I Y R G I P Q R S Q S T V D I K E K E K Y I E A Y H K E V N Q L L ----:----|----:----|----:----|----:----|----:----|----:----| F I N F F F F F I D L C V V F F D I L Q L S I L S F S F Y I S A Y W L S T L * S L Y * L F L F I Y R P M G C L L * D V T TspDTI | TspRI | | SspI MboII | | BslFI \ \ \ \ TGAAGATGAAAACTTGGGACACTGACGAATATTATGACAGAAAAGAAATAGACCCTAAAA 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| ACTTCTACTTTTGAACCCTGTGACTGCTTATAATACTGTCTTTTCTTTATCTGGGATTTT / / / / / | | TspDTI | BslFI | TspRI SspI MboII * R * K L G T L T N I M T E K K * T L K E D E N L G H * R I L * Q K R N R P * K K M K T W D T D E Y Y D R K E I D P K R ----:----|----:----|----:----|----:----|----:----|----:----| Q L H F S P V S V F I I V S F F Y V R F N F I F V Q S V S S Y * S L F S I S G L S S S F K P C Q R I N H C F L F L G * F MaeII |MaeIII |Tsp45I || SetI || TaiI AluI || | Tsp4CI* CviJI BdaI || | |Csp6I |MaeI MboII BdaI || | ||RsaI ||SetI \ \ \\ \ \\\ \\\ GAGTAATAAACTCAATGTTTATCTTCAACAAGAAACGTGACGGTACTCATAAAGCTAGAT 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| CTCATTATTTGAGTTACAAATAGAAGTTGTTCTTTGCACTGCCATGAGTATTTCGATCTA / / / / / // / / / / MboII BdaI | | | |Csp6I | | | BdaI BdaI | | | RsaI | | | BdaI | | Tsp4CI* | | MaeI | | Tsp45I | CviJI | | MaeIII | AluI | MaeII SetI TaiI SetI E * * T Q C L S S T R N V T V L I K L D S N K L N V Y L Q Q E T * R Y S * S * I V I N S M F I F N K K R D G T H K A R F ----:----|----:----|----:----|----:----|----:----|----:----| S Y Y V * H K D E V L F T V T S M F S S L T I F E I N I K L L F R S P V * L A L L L L S L T * R * C S V H R Y E Y L * I FatI |CviAII ||Cac8I BdaI BseGI ||| SphI BdaI |HphI ||| NspI | MnlI || Hpy178III* ||| CviRI* | | CviRI* || | SfaNI ||| NlaIII | | | FokI || | |MlyI HinfI ||| | BspCNI | | | | SetI || | |PleI | DdeI ||| | |BseMII \ \ \ \ \ \\ \ \\ \ \ \\\ \ \\ TTGTTGCAAGAGGTGATATTCAGCATCCTGACACTTACGACTCAGGCATGCAATCCAATA 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| AACAACGTTCTCCACTATAAGTCGTAGGACTGTGAATGCTGAGTCCGTACGTTAGGTTAT / / / / / / / // / / / / /// // | | | FokI | HphI | || SfaNI | | | ||| |BseMII | | SetI BseGI | |PleI | | | ||| BspCNI | CviRI* | MlyI | | | ||CviRI* MnlI Hpy178III* | | | ||FatI | | | |CviAII | | | Cac8I | | NlaIII | | NspI | | SphI | DdeI HinfI L L Q E V I F S I L T L T T Q A C N P I C C K R * Y S A S * H L R L R H A I Q Y V A R G D I Q H P D T Y D S G M Q S N T ----:----|----:----|----:----|----:----|----:----|----:----| K N C S T I N L M R V S V V * A H L G I N T A L P S I * C G S V * S E P M C D L Q Q L L H Y E A D Q C K R S L C A I W Y MslI |FokI || CviRI* || | EcoT22I || | | BseGI Tsp4CI* || | | | DrdI |Csp6I || | |MseI | | MaeIII ||RsaI || | |VspI | | Tsp45I CviRI* \\\ \\ \ \\ \ \ \ \ CCGTACATCACTATGCATTAATGACATCCCTGTCACTTGCATTAGACAATAACTACTATA 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| GGCATGTAGTGATACGTAATTACTGTAGGGACAGTGAACGTAATCTGTTATTGATGATAT / // / / / / / / / / | || | | | | | DrdI | CviRI* | || | | | | BseGI Tsp45I | || | | | VspI MaeIII | || | | | MseI | || | | CviRI* | || | | FokI | || | EcoT22I | || MslI | |Csp6I | RsaI Tsp4CI* P Y I T M H * * H P C H L H * T I T T I R T S L C I N D I P V T C I R Q * L L Y V H H Y A L M T S L S L A L D N N Y Y I ----:----|----:----|----:----|----:----|----:----|----:----| G Y M V I C * H C G Q * K C * V I V V I V T C * * A N I V D R D S A N S L L * * R V D S H M L S M G T V Q M L C Y S S Y TspEI | MboII CviRI* TspEI MboII \ \ \ \ \ TTACACAATTAGACATATCTTCGGCATATTTGTATGCAGACATCAAAGAAGAATTATACA 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTGTTAATCTGTATAGAAGCCGTATAAACATACGTCTGTAGTTTCTTCTTAATATGT // / / / |TspEI CviRI* | MboII MboII TspEI L H N * T Y L R H I C M Q T S K K N Y T Y T I R H I F G I F V C R H Q R R I I H T Q L D I S S A Y L Y A D I K E E L Y I ----:----|----:----|----:----|----:----|----:----|----:----| N C L * V Y R R C I Q I C V D F F F * V I V C N S M D E A Y K Y A S M L S S N Y * V I L C I K P M N T H L C * L L I I C TspDTI | MaeII MnlI | | SetI SetI | BsiYI* | | TaiI MboII \ \ \ \ \ \ \ TAAGACCTCCACCACATTTAGGAATGAATGATAAGTTGATACGTTTGAAGAAATCACTTT 4390 4400 4410 4420 4430 4440 ----:----|----:----|----:----|----:----|----:----|----:----| ATTCTGGAGGTGGTGTAAATCCTTACTTACTATTCAACTATGCAAACTTCTTTAGTGAAA / / / / / / SetI BsiYI* | | MaeII MboII MnlI | TaiI | SetI TspDTI * D L H H I * E * M I S * Y V * R N H F K T S T T F R N E * * V D T F E E I T L R P P P H L G M N D K L I R L K K S L Y ----:----|----:----|----:----|----:----|----:----|----:----| Y S R W W M * S H I I L Q Y T Q L F * K M L G G G C K P I F S L N I R K F F D S L V E V V N L F S H Y T S V N S S I V K Csp6I |RsaI |BsrI SetI \\ \ ATGGATTGAAACAAAGTGGAGCGAACTGGTACGAAACTATCAAATCATACCTGATACAAC 4450 4460 4470 4480 4490 4500 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTAACTTTGTTTCACCTCGCTTGACCATGCTTTGATAGTTTAGTATGGACTATGTTG / // / | |Csp6I SetI | RsaI BsrI M D * N K V E R T G T K L S N H T * Y N W I E T K W S E L V R N Y Q I I P D T T G L K Q S G A N W Y E T I K S Y L I Q Q ----:----|----:----|----:----|----:----|----:----|----:----| I S Q F L T S R V P V F S D F * V Q Y L * P N F C L P A F Q Y S V I L D Y R I C H I S V F H L S S T R F * * I M G S V V FatI BseGI |CviAII || NlaIII || | FokI || | | MseI || | | |AhaIII* || | | || Tsp4CI* || | | || | MaeIII XmnI || | | || | Tsp45I | BccI MboII || | | || | | TspEI \ \ \ \\ \ \ \\ \ \ \ AATGTGGTATGGAAGAAGTTCGTGGATGGTCATGCGTATTTAAAAACAGTCAAGTGACAA 4510 4520 4530 4540 4550 4560 ----:----|----:----|----:----|----:----|----:----|----:----| TTACACCATACCTTCTTCAAGCACCTACCAGTACGCATAAATTTTTGTCAGTTCACTGTT / / / / / // // / / | | | | | |FatI |MseI Tsp4CI* Tsp45I | | | | | CviAII AhaIII* MaeIII | | | | NlaIII FokI | | | BseGI | | MboII | BccI XmnI N V V W K K F V D G H A Y L K T V K * Q M W Y G R S S W M V M R I * K Q S S D N C G M E E V R G W S C V F K N S Q V T I ----:----|----:----|----:----|----:----|----:----|----:----| L T T H F F N T S P * A Y K F V T L H C C H P I S S T R P H D H T N L F L * T V I H Y P L L E H I T M R I * F C D L S L ApoI TspEI TspEI \ \ TTTGTTTATTCGTAGATGATATGGTATTGTTTAGCAAAAATCTAAATTCAAACAAAAGAA 4570 4580 4590 4600 4610 4620 ----:----|----:----|----:----|----:----|----:----|----:----| AAACAAATAAGCATCTACTATACCATAACAAATCGTTTTTAGATTTAAGTTTGTTTTCTT / / TspEI TspEI ApoI F V Y S * M I W Y C L A K I * I Q T K E L F I R R * Y G I V * Q K S K F K Q K N C L F V D D M V L F S K N L N S N K R I ----:----|----:----|----:----|----:----|----:----|----:----| N T * E Y I I H Y Q K A F I * I * V F S I Q K N T S S I T N N L L F R F E F L L K N I R L H Y P I T * C F D L N L C F F SfaNI | HindIII | | AluI | | CviJI | | |SmlI | | |AflII | | ||MseI | | ||SetI | | ||| MwoI | | ||| | CviRI* MaeI | | ||| | | Hin4I | BdaI Hin4I | | ||| | | Hin4I PsiI | BdaI MnlI Hin4I \ \ \\\ \ \ \ \ \ \ \ \ TTATAGAGAAGCTTAAGATGCAATACGACACCAAGATTATAAATCTAGGCGAAAGTGATG 4630 4640 4650 4660 4670 4680 ----:----|----:----|----:----|----:----|----:----|----:----| AATATCTCTTCGAATTCTACGTTATGCTGTGGTTCTAATATTTAGATCCGCTTTCACTAC / / / //// // / // // TspEI | | |||| |Hin4I PsiI |MaeI |Hin4I | | |||| |Hin4I BdaI |Hin4I | | |||| CviRI* BdaI MnlI | | |||AflII | | |||SmlI | | ||MseI | | |MwoI | | HindIII | CviJI | SfaNI | AluI SetI L * R S L R C N T T P R L * I * A K V M Y R E A * D A I R H Q D Y K S R R K * * I E K L K M Q Y D T K I I N L G E S D E ----:----|----:----|----:----|----:----|----:----|----:----| N Y L L K L H L V V G L N Y I * A F T I I I S F S L I C Y S V L I I F R P S L S * L S A * S A I R C W S * L D L R F H H BdaI FatI BdaI |CviAII ApoI | CviJI || NlaIII TspEI | |DdeI MnlI SetI || |TspEI \ \ \\ \ \ \\ \\ AGGAAATTCAATATGACATACTTGGCTTAGAAATCAAATATCAAAGAGGTAAATACATGA 4690 4700 4710 4720 4730 4740 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTTAAGTTATACTGTATGAACCGAATCTTTAGTTTATAGTTTCTCCATTTATGTACT / / / / / / / // TspEI BdaI | DdeI MnlI SetI | |FatI ApoI BdaI CviJI | CviAII NlaIII R K F N M T Y L A * K S N I K E V N T * G N S I * H T W L R N Q I S K R * I H E E I Q Y D I L G L E I K Y Q R G K Y M K ----:----|----:----|----:----|----:----|----:----|----:----| L F N L I V Y K A * F D F I L S T F V H S S I * Y S M S P K S I L Y * L P L Y M P F E I H C V Q S L F * I D F L Y I C S TspEI | MseI | | MaeII | | | Csp6I SetI | | | |RsaI | TspDTI | | | |SetI | | BseMII | | | |TaiI | | |BspCNI | | | || SetI | | || MseI | | | || | TfiI | | || | DdeI | | | || | HinfI \ \ \\ \ \ \ \ \ \\ \ \ AATTAGGTATGGAAAACTCATTAACTGAGAAAATACCCAAATTAAACGTACCTTTGAATC 4750 4760 4770 4780 4790 4800 ----:----|----:----|----:----|----:----|----:----|----:----| TTAATCCATACCTTTTGAGTAATTGACTCTTTTATGGGTTTAATTTGCATGGAAACTTAG / / // / / /// /// / TspEI | |BspCNI MseI DdeI ||| ||Csp6I HinfI SetI | BseMII ||| |RsaI TfiI TspDTI ||| |SetI ||| MaeII ||TaiI ||SetI |MseI TspEI N * V W K T H * L R K Y P N * T Y L * I I R Y G K L I N * E N T Q I K R T F E S L G M E N S L T E K I P K L N V P L N P ----:----|----:----|----:----|----:----|----:----|----:----| F * T H F V * * S L F Y G F * V Y R Q I F N P I S F E N V S F I G L N F T G K F I L Y P F S M L Q S F V W I L R V K S D DdeI | Hin6I | MboII | |GlaI | |Eco47III | ||HhaI | |||HaeII | ||||BssKI | ||||EcoRII | ||||| ScrFI | ||||| BseBI | ||||| | SetI | ||||| | |HindII | ||||| | |Hpy166II | ||||| | || BssKI | ||||| | || SexAI | ||||| | || EcoRII BssKI | ||||| | || | ScrFI EcoRII GsuI | ||||| | || | BseBI | ScrFI BseGI Eco57MI | ||||| | || | | SetI | BseBI |MaeI \ \ \\\\\ \ \\ \ \ \ \ \ \\ CAAAAGGAAGAAAACTTAGCGCTCCAGGTCAACCAGGTCTTTATATAGACCAGGATGAAC 4810 4820 4830 4840 4850 4860 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTCCTTCTTTTGAATCGCGAGGTCCAGTTGGTCCAGAAATATATCTGGTCCTACTTG / //// // / / // / / / / Eco57MI |||| || | | || EcoRII | | BseGI GsuI |||| || | | || SexAI | EcoRII |||| || | | || BssKI | BssKI |||| || | | |BseBI BseBI |||| || | | |ScrFI ScrFI |||| || | | SetI |||| || | Hpy166II |||| || | HindII |||| || EcoRII |||| || BssKI |||| |BseBI |||| |ScrFI |||| SetI |||Hin6I ||Eco47III ||GlaI |HhaI MboII HaeII DdeI Q K E E N L A L Q V N Q V F I * T R M N K R K K T * R S R S T R S L Y R P G * T K G R K L S A P G Q P G L Y I D Q D E L ----:----|----:----|----:----|----:----|----:----|----:----| W F S S F K A S W T L W T K I Y V L I F G F P L F S L A G P * G P R * I S W S S L L F F V * R E L D V L D K Y L G P H V Hin4II* |MboII ||TspDTI ||| TspDTI ||| | Csp6I ||| | |RsaI ||| | |SetI ||| | ||FatI TspDTI ||| | |||CviAII |MmeI FokI ||| | |||| NlaIII || TspDTI | TspDTI ||| | |||| | CviRI* || | MaeI \ \ \\\ \ \\\\ \ \ \\ \ \ TAGAAATAGATGAAGATGAATACAAAGAGAAGGTACATGAAATGCAAAAGTTGATTGGTC 4870 4880 4890 4900 4910 4920 ----:----|----:----|----:----|----:----|----:----|----:----| ATCTTTATCTACTTCTACTTATGTTTCTCTTCCATGTACTTTACGTTTTCAACTAACCAG / / / // // // // / // / MaeI | FokI || || || |FatI | || TspDTI TspDTI || || || | | |MmeI || || || | | TspDTI || || || | CviRI* || || || CviAII || || |NlaIII || || |Csp6I || || RsaI || |SetI || TspDTI |TspDTI |MboII Hin4II* * K * M K M N T K R R Y M K C K S * L V R N R * R * I Q R E G T * N A K V D W S E I D E D E Y K E K V H E M Q K L I G L ----:----|----:----|----:----|----:----|----:----|----:----| * F Y I F I F V F L L Y M F H L L Q N T S S I S S S S Y L S F T C S I C F N I P L F L H L H I C L S P V H F A F T S Q D AluI CviJI | SetI ApoI | | NdeI TspEI \ \ \ \ TAGCTTCATATGTTGGATATAAATTTAGATTTGACTTACTATACTACATCAACACACTTG 4930 4940 4950 4960 4970 4980 ----:----|----:----|----:----|----:----|----:----|----:----| ATCGAAGTATACAACCTATATTTAAATCTAAACTGAATGATATGATGTAGTTGTGTGAAC /// / / ||CviJI NdeI TspEI ||AluI ApoI |MaeI SetI * L H M L D I N L D L T Y Y T T S T H L S F I C W I * I * I * L T I L H Q H T C A S Y V G Y K F R F D L L Y Y I N T L A ----:----|----:----|----:----|----:----|----:----|----:----| * S * I N S I F K S K V * * V V D V C K R A E Y T P Y L N L N S K S Y * M L V S L K M H Q I Y I * I Q S V I S C * C V Q FatI |CviAII || NlaIII || | NdeI || | |CspCI || | || TspDTI MaeI MnlI || | || |MseI TspEI \ \ \\ \ \\ \\ \ CTCAACATATACTATTCCCCTCTAGGCAAGTTTTAGACATGACATATGAGTTAATACAAT 4990 5000 5010 5020 5030 5040 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTTGTATATGATAAGGGGAGATCCGTTCAAAATCTGTACTGTATACTCAATTATGTTA / / / // / / / / | MnlI | || | | | MseI MaeI | || | | TspDTI | || | NdeI | || CspCI | |FatI | CviAII NlaIII L N I Y Y S P L G K F * T * H M S * Y N S T Y T I P L * A S F R H D I * V N T I Q H I L F P S R Q V L D M T Y E L I Q F ----:----|----:----|----:----|----:----|----:----|----:----| S L M Y * E G R P L N * V H C I L * Y L A * C I S N G E L C T K S M V Y S N I C E V Y V I G R * A L K L C S M H T L V I CspCI |BslFI FatI || TspEI |CviAII || | MseI || NlaIII MaeI || | VspI SetI CviJI \\ \ \ \\ \ \ \ \ TCATGTGGGACACTAGAGATAAACAATTAATATGGCACAAAAACAAACCTACCAAGCCAG 5050 5060 5070 5080 5090 5100 ----:----|----:----|----:----|----:----|----:----|----:----| AGTACACCCTGTGATCTCTATTTGTTAATTATACCGTGTTTTTGTTTGGATGGTTCGGTC / // / / / // / / | |FatI | CspCI | |VspI SetI CviJI | CviAII MaeI | |MseI NlaIII | TspEI TspEI BslFI S C G T L E I N N * Y G T K T N L P S Q H V G H * R * T I N M A Q K Q T Y Q A R M W D T R D K Q L I W H K N K P T K P D ----:----|----:----|----:----|----:----|----:----|----:----| E H P V S S I F L * Y P V F V F R G L W N M H S V L S L C N I H C L F L G V L G * T P C * L Y V I L I A C F C V * W A L SpeI |MaeI || FalI NdeI || FalI | MaeIII TsoI || | SfaNI | BstEII FalI |MaeIII || | | TspDTI | |BtgZI FalI |Tsp45I \\ \ \ \ \ \\ \ \\ ATAATAAACTAGTCGCAATAAGCGATGCTTCATATGGTAACCAACCATATTACAAGTCAC 5110 5120 5130 5140 5150 5160 ----:----|----:----|----:----|----:----|----:----|----:----| TATTATTTGATCAGCGTTATTCGCTACGAAGTATACCATTGGTTGGTATAATGTTCAGTG / // // / / / / / FalI |SpeI |SfaNI | | BstEII TsoI Tsp45I FalI MaeI TspDTI | | MaeIII MaeIII | | BtgZI | FalI | FalI NdeI I I N * S Q * A M L H M V T N H I T S H * * T S R N K R C F I W * P T I L Q V T N K L V A I S D A S Y G N Q P Y Y K