Restriction Map of HMG2/YLR450W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

HMG2/YLR450W on chromosome XII from coordinates 1032627 to 1035764.


Cac8I | BtsI | CviRI* TatI | | MwoI MaeIII |Csp6I | | | MaeI Tsp45I MseI ||RsaI CviJI | | | |TspRI \ \ \\\ \ \ \ \ \\ ATGTCACTTCCCTTAAAAACGATAGTACATTTGGTAAAGCCCTTTGCTTGCACTGCTAGG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTGAAGGGAATTTTTGCTATCATGTAAACCATTTCGGGAAACGAACGTGACGATCC / / /// / /// // Tsp45I MseI ||TatI CviJI ||CviRI* |MaeI MaeIII |Csp6I |MwoI Hin4I RsaI Cac8I Hin4I TspRI SetI BtsI M S L P L K T I V H L V K P F A C T A R C H F P * K R * Y I W * S P L L A L L G V T S L K N D S T F G K A L C L H C * V ----:----|----:----|----:----|----:----|----:----|----:----| X D S G K F V I T C K T F G K A Q V A L X T V E R L F S L V N P L A R Q K C Q * H * K G * F R Y Y M Q Y L G K S A S S P AciI BisI |BlsI ||TseI ||TauI MaeII ||NspBII* SetI |BtrI |||BisI |Hin4I || SetI Hin4I ||||BlsI |Hin4I || TaiI Hin4I BbvI ||||TspGWI \\ \\ \ \ \ \\\\\ TTTAGTGCGAGATACCCAATCCACGTCATTGTTGTTGCTGTTTTATTGAGTGCCGCTGCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AAATCACGCTCTATGGGTTAGGTGCAGTAACAACAACGACAAAATAACTCACGGCGACGA / // / / /////// | || Hin4I BbvI ||||||TseI | || Hin4I |||||BisI | |MaeII ||||BlsI | BtrI |||NspBII* TaiI |||TspGWI SetI |||AciI ||BisI |BlsI TauI F S A R Y P I H V I V V A V L L S A A A L V R D T Q S T S L L L L F Y * V P L L * C E I P N P R H C C C C F I E C R C L ----:----|----:----|----:----|----:----|----:----|----:----| N L A L Y G I W T M T T A T K N L A A A T * H S I G L G R * Q Q Q Q K I S H R Q K T R S V W D V D N N N S N * Q T G S S MlyI PleI | AluI | CviJI MaeIII MseI | | SetI Tsp45I SetI | | | HinfI \ \ \ \ \ \ TATCTATCCGTGACACAATCTTACCTTAACGAATGGAAGCTGGACTCTAATCAGTATTCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGATAGGCACTGTGTTAGAATGGAATTGCTTACCTTCGACCTGAGATTAGTCATAAGA / / / /// / Tsp45I SetI MseI ||CviJI HinfI MaeIII ||AluI |PleI SetI MlyI Y L S V T Q S Y L N E W K L D S N Q Y S I Y P * H N L T L T N G S W T L I S I L S I R D T I L P * R M E A G L * S V F Y ----:----|----:----|----:----|----:----|----:----|----:----| * R D T V C D * R L S H F S S E L * Y E K D I R S V I K G * R I S A P S * D T N I * G H C L R V K V F P L Q V R I L I R SmlI AflII CviJI |MseI |HpaII BseGI FokI CviRI* SfeI* SetI \\ \\ \ \ \ \ \ ACATACTTAAGCATAAAGCCGGATGAGTTGTTTGAAAAATGCACACACTACTATAGGTCT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGTATGAATTCGTATTTCGGCCTACTCAACAAACTTTTTACGTGTGTGATGATATCCAGA // / / / / / // |AflII | | BseGI | CviRI* |SfeI* |SmlI | HpaII FokI SetI MseI CviJI T Y L S I K P D E L F E K C T H Y Y R S H T * A * S R M S C L K N A H T T I G L I L K H K A G * V V * K M H T L L * V S ----:----|----:----|----:----|----:----|----:----|----:----| V Y K L M F G S S N N S F H V C * * L D * M S L C L A P H T T Q F I C V S S Y T C V * A Y L R I L Q K F F A C V V I P R Hpy188I | FatI | |CviAII BspCNI | || NlaIII |BseMII | || | MaeIII ||CviJI | || | | DdeI |||AciI | || | | | AluI |||BisI BsmAI | || | | | CviJI ||||BlsI Eco31I | || | | | | SetI |||||TauI TspDTI \ \ \\ \ \ \ \ \ \\\\\\ \ CCTGTGTCTGATACATGGAAGTTACTCAGCTCTAAAGAAGCCGCCGATATTTATACCCCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GGACACAGACTATGTACCTTCAATGAGTCGAGATTTCTTCGGCGGCTATAAATATGGGGA / / / // / /// // //// / | | | |FatI | ||CviJI || |||AciI TspDTI | | | CviAII | ||AluI || ||BisI | | NlaIII | |DdeI || |BlsI | Hpy188I | SetI || CviJI Eco31I MaeIII || TauI BsmAI |BseMII BspCNI P V S D T W K L L S S K E A A D I Y T P L C L I H G S Y S A L K K P P I F I P L C V * Y M E V T Q L * R S R R Y L Y P F ----:----|----:----|----:----|----:----|----:----|----:----| G T D S V H F N S L E L S A A S I * V G E Q T Q Y M S T V * S * L L R R Y K Y G R H R I C P L * E A R F F G G I N I G R AccI |Hpy166II TspEI \\ \ TTTCATTATTATTTGTCTACCATAAGTTTTCAAAGTAAGGACAATTCAACGACTTTGCCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGTAATAATAAACAGATGGTATTCAAAAGTTTCATTCCTGTTAAGTTGCTGAAACGGA // / |AccI TspEI Hpy166II F H Y Y L S T I S F Q S K D N S T T L P F I I I C L P * V F K V R T I Q R L C L S L L F V Y H K F S K * G Q F N D F A F ----:----|----:----|----:----|----:----|----:----|----:----| K * * * K D V M L K * L L S L E V V K G K E N N N T * W L N E F Y P C N L S K A K M I I Q R G Y T K L T L V I * R S Q R Tsp4CI* | TspRI | HindII | Hpy166II | | BssKI | | SexAI | | EcoRII | | | ScrFI Hin4II* | | | BseBI | MaeII | | | | Csp6I MseI | | SetI | | | | |RsaI |SapI | | TaiI | | | | |SetI |Ksp632I* CviJI \ \ \ \ \ \ \ \\ \\ \ TCCCTTGATGACGTTATTTACAGTGTTGACCATACCAGGTACTTATTAAGTGAAGAGCCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGGGAACTACTGCAATAAATGTCACAACTGGTATGGTCCATGAATAATTCACTTCTCGGT / / / / / / // /// / / / | | | | | Hpy166II || ||Csp6I | | CviJI | | | | | HindII || |RsaI | Ksp632I* | | | | Tsp4CI* || EcoRII | SapI | | | TspRI || SexAI MseI | | MaeII || BssKI | TaiI |BseBI | SetI |ScrFI Hin4II* SetI S L D D V I Y S V D H T R Y L L S E E P P L M T L F T V L T I P G T Y * V K S Q P * * R Y L Q C * P Y Q V L I K * R A K ----:----|----:----|----:----|----:----|----:----|----:----| E R S S T I * L T S W V L Y K N L S S G K G Q H R * K C H Q G Y W T S I L H L A G K I V N N V T N V M G P V * * T F L W SpeI MboII |MaeI Hpy188I TspGWI TspEI \ \\ \ \ \ AAGATACCAACTGAACTAGTGTCTGAAAACGGAACGAAATGGAGATTGAGAAACAACAGC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTATGGTTGACTTGATCACAGACTTTTGCCTTGCTTTACCTCTAACTCTTTGTTGTCG / // / / MboII || Hpy188I TspGWI |SpeI MaeI K I P T E L V S E N G T K W R L R N N S R Y Q L N * C L K T E R N G D * E T T A D T N * T S V * K R N E M E I E K Q Q Q ----:----|----:----|----:----|----:----|----:----|----:----| F I G V S S T D S F P V F H L N L F L L L S V L Q V L T Q F R F S I S I S F C C L Y W S F * H R F V S R F P S Q S V V A AsuI* AvaII |BmgT120I || SetI || |CviRI* || || BspMI TspEI || || |SspI BsiYI* | HphI \\ \\ \\ \ \ \ AATTTTATTTTGGACCTGCATAATATTTACCGAAATATGGTGAAGCAATTTTCTAACAAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAAATAAAACCTGGACGTATTATAAATGGCTTTATACCACTTCGTTAAAAGATTGTTT / /// / / / / / TspEI ||| | | BspMI BsiYI* TspEI ||| | SspI HphI ||| CviRI* ||AvaII ||AsuI* |BmgT120I SetI N F I L D L H N I Y R N M V K Q F S N K I L F W T C I I F T E I W * S N F L T K F Y F G P A * Y L P K Y G E A I F * Q N ----:----|----:----|----:----|----:----|----:----|----:----| L K I K S R C L I * R F I T F C N E L L C N * K P G A Y Y K G F Y P S A I K * C I K N Q V Q M I N V S I H H L L K R V F ApoI BseGI TspEI | MaeI | MboI | | TseI | BclI | | AluI | | DpnI | | CviJI | | |BstKTI | | |BisI | | || FokI | | ||BlsI | | || |TaqI BbvI | | ||SetI SetI \ \ \\ \\ \ \ \ \\\ \ ACGAGCGAATTTGATCAGTTCGATTTGTTTATCATCCTAGCTGCTTACCTTACTCTTTTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTCGCTTAAACTAGTCAAGCTAAACAAATAGTAGGATCGACGAATGGAATGAGAAAAA / // / // // ////// / | || BclI |FokI |BbvI |||||| SetI | || MboI TaqI BseGI |||||TseI | |DpnI ||||BisI | BstKTI |||BlsI TspEI ||CviJI ApoI ||AluI |MaeI SetI T S E F D Q F D L F I I L A A Y L T L F R A N L I S S I C L S S * L L T L L F F E R I * S V R F V Y H P S C L P Y S F L ----:----|----:----|----:----|----:----|----:----|----:----| V L S N S * N S K N I M R A A * R V R K F S R I Q D T R N T * * G L Q K G * E K R A F K I L E I Q K D D * S S V K S K K MboI MseI Hpy188I | MnlI | TsoI MseI | | FatI | DpnI | HindIII | | |CviAII | |BstKTI | | AluI | | || NlaIII | || BinI* | | CviJI \ \ \\ \ \ \\ \ \ \ \ TATACTCTCTGTTGCCTGTTTAATGACATGAGGAAAATCGGATCAAAGTTTTGGTTAAGC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ATATGAGAGACAACGGACAAATTACTGTACTCCTTTTAGCCTAGTTTCAAAACCAATTCG / / // //// / / / / | | |FatI |||| MboI BinI* | CviJI | | CviAII |||DpnI | AluI | NlaIII ||BstKTI MseI MseI |TsoI SetI MnlI Hpy188I Y T L C C L F N D M R K I G S K F W L S I L S V A C L M T * G K S D Q S F G * A Y S L L P V * * H E E N R I K V L V K L ----:----|----:----|----:----|----:----|----:----|----:----| * V R Q Q R N L S M L F I P D F N Q N L K Y E R N G T * H C S S F R I L T K T L I S E T A Q K I V H P F D S * L K P * A FatI CviRI* |CviAII ||Cac8I ||| SphI ||| NspI ||| Hin6I ||| NlaIII TatI ||| |GlaI Bsp1407I ||| |MstI* |Csp6I ||| |FspAI ||RsaI SetI ||| ||HhaI |||Hpy166II Tsp4CI* \ \\\ \\\ \\\\ \ TTTTCTGCTCTTTCAAACTCTGCATGCGCATTATATTTATCGCTGTACACAACTCACAGT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAGACGAGAAAGTTTGAGACGTACGCGTAATATAAATAGCGACATGTGTTGAGTGTCA / / ///// /// / HindIII | ||||Hin6I ||Bsp1407I Tsp4CI* | |||FspAI ||TatI | |||MstI* |Hpy166II | |||GlaI |Csp6I | ||FatI RsaI | ||HhaI | |CviAII | Cac8I CviRI* NlaIII NspI SphI F S A L S N S A C A L Y L S L Y T T H S F L L F Q T L H A H Y I Y R C T Q L T V F C S F K L C M R I I F I A V H N S Q F ----:----|----:----|----:----|----:----|----:----|----:----| K E A R E F E A H A N Y K D S Y V V * L S K Q E K L S Q M R M I N I A T C L E C K R S K * V R C A C * I * R Q V C S V T Cfr10I |HpaII || CviJI || | MboII MseI TspEI \\ \ \ \ \ TTATTGAAGAAACCGGCTTCCTTATTAAGTTTGGTCATTGGACTACCATTTATCGTAGTA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AATAACTTCTTTGGCCGAAGGAATAATTCAAACCAGTAACCTGATGGTAAATAGCATCAT /// / ||MboII MseI |Cfr10I |CviJI HpaII L L K K P A S L L S L V I G L P F I V V Y * R N R L P Y * V W S L D Y H L S * * I E E T G F L I K F G H W T T I Y R S N ----:----|----:----|----:----|----:----|----:----|----:----| K N F F G A E K N L K T M P S G N I T T N I S S V P K R I L N P * Q V V M * R L * Q L F R S G * * T Q D N S * W K D Y Y AciI BcgI |BisI | CviJI ||BlsI | | FalI |||BsmI | | FalI |||TauI FalI ApoI | | MseI TaqI |||| BcgI FalI TspEI TspEI \ \ \ \ \\\\ \ \ \ \ ATTATTGGCTTTAAGCATAAAGTTCGACTTGCGGCATTCTCGCTACAAAAATTCCACAGA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TAATAACCGAAATTCGTATTTCAAGCTGAACGCCGTAAGAGCGATGTTTTTAAGGTGTCT // / / / / /// / / / || | | MseI TaqI ||| | FalI TspEI || | CviJI ||| | FalI ApoI || FalI ||| BcgI || FalI ||BisI |TspEI ||AciI BcgI |BlsI |BsmI TauI I I G F K H K V R L A A F S L Q K F H R L L A L S I K F D L R H S R Y K N S T E Y W L * A * S S T C G I L A T K I P Q N ----:----|----:----|----:----|----:----|----:----|----:----| I I P K L C L T R S A A N E S C F N W L L * Q S * A Y L E V Q P M R A V F I G C N N A K L M F N S K R C E R * L F E V S Hin4II* Tsp4CI* MnlI CviJI | Hpy178III* \ \ \ \ \ ATTAGTATTGACAAGAAAATAACGGTAAGCAACATTATTTATGAGGCTATGTTTCAAGAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TAATCATAACTGTTCTTTTATTGCCATTCGTTGTAATAAATACTCCGATACAAAGTTCTT / / / / / / / TspEI Tsp4CI* MnlI | | | SetI | | Hpy178III* | Hin4II* CviJI I S I D K K I T V S N I I Y E A M F Q E L V L T R K * R * A T L F M R L C F K K * Y * Q E N N G K Q H Y L * G Y V S R R ----:----|----:----|----:----|----:----|----:----|----:----| I L I S L F I V T L L M I * S A I N * S F * Y Q C S F L P L C C * K H P * T E L N T N V L F Y R Y A V N N I L S H K L F TspDTI HgiCI* | AluI | SetI AciI | CviJI Hin4II* | NlaIV MseI | FnuDII* | | SetI | BseGI \ \ \ \ \ \ \ \ \ \ GGTGCCTACTTAATCCGCGACTACTTATTTTATATTAGCTCCTTCATTGGATGTGCTATT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGGATGAATTAGGCGCTGATGAATAAAATATAATCGAGGAAGTAACCTACACGATAA / / / / / / / / / / | HgiCI* MseI FnuDII* | | CviJI | | MwoI NlaIV AciI | | AluI | BseGI | SetI Hin4II* TspDTI G A Y L I R D Y L F Y I S S F I G C A I V P T * S A T T Y F I L A P S L D V L F C L L N P R L L I L Y * L L H W M C Y L ----:----|----:----|----:----|----:----|----:----|----:----| P A * K I R S * K N * I L E K M P H A I L H R S L G R S S I K Y * S R * Q I H * T G V * D A V V * K I N A G E N S T S N PfoI MwoI BssKI |FokI | HpaII || MboII | ScrFI AccI || |MaeI | CauII* TspEI |Hpy166II MaeI \\ \\ \ \ \ \\ \ TATGCTAGACATCTTCCCGGATTGGTCAATTTCTGTATTTTGTCTACATTTATGCTAGTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ATACGATCTGTAGAAGGGCCTAACCAGTTAAAGACATAAAACAGATGTAAATACGATCAA / // /// / // / | |MaeI ||BssKI TspEI |AccI MaeI | FokI ||PfoI Hpy166II MboII |HpaII CauII* ScrFI Y A R H L P G L V N F C I L S T F M L V M L D I F P D W S I S V F C L H L C * F C * T S S R I G Q F L Y F V Y I Y A S F ----:----|----:----|----:----|----:----|----:----|----:----| * A L C R G P N T L K Q I K D V N I S T K H * V D E R I P * N R Y K T * M * A L I S S M K G S Q D I E T N Q R C K H * N AluI CviJI | SetI | | TspEI TaqI | | | MseI \ \ \ \ \ TTCGACTTGCTTTTGTCTGCTACTTTTTATTCTGCCATTTTATCAATGAAGCTGGAAATT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTGAACGAAAACAGACGATGAAAAATAAGACGGTAAAATAGTTACTTCGACCTTTAA / / / // TaqI | CviJI |TspEI | AluI |Hin4I SetI |Hin4I TspDTI F D L L L S A T F Y S A I L S M K L E I S T C F C L L L F I L P F Y Q * S W K L R L A F V C Y F L F C H F I N E A G N * ----:----|----:----|----:----|----:----|----:----|----:----| K S K S K D A V K * E A M K D I F S S I K R S A K T Q * K K N Q W K I L S A P F E V Q K Q R S S K I R G N * * H L Q F N MboI | DpnI | |BstKTI | || Tsp4CI* | || | Hpy188I | || | | Ksp632I* | || | | |MnlI TspDTI | || | | ||Hin4I | Hin4I | || | | ||Hin4I DrdI | Hin4I | || | | ||| BslFI MboII \ \ \ \\ \ \ \\\ \ \ AACATCATTCACAGATCAACCGTCATCAGACAGACTTTGGAAGAGGACGGAGTTGTCCCA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTAGTAAGTGTCTAGTTGGCAGTAGTCTGTCTGAAACCTTCTCCTGCCTCAACAGGGT / // / / / / / / / // / MseI || | | | | | | BslFI |MboII TspGWI || | | | | | Ksp632I* DrdI || | | | | MnlI || | | | Hin4I || | | | Hin4I || | | Hpy188I || | Tsp4CI* || MboI |DpnI BstKTI N I I H R S T V I R Q T L E E D G V V P T S F T D Q P S S D R L W K R T E L S Q H H S Q I N R H Q T D F G R G R S C P N ----:----|----:----|----:----|----:----|----:----|----:----| L M M * L D V T M L C V K S S S P T T G * C * E C I L R * * V S K P L P R L Q G V D N V S * G D D S L S Q F L V S N D W BseGI | CspCI | | EcoP15I | | |DdeI | | ||FokI | | ||| Hpy188I | | ||| | TspDTI | | ||| | | MnlI | | ||| | | | BspCNI | | ||| | | | |BseMII | | ||| | | | || TsoI | | ||| | | | || MboI | | ||| | | | || BglII | | ||| | | | || XhoII SfeI* | | ||| | | | || | DpnI TspGWI | | ||| | | | || | |BstKTI \ \ \ \\\ \ \ \ \\ \ \\ ACTACAGCAGATATTATATATAAGGATGAAACTGCCTCAGAACCACATTTTTTGAGATCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TGATGTCGTCTATAATATATATTCCTACTTTGACGGAGTCTTGGTGTAAAAAACTCTAGA / / / /// / / // / // / SfeI* | CspCI ||| | | || | || XhoII BseGI ||| | | || | || BglII ||| | | || | || MboI ||| | | || | |DpnI ||| | | || | BstKTI ||| | | || TsoI ||| | | |BseMII ||| | | BspCNI ||| | MnlI ||| FokI ||TspDTI ||DdeI |Hpy188I EcoP15I T T A D I I Y K D E T A S E P H F L R S L Q Q I L Y I R M K L P Q N H I F * D L Y S R Y Y I * G * N C L R T T F F E I * ----:----|----:----|----:----|----:----|----:----|----:----| V V A S I I Y L S S V A E S G C K K L D L * L L Y * I Y P H F Q R L V V N K S I S C C I N Y I L I F S G * F W M K Q S R MboI MaeII BclI | SetI Hpy188I | TaiI | DpnI | | CviJI | |BstKTI | | CspCI SfaNI | || SetI \ \ \ \ \ \\ \ AACGTGGCTATCATTCTGGGAAAAGCATCAGTTATTGGTCTTTTGCTTCTGATCAACCTT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCACCGATAGTAAGACCCTTTTCGTAGTCAATAACCAGAAAACGAAGACTAGTTGGAA / // / / / // // | || CviJI SfaNI | || |SetI | |CspCI | || BclI | MaeII | || MboI TaiI | |DpnI SetI | BstKTI Hpy188I N V A I I L G K A S V I G L L L L I N L T W L S F W E K H Q L L V F C F * S T F R G Y H S G K S I S Y W S F A S D Q P L ----:----|----:----|----:----|----:----|----:----|----:----| L T A I M R P F A D T I P R K S R I L R * R P * * E P F L M L * Q D K A E S * G V H S D N Q S F C * N N T K Q K Q D V K Tsp4CI* | MlyI MseI | PleI HinfI TspEI \ \ \ \ \ TATGTTTTCACAGATAAGTTAAATGCTACAATACTAAACACGGTATATTTTGACTCTACA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| ATACAAAAGTGTCTATTCAATTTACGATGTTATGATTTGTGCCATATAAAACTGAGATGT / / // / MseI | |PleI HinfI | MlyI Tsp4CI* Y V F T D K L N A T I L N T V Y F D S T M F S Q I S * M L Q Y * T R Y I L T L Q C F H R * V K C Y N T K H G I F * L Y N ----:----|----:----|----:----|----:----|----:----|----:----| * T K V S L N F A V I S F V T Y K S E V K H K * L Y T L H * L V L C P I N Q S * I N E C I L * I S C Y * V R Y I K V R C TspGWI | MboI | BclI ApoI TspEI DdeI | BspCNI MaeIII TspEI | PsiI |MwoI | |BseMII \ \ \ \ \\ \ \\ ATTTACTCGTTACCAAATTTTATCAATTATAAAGATATTGGCAATCTCAGCAATCAAGTG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TAAATGAGCAATGGTTTAAAATAGTTAATATTTCTATAACCGTTAGAGTCGTTAGTTCAC / / / // / / / // / TspEI | TspEI |PsiI MwoI DdeI | || BstKTI | ApoI TspEI | |BseMII MaeIII | BspCNI TspGWI I Y S L P N F I N Y K D I G N L S N Q V F T R Y Q I L S I I K I L A I S A I K * L L V T K F Y Q L * R Y W Q S Q Q S S D ----:----|----:----|----:----|----:----|----:----|----:----| I * E N G F K I L * L S I P L R L L * T L K S T V L N * * N Y L Y Q C D * C D L N V R * W I K D I I F I N A I E A I L H MboI Hpy188I | DpnI DpnI | |TaqI |BstKTI AciI | |BccI || MslI SspI | NspBII* | |BstKTI \\ \ \ \ \ \ \\ ATCATTTCCGTGTTGCCAAAGCAATATTATACTCCGCTGAAAAAATACCATCAGATCGAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTAAAGGCACAACGGTTTCGTTATAATATGAGGCGACTTTTTTATGGTAGTCTAGCTT / / / / / / // // | | MslI SspI NspBII* | || |TaqI | BclI AciI | || BccI | MboI | || MboI DpnI | |DpnI | BstKTI Hpy188I I I S V L P K Q Y Y T P L K K Y H Q I E S F P C C Q S N I I L R * K N T I R S K H F R V A K A I L Y S A E K I P S D R R ----:----|----:----|----:----|----:----|----:----|----:----| I M E T N G F C Y * V G S F F Y W * I S S * K R T A L A I N Y E A S F I G D S R D N G H Q W L L I I S R Q F F V M L D F BsrDI | Hpy178III* | | AsuI* | | AvaII | | |NlaIV TfiI MboII TfiI | | |BmgT120I HinfI | TspGWI HinfI | | || TspEI BslFI \ \ \ \ \ \ \\ \ \ GATTCTGTTCTACTTATCATTGATTCCGTTAGCAATGCTATTCGGGACCAATTTATCAGC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGACAAGATGAATAGTAACTAAGGCAATCGTTACGATAAGCCCTGGTTAAATAGTCG / / / / / //// / | | TspGWI HinfI BsrDI |||| TspEI | MboII TfiI |||AvaII HinfI |||AsuI* TfiI ||BmgT120I |NlaIV Hpy178III* D S V L L I I D S V S N A I R D Q F I S I L F Y L S L I P L A M L F G T N L S A F C S T Y H * F R * Q C Y S G P I Y Q Q ----:----|----:----|----:----|----:----|----:----|----:----| S E T R S I M S E T L L A I R S W N I L L N Q E V * * Q N R * C H * E P G I * * I R N * K D N I G N A I S N P V L K D A BccI TseI |AccI |BisI CviRI* ||BbvI ||BlsI MaeIII | CviRI* ||Hpy166II ||BsmI \ \ \ \\\ \\\ AAGTTACTTTTTTTTGCATTTGCAGTTAGTATTTCCATCAATGTCTACTTACTGAATGCT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAATGAAAAAAAACGTAAACGTCAATCATAAAGGTAGTTACAGATGAATGACTTACGA / / / / /// / /// | MaeIII | CviRI* ||| BbvI ||BisI BslFI CviRI* ||AccI |BlsI |Hpy166II BsmI BccI K L L F F A F A V S I S I N V Y L L N A S Y F F L H L Q L V F P S M S T Y * M L V T F F C I C S * Y F H Q C L L T E C C ----:----|----:----|----:----|----:----|----:----|----:----| L N S K K A N A T L I E M L T * K S F A C T V K K Q M Q L * Y K W * H R S V S H L * K K K C K C N T N G D I D V * Q I S MboI | DpnI | |TaqI | |ClaI | |BstKTI CviRI* | || MboI | ApoI FatI TspDTI | || MmeI | TspEI |CviAII | Hin4I | || | DpnI | | BciVI || NlaIII | Hin4I | || | |BstKTI \ \ \ \\ \ \ \ \ \\ \ \\ GCAAAAATTCACACAGGATACATGAACTTCCAACCACAATCAAATAAGATCGATGATCTT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTTTAAGTGTGTCCTATGTACTTGAAGGTTGGTGTTAGTTTATTCTAGCTACTAGAA / / / // // // // // / CviRI* TspEI | |FatI |TspDTI || || || MboI TseI BciVI | CviAII Hin4I || || |DpnI ApoI NlaIII Hin4I || || BstKTI || |MmeI || |ClaI || |TaqI || MboI |DpnI BstKTI A K I H T G Y M N F Q P Q S N K I D D L Q K F T Q D T * T S N H N Q I R S M I L K N S H R I H E L P T T I K * D R * S C ----:----|----:----|----:----|----:----|----:----|----:----| A F I * V P Y M F K W G C D F L I S S R Q L F E C L I C S S G V V I L Y S R H D C F N V C S V H V E L W L * I L D I I K Hpy188I Hin4I | BarI MboII GsuI Hin4I | | TaqI | Cac8I Eco57MI \ \ \ \ \ \ \ GTTGTTCAGCAAAAATCGGCAACGATTGAGTTTTCAGAAACTCGAAGTATGCCTGCTTCT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CAACAAGTCGTTTTTAGCCGTTGCTAACTCAAAAGTCTTTGAGCTTCATACGGACGAAGA / // / / / / Hin4I |Hpy188I TaqI | | Eco57MI Hin4I BarI | | GsuI | Cac8I MboII V V Q Q K S A T I E F S E T R S M P A S L F S K N R Q R L S F Q K L E V C L L L C S A K I G N D * V F R N S K Y A C F F ----:----|----:----|----:----|----:----|----:----|----:----| T T * C F D A V I S N E S V R L I G A E Q Q E A F I P L S Q T K L F E F Y A Q K N N L L F R C R N L K * F S S T H R S R BsrI | MaeIII CviJI | Tsp45I HaeIII | | AciI Hpy178III* | MaeI | | TspRI | HgaI | | BarI | | | FnuDII* TspEI Hpy188I | |MboII \ \ \ \ \ \ \ \ \ \ \\ TCTGGCCTAGAAACTCCAGTGACCGCGAAAGATATAATTATCTCTGAAGAAATCCAGAAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AGACCGGATCTTTGAGGTCACTGGCGCTTTCTATATTAATAGAGACTTCTTTAGGTCTTA // / / / / / / // || MaeI TspRI | FnuDII* | Hpy188I |MboII |BarI BsrI | AciI TspEI Hpy178III* HaeIII Tsp45I CviJI MaeIII S G L E T P V T A K D I I I S E E I Q N L A * K L Q * P R K I * L S L K K S R I W P R N S S D R E R Y N Y L * R N P E * ----:----|----:----|----:----|----:----|----:----|----:----| E P R S V G T V A F S I I I E S S I W F K Q G L F E L S R S L Y L * R Q L F G S R A * F S W H G R F I Y N D R F F D L I BssKI SecI* EcoRII | ScrFI Eco57I | BseBI TaqI Eco57MI | | TspGWI | ApoI | BsmI | | | CviJI | TspEI \ \ \ \ \ \ \ \ AACGAATGCGTCTATGCTTTGAGTTCCCAGGACGAGCCTATCCGTCCTTTATCGAATTTA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTTACGCAGATACGAAACTCAAGGGTCCTGCTCGGATAGGCAGGAAATAGCTTAAAT // / /// / / / || BsmI ||| CviJI | TspEI |Eco57MI ||EcoRII | ApoI |Eco57I ||BssKI TaqI HgaI |SecI* TspGWI BseBI ScrFI N E C V Y A L S S Q D E P I R P L S N L T N A S M L * V P R T S L S V L Y R I * R M R L C F E F P G R A Y P S F I E F S ----:----|----:----|----:----|----:----|----:----|----:----| L S H T * A K L E W S S G I R G K D F K Y R I R R H K S N G P R A * G D K I S N V F A D I S Q T G L V L R D T R * R I * FatI TspDTI |CviAII |SetI || BseMII || TaqI || |BspCNI || AsuII TspEI || |NlaIII || | TfiI | MseI || || MnlI DdeI || | HinfI \ \ \\ \\ \ \ \\ \ \ GTGGAACTTATGGAGAAAGAACAATTAAAGAACATGAATAATACTGAGGTTTCGAATCTT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTTGAATACCTCTTTCTTGTTAATTTCTTGTACTTATTATGACTCCAAAGCTTAGAA // ///// / // / / |MseI ||||| MnlI |TspDTI | HinfI TspEI ||||FatI |DdeI | TfiI |||CviAII SetI AsuII ||BspCNI TaqI |BseMII NlaIII V E L M E K E Q L K N M N N T E V S N L W N L W R K N N * R T * I I L R F R I L G T