Restriction Map of SIR3/YLR442C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

SIR3/YLR442C on chromosome XII from coordinates 1022251 to 1019315.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 MboI BclI | MnlI | DpnI CviJI Tsp4CI* | |BstKTI \ \ \ \\ ATGGCTAAAACATTGAAAGATTTGGACGGTTGGCAAGTTATCATTACAGATGATCAGGGG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGATTTTGTAACTTTCTAAACCTGCCAACCGTTCAATAGTAATGTCTACTAGTCCCC / / // / CviJI Tsp4CI* || BclI || MboI |DpnI BstKTI MnlI M A K T L K D L D G W Q V I I T D D Q G W L K H * K I W T V G K L S L Q M I R G G * N I E R F G R L A S Y H Y R * S G E ----:----|----:----|----:----|----:----|----:----|----:----| X A L V N F S K S P Q C T I M V S S * P X P * F M S L N P R N A L * * * L H D P H S F C Q F I Q V T P L N D N C I I L P MboI | DpnI | |BstKTI | ||Hpy178III* | ||| MnlI MaeII | ||| |MboII | SetI | ||| || MnlI | TaiI | ||| || |BsaXI | BseRI | ||| || |MboII | | BseRI \ \\\ \\ \\ \ \ \ AGGGTTATTGACGACAACAATAGAAGAAGATCAAGAAAAAGAGGAGGAGAAAACGTATTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCAATAACTGCTGTTGTTATCTTCTTCTAGTTCTTTTTCTCCTCCTCTTTTGCATAAA // ////// / // / || |||||MboII | || BseRI || ||||MnlI | |MaeII || |||BsaXI | BseRI || ||Hpy178III* TaiI || ||MboII SetI || |MnlI || MboI |DpnI BstKTI R V I D D N N R R R S R K R G G E N V F G L L T T T I E E D Q E K E E E K T Y F G Y * R Q Q * K K I K K K R R R K R I S ----:----|----:----|----:----|----:----|----:----|----:----| L T I S S L L L L L D L F L P P S F T N S P * Q R C C Y F F I L F F L L L F R I P N N V V V I S S S * S F S S S F V Y K Hpy188I | ApoI | TspEI | BsaXI HphI | | BccI Hpy188I Hin4II* | MseI \ \ \ \ \ \ \ CTGAAAAGAATTTCTGATGGATTGAGTTTTGGGAAGGGTGAGAGCGTGATATTTAATGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GACTTTTCTTAAAGACTACCTAACTCAAAACCCTTCCCACTCTCGCACTATAAATTACTA / / // / / / / | BsaXI || Hpy188I Hin4II* HphI MseI Hpy188I |TspEI |ApoI BccI L K R I S D G L S F G K G E S V I F N D * K E F L M D * V L G R V R A * Y L M I E K N F * W I E F W E G * E R D I * * * ----:----|----:----|----:----|----:----|----:----|----:----| R F L I E S P N L K P F P S L T I N L S E S F F K Q H I S N Q S P H S R S I * H Q F S N R I S Q T K P L T L A H Y K I I TspGWI |AccI ||BinI* ||Hpy166II ||| MboI ||| | DpnI ||| | |BstKTI ||| | ||FatI ||| | |||CviAII ||| | |||| NlaIII ||| | |||| |MlyI ||| | |||| |PleI ||| | |||| |MboI ||| | |||| || DpnI ||| | |||| || |BstKTI MaeIII ||| | |||| || || Hpy188I Tsp45I ||| | |||| || || |HinfI MseI \ \\\ \ \\\\ \\ \\ \\ \ AATGTGACGGAAACATATTCTGTCTACTTGATCCATGAGATCAGACTCAATACACTTAAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTACACTGCCTTTGTATAAGACAGATGAACTAGGTACTCTAGTCTGAGTTATGTGAATTA / / // // / ///// / / / Tsp45I | || || | ||||| | HinfI MseI MaeIII | || || | ||||| Hpy188I | || || | ||||| MboI | || || | ||||DpnI | || || | |||BstKTI | || || | |||PleI | || || | ||MlyI | || || | |FatI | || || | CviAII | || || NlaIII | || || MboI | || |DpnI | || BstKTI | |BinI* | |AccI | Hpy166II TspGWI N V T E T Y S V Y L I H E I R L N T L N M * R K H I L S T * S M R S D S I H L I C D G N I F C L L D P * D Q T Q Y T * * ----:----|----:----|----:----|----:----|----:----|----:----| L T V S V Y E T * K I W S I L S L V