S Q ----:----|----:----|----:----|----:----|----:----|----:----| I I F * D C Y A I S * I T V L W I V L * S L L S T A I L S A E Y P L W G Y * L D Y Y V L R L L R H K M H Y G V M N C T V SalI |TaqI |AccI ||HindII TspEI ||Hpy166II | MaeIII MnlI TspGWI ||| CviJI \ \ \ \ \\\ \ AAATTGGTAACATTTTCCTACTCAACGGAAAAGTGATTGGAGGAAAGTCGACAAAGGCTT 5170 5180 5190 5200 5210 5220 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAACCATTGTAAAAGGATGAGTTGCCTTTTCACTAACCTCCTTTCAGCTGTTTCCGAA / / / / /// / TspEI MaeIII MnlI TspGWI ||SalI CviJI |AccI |TaqI Hpy166II HindII K L V T F S Y S T E K * L E E S R Q R L N W * H F P T Q R K S D W R K V D K G F I G N I F L L N G K V I G G K S T K A S ----:----|----:----|----:----|----:----|----:----|----:----| L N T V N E * E V S F H N S S L R C L S C I P L M K R S L P F T I P P F D V F A F Q Y C K G V * R F L S Q L F T S L P K MseI |HpaI |HindII |Hpy166II BarI || FatI | TspRI || |CviAII | |AluI || || NspI | |CviJI || || CviRI* | || BdaI || || NlaIII | || BdaI || || | BarI | || SetI || || | | SfeI* | || | AciI \\ \\ \ \ \ \ \\ \ \ CGTTAACATGCACTTCAACTACAGAAGCAGAAATACACGCAGTCAGTGAAGCTATACCGC 5230 5240 5250 5260 5270 5280 ----:----|----:----|----:----|----:----|----:----|----:----| GCAATTGTACGTGAAGTTGATGTCTTCGTCTTTATGTGCGTCAGTCACTTCGATATGGCG /// /// / / / / / / ||| ||BarI SfeI* | BarI | CviJI AciI ||| |CviRI* TspRI | AluI ||| |FatI | BdaI ||| CviAII | BdaI ||NlaIII SetI ||NspI |MseI Hpy166II HindII HpaI R * H A L Q L Q K Q K Y T Q S V K L Y R V N M H F N Y R S R N T R S Q * S Y T A L T C T S T T E A E I H A V S E A I P L ----:----|----:----|----:----|----:----|----:----|----:----| R * C A S * S C F C F Y V C D T F S Y R E N V H V E V V S A S I C A T L S A I G T L M C K L * L L L F V R L * H L * V A HphI | DdeI | |SetI | || MaeIII | || Tsp45I | || | MnlI | || | |SetI | || | ||DraIII | || | ||| BspCNI | || | ||| |CviRI* | || | ||| |BseMII FalI CviJI | || | ||| ||BdaI FalI | Hin4I | || | ||| ||BdaI MseI TspEI MseI | Hin4I \ \\ \ \\\ \\\ \ \ \ \ \ TATTGAATAACCTCAGTCACCTTGTGCAAGAACTTAACAAGAAACCAATTATTAAAGGCT 5290 5300 5310 5320 5330 5340 ----:----|----:----|----:----|----:----|----:----|----:----| ATAACTTATTGGAGTCAGTGGAACACGTTCTTGAATTGTTCTTTGGTTAATAATTTCCGA // / / / //// / / / // / |SetI | | | |||CviRI* MseI FalI | || CviJI HphI | | | ||BdaI FalI | |Hin4I | | | ||BdaI | |Hin4I | | | |BseMII | MseI | | | BspCNI TspEI | | Tsp45I | | MaeIII | | DraIII | | MnlI | SetI DdeI Y * I T S V T L C K N L T R N Q L L K A I E * P Q S P C A R T * Q E T N Y * R L L N N L S H L V Q E L N K K P I I K G L ----:----|----:----|----:----|----:----|----:----|----:----| * Q I V E T V K H L F K V L F W N N F A S N F L R L * R T C S S L L F G I I L P I S Y G * D G Q A L V * C S V L * * L S MboI | DpnI | |FalI | |FalI | |BstKTI | || MboI | || | DpnI | || | |BstKTI AccI | || | || TspEI Hin4I | || | || |Hin4I Hin4I Hin4I | || | || |Hin4I |Hpy166II ApoI Hin4I | || | || || MseI || Ksp632I* TspEI MboII \ \ \\ \ \\ \\ \ \\ \ \ \ TACTTACTGATAGTAGATCAACGATCAGTATAATTAAGTCTACAAATGAAGAGAAATTTA 5350 5360 5370 5380 5390 5400 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAATGACTATCATCTAGTTGCTAGTCATATTAATTCAGATGTTTACTTCTCTTTAAAT / / // / // // /// // / // Hin4I | || | || |Hin4I ||| |AccI Ksp632I* |TspDTI Hin4I | || | || |Hin4I ||| Hpy166II |MboII | || | || MboI ||MseI TspEI | || | |DpnI |TspEI ApoI | || | BstKTI Hin4I | || MboI Hin4I | |DpnI | BstKTI FalI FalI Y L L I V D Q R S V * L S L Q M K R N L T Y * * * I N D Q Y