Y G E R T I K E H E * Y * G F E S C ----:----|----:----|----:----|----:----|----:----|----:----| T S S I S F S C N F F M F L V S T E F R L P V * P S L V I L S C S Y Y Q P K S D H F K H L F F L * L V H I I S L N R I K HindII Hpy166II | Tsp4CI* MnlI | | Hpy166II DdeI |TspEI BsiI* \ \ \ \ \\ \ GTCGTCAACGGTAAACTGCCATTATATTCCTTAGAGAAAAAATTAGAGGACACAACTCGT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCAGTTGCCATTTGACGGTAATATAAGGAATCTCTTTTTTAATCTCCTGTGTTGAGCA / / / / / / / | | Hpy166II DdeI MnlI TspEI BsiI* | Tsp4CI* Hpy166II HindII V V N G K L P L Y S L E K K L E D T T R S S T V N C H Y I P * R K N * R T Q L V R Q R * T A I I F L R E K I R G H N S C ----:----|----:----|----:----|----:----|----:----|----:----| T T L P L S G N Y E K S F F N S S V V R Q R * R Y V A M I N R L S F I L P C L E D D V T F Q W * I G * L F F * L V C S T CviJI | AjuI Eco57I | |TfiI Eco57MI AciI | |HinfI TspEI | Hpy188I \ \ \\ \ \ \ GCGGTTTTAGTTAGGAGAAAGGCACTTTCAACTTTGGCTGAATCGCCAATTTTAGTTTCC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CGCCAAAATCAATCCTCTTTCCGTGAAAGTTGAAACCGACTTAGCGGTTAAAATCAAAGG / / / / / / / AciI | CviJI HinfI | | Hpy188I AjuI TfiI | Eco57MI | Eco57I TspEI A V L V R R K A L S T L A E S P I L V S R F * L G E R H F Q L W L N R Q F * F P G F S * E K G T F N F G * I A N F S F R ----:----|----:----|----:----|----:----|----:----|----:----| A T K T L L F A S E V K A S D G I K T E H P K L * S F P V K L K P Q I A L K L K R N * N P S L C K * S Q S F R W N * N G BsaBI |MboI AluI Hpy188I || DpnI CviJI | TspEI || |BstKTI | SetI TspEI AjuI | | Hin4II* || || FnuDII* | Cac8I \ \ \ \ \ \\ \\ \ \ \ GAAAAATTGCCCTTCAGAAATTATGATTATGATCGCGTTTTTGGAGCTTGCTGTGAAAAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTAACGGGAAGTCTTTAATACTAATACTAGCGCAAAAACCTCGAACGACACTTTTA / / / / / / // // / / / | TspEI | | TspEI | || |FnuDII* | | Cac8I AjuI | Hin4II* | || MboI | CviJI Hpy188I | |DpnI | AluI | BstKTI SetI BsaBI E K L P F R N Y D Y D R V F G A C C E N K N C P S E I M I M I A F L E L A V K M K I A L Q K L * L * S R F W S L L * K C ----:----|----:----|----:----|----:----|----:----|----:----| S F N G K L F * S * S R T K P A Q Q S F R F I A R * F N H N H D R K Q L K S H F F F Q G E S I I I I I A N K S S A T F I TspEI | AsuI* | AvaII | |BmgT120I | || MseI | || VspI | || Hin4I | || Hin4I | || |TspEI CviJI BsrI | || || BccI \ \ \ \\ \\ \ GTCATCGGCTATATGCCAATACCAGTTGGTGTAATTGGTCCATTAATTATTGATGGAACA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTAGCCGATATACGGTTATGGTCAACCACATTAACCAGGTAATTAATAACTACCTTGT / / / /// / // CviJI BsrI | ||| | |TspEI | ||| | BccI | ||| VspI | ||| MseI | ||AvaII | ||AsuI* | |BmgT120I | Hin4I | Hin4I TspEI V I G Y M P I P V G V I G P L I I D G T S S A I C Q Y Q L V * L V H * L L M E H H R L Y A N T S W C N W S I N Y * W N I ----:----|----:----|----:----|----:----|----:----|----:----| T M P * I G I G T P T I P G N I I S P V H * R S Y A L V L Q H L Q D M L * Q H F D D A I H W Y W N T Y N T W * N N I S C Hin4II* MslI | Eco57I AluI | Hin4I |SecI* Eco57MI TspGWI CviJI | Hin4I |DsaI* | SetI | CviJI | SetI CspCI \ \ \\ \ \ \ \ \ \ \ TCTTATCACATACCAATGGCAACCACGGAAGGTTGTTTAGTGGCTTCAGCTATGCGTGGT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AGAATAGTGTATGGTTACCGTTGGTGCCTTCCAACAAATCACCGAAGTCGATACGCACCA / / / / / / / / / / | MslI | | SetI | | | CviJI CspCI Hin4I | Eco57MI | | | AluI Hin4I | Eco57I | | SetI | DsaI* | CviJI | SecI* TspGWI Hin4II* S Y H I P M A T T E G C L V A S A M R G L I T Y Q W Q P R K V V * W L Q L C V V L S H T N G N H G R L F S G F S Y A W L ----:----|----:----|----:----|----:----|----:----|----:----| D * * M G I A V V S P Q K T A E A I R P M K D C V L P L W P L N N L P K L * A H R I V Y W H C G R F T T * H S * S H T T CspCI Hin4I |Tsp4CI* | MnlI CviRI* MwoI || MseI | | TsoI | CviJI | BccI CviRI* || | BccI | | | MaeI \ \ \ \ \ \\ \ \ \ \ \ \ TGCAAAGCCATCAATGCTGGTGGTGGTGCAACAACTGTTTTAACCAAAGATGGTATGACT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| ACGTTTCGGTAGTTACGACCACCACCACGTTGTTGACAAAATTGGTTTCTACCATACTGA / / / / / / / / / / // / | | MwoI BccI | | | | | Hin4I |TsoI BfiI | CviJI | | | | BccI MnlI CviRI* | | | MseI | | Tsp4CI* | CspCI CviRI* C K A I N A G G G A T T V L T K D G M T A K P S M L V V V Q Q L F * P K M V * L Q S H Q C W W W C N N C F N Q R W Y D * ----:----|----:----|----:----|----:----|----:----|----:----| Q L A M L A P P P A V V T K V L S P I V N C L W * H Q H H H L L Q K L W L H Y S A F G D I S T T T C C S N * G F I T H S MboI BglII XhoII | DpnI BfiI | |BstKTI | AsuI* | || HgiCI* | |CviJI | || | NlaIV | |HaeIII | || | | TsoI | |BmgT120I Hin4I | || | | Cac8I MlyI | || BsrI | MseI | || | | | CviRI* PleI \ \\ \ \ \ \ \\ \ \ \ \ \ AGAGGCCCAGTCGTTCGTTTCCCTACTTTAATAAGATCTGGTGCCTGCAAGATATGGTTA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCCGGGTCAGCAAGCAAAGGGATGAAATTATTCTAGACCACGGACGTTCTATACCAAT / /// / / // / //// / // | ||AsuI* Hin4I MseI || | |||| CviRI* |PleI | |BmgT120I || | |||Cac8I MlyI | HaeIII || | ||HgiCI* | CviJI || | |TsoI | BsrI || | NlaIV MaeI || XhoII || BglII || MboI |DpnI BstKTI R G P V V R F P T L I R S G A C K I W L E A Q S F V S L L * * D L V P A R Y G * R P S R S F P Y F N K I W C L Q D M V R ----:----|----:----|----:----|----:----|----:----|----:----| L P G T T R K G V K I L D P A Q L I H N * L G L R E N G * K L L I Q H R C S I T S A W D N T E R S * Y S R T G A L Y P * ApoI HindIII TspEI | AluI HinfI |MboII | CviJI |Ksp632I* || TspEI | | SetI SetI ||MnlI || | MseI | | | MseI | CviRI* ||| Hpy188I || | BslFI | | | |TspEI | | MaeII \\\ \ \\ \ \ \ \ \ \\ \ \ \ GACTCGGAAGAGGGACAAAATTCAATTAAAAAAGCTTTTAATTCTACATCAAGGTTTGCA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAGCCTTCTCCCTGTTTTAAGTTAATTTTTTCGAAAATTAAGATGTAGTTCCAAACGT / // / / // / / / / / / / // | |Ksp632I* | | || | | | | | TspEI SetI |TaiI | |Hpy188I | | || | | | | MseI |SetI | HinfI | | || | | | HindIII CviRI* MnlI | | || | | CviJI | | || | | AluI | | || | SetI | | || BslFI | | |MseI | | TspEI | TspEI | ApoI MboII D S E E G Q N S I K K A F N S T S R F A T R K R D K I Q L K K L L I L H Q G L H L G R G T K F N * K S F * F Y I K V C T ----:----|----:----|----:----|----:----|----:----|----:----| S E S S P C F E I L F A K L E V D L N A L S P L P V F N L * F L K * N * M L T Q V R F L S L I * N F F S K I R C * P K C SetI TaiI SetI | CviRI* | MaeI Cac8I Hpy188I \ \ \ \ \ \ CGTTTGCAACATATTCAAACCTGTCTAGCAGGCGATTTGCTTTTTATGAGATTTCGGACA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| GCAAACGTTGTATAAGTTTGGACAGATCGTCCGCTAAACGAAAAATACTCTAAAGCCTGT / / / / / / | CviRI* SetI | Cac8I Hpy188I MaeII MaeI R L Q H I Q T C L A G D L L F M R F R T V C N I F K P V * Q A I C F L * D F G Q F A T Y S N L S S R R F A F Y E I S D N ----:----|----:----|----:----|----:----|----:----|----:----| R K C C I * V Q R A P S K S K I L N R V V N A V Y E F R D L L R N A K * S I E S T Q L M N L G T * C A I Q K K H S K P C FatI |CviAII AgeI || NlaIII BetI* || | EcoRV Cfr10I || | | TaqI |HpaII HgaI || | | | TspDTI || MaeIII HphI || | | | | SetI || Tsp45I |BsrDI || | | | | | TaqI \\ \ \\ \\ \ \ \ \ \ \ ACTACCGGTGACGCAATGGGTATGAACATGATATCGAAAGGTGTCGAATACTCTTTGAAA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TGATGGCCACTGCGTTACCCATACTTGTACTATAGCTTTCCACAGCTTATGAGAAACTTT // / / / / // / // / / || | BsrDI | | || | || SetI TaqI || | HphI | | || | |TaqI || Tsp45I | | || | TspDTI || MaeIII | | || EcoRV |Cfr10I | | |FatI |BetI* | | CviAII |AgeI | NlaIII HpaII HgaI T T G D A M G M N M I S K G V E Y S L K L P V T Q W V * T * Y R K V S N T L * N Y R * R N G Y E H D I E R C R I L F E T ----:----|----:----|----:----|----:----|----:----|----:----| V V P S A I P I F M I D F P T S Y E K F L * R H R L P Y S C S I S L H R I S K S S G T V C H T H V H Y R F T D F V R Q F TspGWI MboII | MboII BsmAI MaeIII \ \ \ \ \ CAAATGGTAGAAGAATATGGTTGGGAAGATATGGAAGTTGTCTCCGTATCTGGTAACTAT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTACCATCTTCTTATACCAACCCTTCTATACCTTCAACAGAGGCATAGACCATTGATA / / / / / MboII | MboII BsmAI MaeIII TspGWI Q M V E E Y G W E D M E V V S V S G N Y K W * K N M V G K I W K L S P Y L V T I N G R R I W L G R Y G S C L R I W * L L ----:----|----:----|----:----|----:----|----:----|----:----| C I T S S Y P Q S S I S T T E T D P L * V F P L L I H N P L Y P L Q R R I Q Y S L H Y F F I T P F I H F N D G Y R T V I SetI | AciI | BisI | |BlsI | ||TauI | ||| Hin4I | ||| Hin4I | ||| BspMI TatI | ||| | MfeI |Csp6I | ||| | TspEI Hin4I ||RsaI | ||| | | Hin4II* SetI Hin4I \\\ \ \\\ \ \ \ \ \ TGTACTGATAAGAAACCTGCCGCAATCAATTGGATTGAAGGTCGTGGTAAAAGTGTCGTA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| ACATGACTATTCTTTGGACGGCGTTAGTTAACCTAACTTCCAGCACCATTTTCACAGCAT /// / //// / // / / / ||TatI SetI |||AciI | |TspEI SetI Hin4I SetI |Csp6I ||BisI | |MfeI Hin4I RsaI |BlsI | Hin4II* Hin4I BspMI Hin4I TauI C T D K K P A A I N W I E G R G K S V V V L I R N L P Q S I G L K V V V K V S * Y * * E T C R N Q L D * R S W * K C R S ----:----|----:----|----:----|----:----|----:----|----:----| Q V S L F G A A I L Q I S P R P L L T T N Y Q Y S V Q R L * N S Q L D H Y F H R T S I L F R G C D I P N F T T T F T D Y AluI CviJI | SetI BssKI | | AluI EcoRII | | CviJI | ScrFI Eco57I MseI | | | SetI | BseBI Eco57MI HphI |AhaIII* AciI \ \ \ \ \ \ \ \ \\ \ GCTGAAGCTACTATTCCTGGTGATGTCGTAAAAAGTGTTTTAAAGAGCGATGTTTCCGCT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTTCGATGATAAGGACCACTACAGCATTTTTCACAAAATTTCTCGCTACAAAGGCGA / / / / // / // / | | CviJI | |Eco57MI HphI |MseI AciI | | AluI | |Eco57I AhaIII* | SetI | EcoRII CviJI | BssKI AluI BseBI ScrFI A E A T I P G D V V K S V L K S D V S A L K L L F L V M S * K V F * R A M F P L * S Y Y S W * C R K K C F K E R C F R F ----:----|----:----|----:----|----:----|----:----|----:----| A S A V I G P S T T F L T K F L S T E A L Q L * * E Q H H R L F H K L S R H K R S F S S N R T I D Y F T N * L A I N G S BstXI | BinI* | | MboI | | BamHI | | XhoII | | | DpnI | | | NlaIV | | | |BstKTI | | | ||AciI | | | ||| BinI* | | | ||| | CviJI | | | ||| | |BsrDI | | | ||| | || MboI BtgZI | | | ||| | || XhoII | TspEI | | | ||| | || | DpnI | | MseI | | | ||| | || | |BstKTI | | | MmeI | | | ||| | || | || BinI* \ \ \ \ \ \ \ \\\ \ \\ \ \\ \ TTAGTTGAATTAAATATATCCAAGAACTTGGTTGGATCCGCAATGGCTGGATCTGTTGGT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| AATCAACTTAATTTATATAGGTTCTTGAACCAACCTAGGCGTTACCGACCTAGACAACCA / /// / / // / / / // // / / | ||MseI BstXI | || | | | || || | BinI* | |TspEI | || | | | || || XhoII | MmeI | || | | | || || MboI BtgZI | || | | | || |DpnI | || | | | || BstKTI | || | | | |CviJI | || | | | BsrDI | || | | BinI* | || | AciI | || XhoII | || BamHI | || MboI | |NlaIV | |DpnI | BstKTI BinI* L V E L N I S K N L V G S A M A G S V G * L N * I Y P R T W L D P Q W L D L L V S * I K Y I Q E L G W I R N G W I C W W ----:----|----:----|----:----|----:----|----:----|----:----| K T S N F I D L F K T P D A I A P D T P K L Q I L Y I W S S P Q I R L P Q I Q Q * N F * I Y G L V Q N S G C H S S R N T Hin6I FnuDII* |GlaI ||HhaI ||| Cac8I ||| | TseI ||| | MwoI ||| | |BsgI BinI* ||| | |BisI |CviJI ||| | ||BlsI |HaeIII ||| | |||AluI MaeIII || MboI ||| | |||CviJI Tsp45I || XhoII ||| | |||| SetI |BbvI