S L Y H S P F M N Q R S S G H S * V * Y V * I H R F C I R D V Q D M L D S E I C K I TatI BccI Tsp4CI* |SmlI Bce83I* |Csp6I \\ \ \\ AATGTTGTGGAGATTTGGGTTTTTTCTTACTTGAGATGGTTTGAACTCAAACCAAAACTG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAACACCTCTAAACCCAAAAAAGAATGAACTCTACCAAACTTGAGTTTGGTTTTGAC / / / / | SmlI Bce83I* Tsp4CI* BccI N V V E I W V F S Y L R W F E L K P K L M L W R F G F F L T * D G L N S N Q N C C C G D L G F F L L E M V * T Q T K T V ----:----|----:----|----:----|----:----|----:----|----:----| L T T S I Q T K E * K L H N S S L G F S Y H Q P S K P K K K S S I T Q V * V L V I N H L N P N K R V Q S P K F E F W F Q CviJI HaeIII | MboI | BglII | XhoII MboI | | DpnI | DpnI MboII | | |BstKTI | |BseGI | ApoI RsaI TspEI | | || FokI | |BstKTI | TspEI \ \ \ \ \\ \ \ \\ \ \ TACTACGAACAATTCAGGCCAGATCTAATAAAGGAAGATCATCCTTTAGAATTTTACAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ATGATGCTTGTTAAGTCCGGTCTAGATTATTTCCTTCTAGTAGGAAATCTTAAAATGTTT /// / / // / / // / / / ||TatI | | || | FokI || MboI MboII TspEI |Csp6I | | || XhoII |DpnI ApoI RsaI | | || BglII BstKTI | | || MboI BseGI | | |DpnI | | BstKTI | HaeIII | CviJI TspEI Y Y E Q F R P D L I K E D H P L E F Y K T T N N S G Q I * * R K I I L * N F T K L R T I Q A R S N K G R S S F R I L Q R ----:----|----:----|----:----|----:----|----:----|----:----| Y * S C N L G S R I F S S * G K S N * L T S R V I * A L D L L P L D D K L I K C V V F L E P W I * Y L F I M R * F K V F DdeI EspI* | AluI BseMII | CviJI ApoI |BspCNI | | SetI TspEI EcoP15I ||MseI | | | Hpy188I \ \ \\\ \ \ \ \ GATAAATTTTTCAACGAAGTAAATAAGAGCGAGTTATATTTAACTGCTGAGCTATCAGAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTTAAAAAGTTGCTTCATTTATTCTCGCTCAATATAAATTGACGACTCGATAGTCTC / / // / /// / TspEI EcoP15I || MseI ||| Hpy188I ApoI |BspCNI ||CviJI BseMII ||AluI |EspI* |DdeI SetI D K F F N E V N K S E L Y L T A E L S E I N F S T K * I R A S Y I * L L S Y Q R * I F Q R S K * E R V I F N C * A I R D ----:----|----:----|----:----|----:----|----:----|----:----| S L N K L S T F L L S N Y K V A S S D S L Y I K * R L L Y S R T I N L Q Q A I L I F K E V F Y I L A L * I * S S L * * L MmeI HinfI CviJI |MaeIII TspDTI |Tsp45I |SmlI || XcmI |AflII BsrDI || | PleI ||MseI | CviRI* AlwNI || | |MlyI \\\ \ \ \ \\ \ \\ ATTTGGCTTAAGGATTTCATTGCAGTTGGACAGATACTGCCAGAGTCACAATGGAATGAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAAACCGAATTCCTAAAGTAACGTCAACCTGTCTATGACGGTCTCAGTGTTACCTTACTA / / // / / / / / / | | || BsrDI CviRI* AlwNI | | PleI | | |AflII | | MlyI | | |SmlI | Tsp45I | | MseI | MaeIII | CviJI HinfI TspDTI XcmI MmeI I W L K D F I A V G Q I L P E S Q W N D F G L R I S L Q L D R Y C Q S H N G M I L A * G F H C S W T D T A R V T M E * * ----:----|----:----|----:----|----:----|----:----|----:----| I Q S L S K M A T P C I S G S D C H F S S K A * P N * Q L Q V S V A L T V I S H N P K L I E N C N S L Y Q W L * L P I I MaeI | Csp6I | |RsaI | ||MaeII | |||BcgI | |||| SetI | |||| TaiI | |||| | FatI | |||| | CviRI* | |||| | |CviAII | |||| | ||Cac8I | |||| | ||EcoT22I TaqI | |||| | ||| SphI ClaI | |||| | ||| NspI | MnlI | |||| | ||| NlaIII SetI \ \ \ \\\\ \ \\\ \ \ AGTAGTATCGATAAAATAGAGGATAGAGATTTTCTAGTACGTTATGCATGCGAACCTACT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCATCATAGCTATTTTATCTCCTATCTCTAAAAGATCATGCAATACGTACGCTTGGATGA // / // / / / /// / |MnlI | || | | | ||| SetI ClaI | || | | | ||FatI TaqI | || | | | |CviAII | || | | | Cac8I | || | | CviRI* | || | | NlaIII | || | | NspI | || | | SphI | || | EcoT22I | || MaeII | |Csp6I | RsaI | TaiI | SetI | BcgI MaeI S S I D K I E D R D F L V R Y A C E P T V V S I K * R I E I F * Y V M H A N L L * Y R * N R G * R F S S T L C M R T Y C ----:----|----:----|----:----|----:----|----:----|----:----| L L I S L I S S L S K R T R * A H S G V Y Y Y R Y F L P Y L N E L V N H M R V * T T D I F Y L I S I K * Y T I C A F R S BdaI BdaI | Csp6I | |RsaI | |BcgI Ksp632I* | || MfeI | BdaI AciI | || TspEI | BdaI MboII NlaIV \ \ \\ \ \ \ \ \ GCGGAAAAGTTTGTACCAATTGATATTTTTCAAATCATAAGAAGAGTAAAGGAAATGGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGCCTTTTCAAACATGGTTAACTATAAAAAGTTTAGTATTCTTCTCATTTCCTTTACCTT / / / // / / / / / AciI | | |Csp6I TspEI | BdaI MboII NlaIV | | RsaI MfeI | BdaI | BcgI Ksp632I* BdaI BdaI A E K F V P I D I F Q I I R R V K E M E R K S L Y Q L I F F K S * E E * R K W N G K V C T N * Y F S N H K K S K G N G T ----:----|----:----|----:----|----:----|----:----|----:----| A S F N T G I S I K * I M L L T F S I S Q P F T Q V L Q Y K E F * L F L L P F P R F L K Y W N I N K L D Y S S Y L F H F Csp6I PflMI |RsaI BsiYI* Hpy188I TspDTI || BsrI |TspRI \ \ \\ \ \\ CCCAAACAATCTGATGAATACTTGAAAAGAGTATCTGTACCAGTGAGTGGGCAGAAGACA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTTTGTTAGACTACTTATGAACTTTTCTCATAGACATGGTCACTCACCCGTCTTCTGT / / // / Hpy188I TspDTI || BsiYI* || PflMI |Csp6I TspRI RsaI BsrI P K Q S D E Y L K R V S V P V S G Q K T P N N L M N T * K E Y L Y Q * V G R R Q Q T I * * I L E K S I C T S E W A E D K ----:----|----:----|----:----|----:----|----:----|----:----| G L C D S S Y K F L T D T G T L P C F V V W V I Q H I S S F L I Q V L S H A S S G F L R I F V Q F S Y R Y W H T P L L C BbvII* |SfaNI || MboII MboII || | SetI | MboI || | | BccI | BglII || | | CviRI* | XhoII || | | | EcoT22I | | DpnI || | | | | HphI | | |BstKTI MaeI \\ \ \ \ \ \ \ \ \\ \ AATAGACAGGTGATGCATAAGATGGGAGTTGAAAGATCTTCAAAAAGACTAGCAAAGAAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCTGTCCACTACGTATTCTACCCTCAACTTTCTAGAAGTTTTTCTGATCGTTTCTTT /// / // / / // / / / ||SetI | || HphI MboII || XhoII MaeI SetI |SfaNI | |BccI || BglII BbvII* | CviRI* || MboI MboII EcoT22I |DpnI BstKTI N R Q V M H K M G V E R S S K R L A K K I D R * C I R W E L K D L Q K D * Q R N * T G D A * D G S * K I F K K T S K E T ----:----|----:----|----:----|----:----|----:----|----:----| F L C T I C L I P T S L D E F L S A F F L Y V P S A Y S P L Q F I K L F V L L S I S L H H M L H S N F S R * F S * C L F TspDTI |TaqI || CviJI || | SduI || | HgiJII* Hin4II* || | | SfeI* MaeII | BcgI || | | | CviRI* | SetI | |TspEI || | | | | PstI | TaiI SetI | || MseI || | | | | | MnlI | BcgI \ \ \\ \ \\ \ \ \ \ \ \ \ \ CCTTCAATGAAAAAAATTAAAATCGAGCCCTCTGCAGATGATGACGTAAATAATGGAAAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAGTTACTTTTTTTAATTTTAGCTCGGGAGACGTCTACTACTGCATTTATTACCTTTA // /// / / / / / / / // |BcgI ||| | | | | | MnlI | |MaeII Hin4II* ||| | | | | SfeI* | BcgI ||| | | | CviRI* TaiI ||| | | PstI