N * V Y K * R E I * L T D S R S T I S I I K S T N E E K F R ----:----|----:----|----:----|----:----|----:----|----:----| * K S I T S * R D T Y N L R C I F L F K K S V S L L D V I L I I L D V F S S F N V * Q Y Y I L S * Y L * T * L H L S I * Hin4I Hin4I SetI |BsrDI | TspDTI TspDTI BsmAI || DdeI | |TspEI \ \ \\ \ \ \\ GAAACAGATTTTTTGGCACAAAGGCAATGAGACTTAGAGATGAAGTATCAGGTAATAATT 5410 5420 5430 5440 5450 5460 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGTCTAAAAAACCGTGTTTCCGTTACTCTGAATCTCTACTTCATAGTCCATTATTAA / / / / / / / / | | BsrDI DdeI | | | TspEI | BsmAI | | Hin4I Hin4I | | Hin4I Hin4I | TspDTI SetI E T D F L A Q R Q * D L E M K Y Q V I I K Q I F W H K G N E T * R * S I R * * F N R F F G T K A M R L R D E V S G N N L ----:----|----:----|----:----|----:----|----:----|----:----| S V S K K A C L C H S K S I F Y * T I I L F L N K P V F A I L S L S S T D P L L F C I K Q C L P L S V * L H L I L Y Y N Hin4I Hin4I | MaeII | |BsaAI | |SnaBI | || AccI | || SetI | || TaiI | || |BssNAI | || |Hpy166II | || || BsmAI | || || Eco31I | || || | TaqI Hin4I | || || | |Hpy178III* BsrDI MboII MboII SetI \ \\ \\ \ \\ \ \ \ \ TATACGTATACTACATCGAGACCAAGAAGAACATTGCTGATGTGATGACAAAACCTCTTC 5470 5480 5490 5500 5510 5520 ----:----|----:----|----:----|----:----|----:----|----:----| ATATGCATATGATGTAGCTCTGGTTCTTCTTGTAACGACTACACTACTGTTTTGGAGAAG / // // / // / / / / / / | || |AccI | || | | MboII | SetI Hpy188I | || | | || | Hin4I MboII | || | | || BsrDI | || | | |Hpy178III* | || | | TaqI | || | Eco31I | || | BsmAI | || Hpy166II | || BssNAI | |MaeII | SnaBI | BsaAI TaiI SetI Y T Y T T S R P R R T L L M * * Q N L F I R I L H R D Q E E H C * C D D K T S S Y V Y Y I E T K K N I A D V M T K P L P ----:----|----:----|----:----|----:----|----:----|----:----| * V Y V V D L G L L V N S I H H C F R K K Y T Y * M S V L F F M A S T I V F G R I R I S C R S W S S C Q Q H S S L V E E MboI BglII XhoII Hin4I | DpnI Hpy188I | MseI | |BstKTI Ksp632I* | |AhaIII* TfiI | || TaqII | MnlI | || MseI TspDTI HinfI | || |MmeI \ \ \ \\ \ \ \ \ \\ \\ CGATAAAAACATTTAAACTATTAACAAACAAATGGATTCATTAGATCTATTACATTATGG 5530 5540 5550 5560 5570 5580 ----:----|----:----|----:----|----:----|----:----|----:----| GCTATTTTTGTAAATTTGATAATTGTTTGTTTACCTAAGTAATCTAGATAATGTAATACC /// // / / / //// ||Hin4I |MseI | TspDTI HinfI |||XhoII |Ksp632I* AhaIII* MseI TfiI |||BglII MnlI |||MboI |||MmeI ||TaqII |DpnI BstKTI R * K H L N Y * Q T N G F I R S I T L W D K N I * T I N K Q M D S L D L L H Y G I K T F K L L T N K W I H * I Y Y I M G ----:----|----:----|----:----|----:----|----:----|----:----| R Y F C K F * * C V F P N M L D I V N H G I F V N L S N V F L H I * * I * * M I S L F M * V I L L C I S E N S R N C * P MaeII |MaeIII || SetI || TaiI SpeI || | SpeI |MaeI || | |MaeI \\ \\ \ \\ GTGGTATGTTGGAATAAAAATCAACTATCATCTACTAACTAGTATTTACGTTACTAGTAT 5590 5600 5610 5620 5630 5640 ----:----|----:----|----:----|----:----|----:----|----:----| CACCATACAACCTTATTTTTAGTTGATAGTAGATGATTGATCATAAATGCAATGATCATA // / / / // |SpeI | | | |SpeI MaeI | | | MaeI | | MaeIII | MaeII TaiI SetI V V C W N K N Q L S S T N * Y L R Y * Y W Y V G I K I N Y H L L T S I Y V T S I G M L E * K S T I I Y * L V F T L L V Y ----:----|----:----|----:----|----:----|----:----|----:----| T T H Q F L F * S D D V L * Y K R * * Y P P I N S Y F D V I M * * S T N V N S T H Y T P I F I L * * R S V L I * T V L I Hin4I | MboII Tsp4CI* | | HgaI TspEI \ \ \ \ \ ATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGTCATCTAAATTAGT 5650 5660 5670 5680 5690 5700 ----:----|----:----|----:----|----:----|----:----|----:----| TAATAGTATATGCCACAATCTTCTACTGCGTTTACTACTCTTTATCAGTAGATTTAATCA / / / / // Tsp4CI* Hin4I MboII HgaI |TspEI Hin4I I I I Y G V R R * R K * * E I V I * I S L S Y T V L E D D A N D E K * S S K L V Y H I R C * K M T Q M M R N S H L N * W ----:----|----:----|----:----|----:----|----:----|----:----| I I M Y P T L L H R L H H S I T M * I L Y * * I R H * F I V C I I L F L * R F * N D Y V T N S S S A F S S F Y D D L N T MboI | DpnI Hin4I | |BstKTI | AluI | || BinI* | CviJI | || | SspI | | SetI | || | | MseI TspDTI \ \ \ \ \\ \ \ \ \ GGAAGCTGAAACGCAAGGATTGATAATGTAATAGGATCAATGAATATTAACATATAAAAC 5710 5720 5730 5740 5750 5760 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTCGACTTTGCGTTCCTAACTATTACATTATCCTAGTTACTTATAATTGTATATTTTG / / // / / / / / | CviJI || MboI | | | TspDTI | AluI |DpnI | | MseI SetI BstKTI | SspI BinI* G S * N A R I D N V I G S M N I N I * N E A E T Q G L I M * * D Q * I L T Y K T K L K R K D * * C N R I N E Y * H I K R ----:----|----:----|----:----|----:----|----:----|----:----| P L Q F A L I S L T I P D I F I L M Y F H F S F R L S Q Y H L L I L S Y * C I F S A S V C P N I I Y Y S * H I N V Y L V TspEI | CviRI* BsiYI* | | TfiI | TfiI SspI TspEI | | HinfI | HinfI MnlI \ \ \ \ \ \ \ \ GATGATAATAATATTTATAGAATTGTGTAGAATTGCAGATTCCCTTTTATGGATTCCTAA 5770 5780 5790 5800 5810 5820 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTATTATTATAAATATCTTAACACATCTTAACGTCTAAGGGAAAATACCTAAGGATT / / // / / / / SspI TspEI || | BsiYI* | MnlI || HinfI HinfI || TfiI TfiI |CviRI* TspEI D D N N I Y R I V * N C R F P F M D S * M I I I F I E L C R I A D S L L W I P K * * * Y L * N C V E L Q I P F Y G F L N ----:----|----:----|----:----|----:----|----:----|----:----| S S L L I * L I T Y F Q L N G K I S E * R H Y Y Y K Y F Q T S N C I G K * P N R I I I I N I S N H L I A S E R K H I G L AvaI XhoI SmlI AbsI AccI PspXI |BssNAI |TaqI |Hpy166II |BmeT110I MaeI || SetI || MnlI | BseRI || | SspI CviJI \\ \ \ \ \\ \ \ \ ATCCTCGAGGAGAACTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTATCAACAA 5830 5840 5850 5860 5870 5880 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGAGCTCCTCTTGAAGATCATATAAGACATATGGATTATAATATCGGAAATAGTTGTT // / / // / / || MnlI BseRI |AccI SspI CviJI |PspXI MaeI |SetI |AbsI Hpy166II |SmlI BssNAI |XhoI |AvaI BmeT110I TaqI I L E E N F * Y I L Y T * Y Y S L Y Q Q S S R R T S S I F C I P N I I A F I N N P R G E L L V Y S V Y L I L * P L S T M ----:----|----:----|----:----|----:----|----:----|----:----| I R S S F K * Y I R Y V * Y * L R * * C F G R P S S R T Y E T Y R I N Y G K D V D E L L V E L I N Q I G L I I A K I L L TfiI ApoI HinfI TspEI TspEI TspEI \ \ \ \ TGGAATCCCAACAATTATCTAATTACCCACAAATTTCTCA 5890 5900 5910 5920 ----:----|----:----|----:----|----:----| ACCTTAGGGTTGTTAATAGATTAATGGGTGTTTAAAGAGT / / / / HinfI TspEI TspEI TspEI TfiI ApoI W N P N N Y L I T H K F L X G I P T I I * L P T N F S E S Q Q L S N Y P Q I S X ----:----|----:----|----:----|----:----| H F G L L * R I V W L N R I S D W C N D L * G C I E * P I G V I I * N G V F K E # Enzymes that cut Frequency Isoschizomers AarI 2 AbsI 2 Acc65I 1 Asp718I AccI 8 FblI,XmiI AciI 5 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 2 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 3 DraI AjuI 1 AlfI 2 AluI 14 AluBI AlwNI 1 CaiI ApaLI 1 Alw44I,VneI ApoI 18 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 3 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BarI 