CviRI* || | DpnI ||| | |||| TspEI ||BtsI | TspRI || | |BstKTI \\\ \ \\\\ \ \\\ \ \ \\ \ \\ GGTTTCAACGCGCACGCAGCTAATTTGGTCACTGCACTTTTCTTGGCATTAGGCCAAGAT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAAGTTGCGCGTGCGTCGATTAAACCAGTGACGTGAAAAGAACCGTAATCCGGTTCTA ////// /// / / / / / // |||||| ||CviJI | | | CviRI* | |DpnI |||||| ||TseI | | Tsp45I | BstKTI |||||| ||AluI | | MaeIII HaeIII |||||| |BisI | | BbvI CviJI |||||| BlsI | TspRI BinI* |||||| SetI | BtsI |||||BsgI TspEI ||||Cac8I |||MwoI ||Hin6I |GlaI FnuDII* HhaI G F N A H A A N L V T A L F L A L G Q D V S T R T Q L I W S L H F S W H * A K I F Q R A R S * F G H C T F L G I R P R S ----:----|----:----|----:----|----:----|----:----|----:----| P K L A C A A L K T V A S K K A N P W S H N * R A R L * N P * Q V K R P M L G L T E V R V C S I Q D S C K E Q C * A L I MaeII Hin6I | TaqI |GlaI | SetI |MstI* | TaiI BccI ||HhaI | | Hpy99I Tsp4CI* Hin4II* |MmeI TspDTI \\\ \ \ \ \ \ \\ \ CCTGCGCAGAACGTCGAAAGTTCCAACTGTATAACTTTGATGAAGGAAGTTGATGGTGAT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| GGACGCGTCTTGCAGCTTTCAAGGTTGACATATTGAAACTACTTCCTTCAACTACCACTA / /// // / / / / / / / | ||| || | TaqI Tsp4CI* Hin4II* | BccI TspDTI | ||| || MaeII MmeI | ||| |Hpy99I | ||| TaiI | ||| SetI | ||Hin6I | |MstI* | |GlaI | HhaI XhoII MboI P A Q N V E S S N C I T L M K E V D G D L R R T S K V P T V * L * * R K L M V I C A E R R K F Q L Y N F D E G S * W * F ----:----|----:----|----:----|----:----|----:----|----:----| G A C F T S L E L Q I V K I F S T S P S D Q A S R R F N W S Y L K S S P L Q H H R R L V D F T G V T Y S Q H L F N I T I MseI | MboI | XhoII | | DpnI | | HphI | | |BstKTI | | || BinI* | | || | FatI Csp6I Csp6I | | || | |CviAII |RsaI |RsaI | | || | || NlaIII BccI ||FauI AciI || Tsp4CI* \ \ \\ \ \\ \ \ \\\ \ \\ \ TTAAGGATCTCTGTTTCCATGCCATCTATTGAAGTTGGTACGATTGGCGGGGGTACTGTT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| AATTCCTAGAGACAAAGGTACGGTAGATAACTTCAACCATGCTAACCGCCCCCATGACAA / // / / / // / // / / /// | || | | | |FatI BccI || FauI AciI ||Tsp4CI* | || | | | CviAII |Csp6I |Csp6I | || | | NlaIII RsaI RsaI | || | BinI* | || XhoII | || MboI | |DpnI | BstKTI | HphI MseI L R I S V S M P S I E V G T I G G G T V * G S L F P C H L L K L V R L A G V L F K D L C F H A I Y * S W Y D W R G Y C S ----:----|----:----|----:----|----:----|----:----|----:----| K L I E T E M G D I S T P V I P P P V T N L S R Q K W A M * Q L Q Y S Q R P Y Q * P D R N G H W R N F N T R N A P T S N Hpy178III* | NlaIV | |CviJI | || DdeI | || SauI* | || | NmeAIII | || | | KasI | || | | HgiCI* | || | | |AcyI | || | | |NarI | || | | |Hin6I | || | | ||GlaI | || | | ||DinI | || | | ||NlaIV | || | | |||HhaI | || | | ||||FatI | || | | ||||MnlI | || | | ||||HaeII | || | | |||||CviAII | || | | ||||||MboII | || | | ||||||| NlaIII | || | | ||||||| BspCNI | || | | ||||||| |GsuI | || | | ||||||| |BseMII | || | | ||||||| |Eco57MI HphI MnlI | || | | ||||||| || MboI | AsuI* | BssKI | || | | ||||||| || | DpnI | AvaII | TspRI | || | | ||||||| || | |BstKTI | |BmgT120I | EcoRII \ \\ \ \ \\\\\\\ \\ \ \\ \ \\ \ \ CTGGAGCCTCAGGGCGCCATGCTTGATCTTCTCGGCGTTCGTGGTCCTCACCCCACTGAA 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| GACCTCGGAGTCCCGCGGTACGAACTAGAAGAGCCGCAAGCACCAGGAGTGGGGTGACTT / // / / ///////// // / / // / / / | || | | ||||||||| || MboI HphI || | | SetI | || | | ||||||||| |DpnI || | MnlI | || | | ||||||||| BstKTI || TspRI | || | | ||||||||FatI |AvaII | || | | |||||||Eco57MI |AsuI* | || | | |||||||BseMII BmgT120I | || | | |||||||CviAII | || | | |||||||GsuI | || | | ||||||BspCNI | || | | |||||MboII | || | | ||||HgiCI* | || | | ||||NlaIII | || | | ||||KasI | || | | |||Hin6I | || | | |||MnlI | || | | |||NarI | || | | |||AcyI | || | | ||NlaIV | || | | ||DinI | || | | ||GlaI | || | | |HhaI | || | | HaeII | || | SauI* | || | DdeI | || NmeAIII | |CviJI | NlaIV Hpy178III* L E P Q G A M L D L L G V R G P H P T E W S L R A P C L I F S A F V V L T P L N G A S G R H A * S S R R S W S S P H * T ----:----|----:----|----:----|----:----|----:----|----:----| R S G * P A M S S R R P T R P G * G V S E P A E P R W A Q D E R R E H D E G W Q Q L R L A G H K I K E A N T T R V G S F TspEI | GsuI | Eco57MI | | AluI ScrFI | | CviJI BseBI | | |MaeI MwoI |SetI MaeI | | ||SetI FnuDII* | CviJI Hpy166II \\ \ \ \ \\\ \ \ \ \ CCTGGAGCAAATGCTAGGCAATTAGCTAGAATAATCGCGTGTGCTGTCTTGGCTGGTGAA 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| GGACCTCGTTTACGATCCGTTAATCGATCTTATTAGCGCACACGACAGAACCGACCACTT / / / / / / / / / / / | EcoRII MaeI | | | MaeI FnuDII* MwoI CviJI Hpy166II | BssKI | | CviJI BseBI | | AluI ScrFI | TspEI | SetI Eco57MI GsuI P G A N A R Q L A R I I A C A V L A G E L E Q M L G N * L E * S R V L S W L V N W S K C * A I S * N N R V C C L G W * T ----:----|----:----|----:----|----:----|----:----|----:----| G P A F A L C N A L I I A H A T K A P S V Q L L H * A I L * F L R T H Q R P Q H R S C I S P L * S S Y D R T S D Q S T F HphI TseI MwoI BstAPI |BisI ||BlsI |||Cfr10I ||||HpaII ||||| MaeIII ||||| Tsp45I ||||| BstEII ||||| | BssKI Tsp4CI* ||||| | SexAI | HphI ||||| | EcoRII | |BsmAI ||||| | | ScrFI CviJI | ||BbvI ||||| | | BseBI |MlyI | ||| SduI ||||| | | |SetI |PleI | ||| HgiAI* ||||| | | || Csp6I || NdeI | ||| |AciI ||||| | | || |RsaI || | HinfI \ \\\ \\ \\\\\ \ \ \\ \\ \\ \ \ CTGTCTCTGTGCTCCGCACTTGCTGCCGGTCACCTGGTACAAAGCCATATGACTCACAAC 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| GACAGAGACACGAGGCGTGAACGACGGCCAGTGGACCATGTTTCGGTATACTGAGTGTTG / / / // / / / /// // / / / /// /// / / / | | | || | | | ||| || | | | ||| ||| NdeI HinfI Tsp4CI* | | | || | | | ||| || | | | ||| ||PleI | | | || | | | ||| || | | | ||| |MlyI | | | || | | | ||| || | | | ||| CviJI | | | || | | | ||| || | | | ||Csp6I | | | || | | | ||| || | | | |RsaI | | | || | | | ||| || | | | EcoRII | | | || | | | ||| || | | | SexAI | | | || | | | ||| || | | | BssKI | | | || | | | ||| || | | BseBI | | | || | | | ||| || | | ScrFI | | | || | | | ||| || | BstEII | | | || | | | ||| || | Tsp45I | | | || | | | ||| || | MaeIII | | | || | | | ||| || SetI | | | || | | | ||| |Cfr10I | | | || | | | ||| HpaII | | | || | | | ||TseI | | | || | | | |BisI | | | || | | | BlsI | | | || | | HphI | | | || | BstAPI | | | || | MwoI | | | || AciI | | | |BbvI | | | BsmAI | | HgiAI* | | SduI | HphI Tsp4CI* L S L C S A L A A G H L V Q S H M T H N C L C A P H L L P V T W Y K A I * L T T V S V L R T C C R S P G T K P Y D S Q P ----:----|----:----|----:----|----:----|----:----|----:----| S D R H E A S A A P * R T C L W I V * L V T E T S R V Q Q R D G P V F G Y S E C Q R Q A G C K S G T V Q Y L A M H S V V AsuI* DraII Bsp120I |AsuI* |DraII |BmgT120I ||CviJI ||NlaIV ||HaeIII ||BmgT120I |||NlaIV ||||ApaI ||||SduI TspDTI ||||BseSI Tsp4CI* CviJI | MaeIII ||||HgiJII* \ \ \ \ \\\\\ CGTAAAACAAACAAAGCCAATGAACTGCCACAACCAAGTAACAAAGGGCCCCCCTGTAAA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| GCATTTTGTTTGTTTCGGTTACTTGACGGTGTTGGTTCATTGTTTCCCGGGGGGACATTT / / / / /// / CviJI TspDTI | | ||Bsp120I SetI | | ||DraII | | ||AsuI* | | |BmgT120I | | |DraII | | |AsuI* | | |NlaIV | | BmgT120I | | HaeIII | | NlaIV | | CviJI | HgiJII* | BseSI | SduI | ApaI MaeIII R K T N K A N E L P Q P S N K G P P C K V K Q T K P M N C H N Q V T K G P P V K * N K Q S Q * T A T T K * Q R A P L * N ----:----|----:----|----:----|----:----|----:----|----:----| R L V F L A L S S G C G L L L P G G Q L G Y F L C L W H V A V V L Y C L A G R Y T F C V F G I F Q W L W T V F P G G T F DdeI MnlI BbvCI | PsiI Bpu10I | |BspCNI |SetI | ||BseMII \\ \ \\\ ACCTCAGCATTATTATAA 3130 ----:----|----:--- TGGAGTCGTAATAATATT / / // | | |BseMII | | |PsiI | | BspCNI | MnlI Bpu10I BbvCI DdeI T S A L L * P Q H Y Y X L S I I I X ----:----|----:--- V E A N N Y F R L M I I G * C * * L # Enzymes that cut Frequency Isoschizomers AccI 3 FblI,XmiI AciI 12 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AjuI 1 AluI 13 AluBI ApaI 1 ApoI 6 AcsI,XapI AsuI* 7 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 4 Bme18I,Eco47I,SinI,VpaK11BI BamHI 1 BarI 1 BbvCI 1 BbvI 5 BseXI,BstV1I,Lsp1109I BccI 7 BcgI 1 BciVI 1 BfuI BclI 3 FbaI,Ksp22I BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglII 2 BinI* 6 AlwI,BspPI,AclWI BisI 9 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 9 BmgT120I 7 Bpu10I 1 BsaBI 1 Bse8I,BseJI BseBI 5 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 6 BseSI 1 BaeGI,BstSLI BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI Bsp120I 1 PspOMI Bsp1407I 1 BsrGI,BstAUI BspCNI 6 BspMI 2 BfuAI,Acc36I,BveI BsrDI 3 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BstAPI 1 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 16 BstXI 1 BtgZI 1 BtrI 1 BmgBI,AjiI BtsI 2 Cac8I 7 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 3 BsrFI,BssAI,Bse118I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 7 CviQI,RsaNI CspCI 2 CviAII 8 CviJI 35 CviKI-1 CviRI* 13 HpyCH4V DdeI 7 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 16 MalI DraII 2 EcoO109I DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 4 AcuI Eco57MI 7 EcoP15I 1 EcoRII 5 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FalI 2 FatI 8 FauI 1 SmuI FnuDII* 5 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 FspAI 1 GlaI 4 GsuI 3 BpmI HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 3 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 4 BstHHI,CfoI,AspLEI Hin4I 11 Hin4II* 7 HpyAV Hin6I 4 HinP1I,HspAI HindII 2 HincII HindIII 2 HinfI 8 HpaII 5 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 13 Hpy99I 1 KasI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 10 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 11 MboI 16 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 11 MfeI 1 MunI MlyI 4 SchI MmeI 3 MnlI 11 MseI 20 Tru1I,Tru9I MslI 2 RseI,SmiMI MstI* 2 AviII,FspI,NsbI,Acc16I MwoI 7 HpyF10VI,BstMWI NarI 1 Mly113I NdeI 1 FauNDI NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 8 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 2 MspA1I NspI 1 BstNSI,XceI PfoI 1 PleI 4 PpsI PsiI 2 AanI RsaI 7 AfaI SapI 1 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 36 SexAI 2 MabI SfaNI 1 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI SpeI 1 BcuI,AhlI SphI 1 PaeI,BbuI SspI 2 TaiI 5 TaqI 11 TatI 3 TauI 4 TfiI 4 PfeI TseI 5 ApeKI TsoI 4 Tsp45I 6 NmuCI Tsp4CI* 11 HpyCH4III,TaaI,Bst4CI TspDTI 9 TspEI 30 TasI,Tsp509I,Sse9I TspGWI 8 TspRI 5 TscAI VspI 1 PshBI,AseI XhoII 6 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AflIII AlfI AloI AlwNI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BbvII* Bce83I* BceAI BdaI BglI BmeT110I BmtI BplI BsaAI BsaXI BsePI BseRI BseYI BspHI BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstZ17I Cfr9I CfrI DraIII Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoRI EcoT22I Esp3I EspI* FseI GsaI HpaI KpnI MauBI McrI* MluI Mph1103I MroNI NaeI NcoI NgoMIV NheI NotI NruI NsiI OliI PacI PasI PflMI PmaCI PmeI PpiI PpuMI PshAI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI ScaI SfiI SgfI SgrAI SgrDI SmaI SnaBI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TspMI TstI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769