1 BbvCI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 12 BceAI 4 BciVI 2 BfuI BclI 1 FbaI,Ksp22I BdaI 10 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglII 3 BinI* 5 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 3 BmgT120I 4 Bpu10I 2 BsaAI 2 BstBAI,Ppu21I BsaXI 1 BseBI 11 Bst2UI,BstNI,BstOI,MvaI BseGI 12 BstF5I,BtsCI BseMII 13 BseRI 3 BseSI 1 BaeGI,BstSLI BseYI 1 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 7 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 8 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 13 BspHI 1 CciI,PagI,RcaI BspMI 3 BfuAI,Acc36I,BveI BsrDI 4 BseMI,Bse3DI BsrI 9 BseNI,Bse1I,BsrSI BssKI 11 BstSCI,StyD4I BssNAI 5 Bst1107I,BstZ17I BstEII 2 BstPI,Eco91I,EcoO65I,PspEI BstKTI 18 BstXI 1 BtgZI 3 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 7 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 22 CviQI,RsaNI CspCI 1 CviAII 22 CviJI 34 CviKI-1 CviRI* 26 HpyCH4V DdeI 23 BstDEI,HpyF3I DpnI 18 MalI DraIII 1 AdeI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 3 AcuI Eco57MI 5 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRI 2 EcoRII 11 AjnI,Psp6I,PspGI EcoRV 4 Eco32I EcoT22I 3 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FalI 4 FatI 22 FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 12 GlaI 4 GsaI 1 GsuI 2 BpmI HaeII 2 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 4 CseI HgiAI* 3 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 4 BstHHI,CfoI,AspLEI Hin4I 23 Hin4II* 6 HpyAV Hin6I 4 HinP1I,HspAI HindII 8 HincII HindIII 1 HinfI 36 HpaI 2 KspAI HpaII 2 HapII,BsiSI,MspI HphI 13 AsuHPI Hpy166II 23 Hpy8I Hpy178III* 20 Hpy188III Hpy188I 20 Hpy99I 3 KpnI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 17 FspBI,BfaI,XspI MaeII 14 HpyCH4IV MaeIII 16 MboI 18 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 25 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 9 SchI MmeI 6 MnlI 32 MseI 31 Tru1I,Tru9I MslI 6 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 5 HpyF10VI,BstMWI NdeI 3 FauNDI NlaIII 22 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspBII* 4 MspA1I NspI 6 BstNSI,XceI OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 9 PpsI PpiI 1 PsiI 2 AanI PspXI 2 PstI 2 PvuII 2 RsaI 22 AfaI SalI 2 SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 2 BmcAI,AssI,ZrmI ScrFI 11 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 8 BseDI,BssECI,BsaJI SetI 81 SexAI 1 MabI SfaNI 9 LweI SfeI* 3 BstSFI,SfcI,BfmI SmlI 3 SmoI SnaBI 1 Eco105I,BstSNI SpeI 5 BcuI,AhlI SphI 4 PaeI,BbuI SplI* 1 Pfl23II,PspLI,BsiWI SspI 11 TaiI 14 TaqI 23 TaqII 6 TatI 6 TfiI 27 PfeI TseI 3 ApeKI TsoI 1 Tsp45I 10 NmuCI Tsp4CI* 23 HpyCH4III,TaaI,Bst4CI TspDTI 31 TspEI 56 TasI,Tsp509I,Sse9I TspGWI 14 TspRI 7 TscAI TstI 1 VspI 3 PshBI,AseI XhoI 2 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 5 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AclI AcyI AloI ApaI AscI AvrII BalI BamHI Bce83I* BcgI BglI BmtI BplI BsaBI BsePI BsgI Bsp120I Bsp1407I BspLU11I* BspMII* BspOI BsrBI BstAPI CauII* Cfr9I CfrI DinI DraII Eam1105I EciI Ecl136II EcoICRI EgeI EheI EspI* FauI FseI FspAI KasI MauBI MluI MroNI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI PacI PasI PmaCI PmeI PpuMI PshAI PspOMI PsrI PvuI RsrII SacI SacII SanDI SapI SfiI SfoI SgfI SgrAI SgrDI SmaI SrfI Sse232I* Sse8387I StuI StyI SwaI TauI TspMI Tth111I XbaI XcmI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769