SetI ||| | CviJI ||| HgiJII* ||| TaqI ||| SduI ||TspDTI |MseI TspEI P S M K K I K I E P S A D D D V N N G N L Q * K K L K S S P L Q M M T * I M E I F N E K N * N R A L C R * * R K * W K Y ----:----|----:----|----:----|----:----|----:----|----:----| G E I F F I L I S G E A S S S T F L P F V K L S F F * F R A R Q L H H R L Y H F R * H F F N F D L G R C I I V Y I I S I MaeII | BspCNI | |SetI | |TaiI | |BseMII | ||HindII Tsp4CI* | ||Hpy166II | MnlI | ||| FatI | |DdeI | ||| |CviAII | || BsmAI | ||| || NlaIII Ksp632I* | || Esp3I | ||| || | TspEI | HinfI \ \\ \ \ \\\ \\ \ \ \ \ ATACCGTCTCAGCGAGGAACGTCAACAACTCATGGTTCAATTTCTCCCCAAGAAGAGTCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TATGGCAGAGTCGCTCCTTGCAGTTGTTGAGTACCAAGTTAAAGAGGGGTTCTTCTCAGA / / / / //// / / // / / / | MnlI | | |||| | | |FatI TspEI | HinfI | | | |||| | | CviAII Ksp632I* | | | |||| | NlaIII | | | |||| Hpy166II | | | |||| HindII | | | |||MaeII | | | ||BseMII | | | |BspCNI | | | TaiI | | | SetI | | Esp3I | | BsmAI | DdeI Tsp4CI* I P S Q R G T S T T H G S I S P Q E E S Y R L S E E R Q Q L M V Q F L P K K S L T V S A R N V N N S W F N F S P R R V C ----:----|----:----|----:----|----:----|----:----|----:----| I G D * R P V D V V * P E I E G W S S D Y V T E A L F T L L E H N L K E G L L T Y R R L S S R * C S M T * N R G L F L R PleI Hin6I MboII |MlyI |HphI SfeI* |MboII |GlaI |SetI || BslFI ||HhaI || TfiI TaqI || | HgaI AcyI ||| Hin4II* || HinfI AsuII \\ \ \ \ \\\ \ \\ \ \ GTTTCCCCTAACATCTCATCGGCGTCCCCTTCTGCGCTCACATCACCTACAGATTCTTCG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGGGGATTGTAGAGTAGCCGCAGGGGAAGACGCGAGTGTAGTGGATGTCTAAGAAGC // / / / //// / / / / / |PleI | HgaI AcyI |||| | | | | AsuII |MlyI BslFI |||| | | | | TaqI MboII |||| | | | HinfI |||| | | | TfiI |||| | | SfeI* |||| | MboII |||| SetI |||Hin4II* ||Hin6I |GlaI HhaI HphI V S P N I S S A S P S A L T S P T D S S F P L T S H R R P L L R S H H L Q I L R F P * H L I G V P F C A H I T Y R F F E ----:----|----:----|----:----|----:----|----:----|----:----| T E G L M E D A D G E A S V D G V S E E Q K G * C R M P T G K Q A * M V * L N K N G R V D * R R G R R R E C * R C I R R MboI BglII Hpy188I XhoII | AjuI | DpnI | | Eco57I ApoI | |BstKTI TspEI | | Eco57MI TspEI | || BsaBI | MnlI | | | MboII \ \ \\ \ \ \ \ \ \ \ AAAATTTTACAAAAAAGATCTATATCAAAGGAACTAATTGTTTCAGAGGAAATACCAATA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAAAATGTTTTTTCTAGATATAGTTTCCTTGATTAACAAAGTCTCCTTTATGGTTAT / // // // // / / TspEI || |BsaBI || || | MboII ApoI || XhoII || || Eco57MI || BglII || || Eco57I || MboI || |Hpy188I |DpnI || AjuI BstKTI |TspEI MnlI K I L Q K R S I S K E L I V S E E I P I K F Y K K D L Y Q R N * L F Q R K Y Q * N F T K K I Y I K G T N C F R G N T N K ----:----|----:----|----:----|----:----|----:----|----:----| F I K C F L D I D F S S I T E S S I G I S F K V F F I * I L P V L Q K L P F V L F N * L F S R Y * L F * N N * L F Y W Y Hpy188I Ksp632I* | TfiI | HinfI | | AjuI | | |Hpy188I CviJI TspDTI \ \ \\ \ \ AACTCTTCAGAACAGGAATCCGATTATGAGCCAAACAATGAAACATCTGTGCTTTCAAGT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAGAAGTCTTGTCCTTAGGCTAATACTCGGTTTGTTACTTTGTAGACACGAAAGTTCA / / / // / / | | | |Hpy188I CviJI TspDTI | | | HinfI | | | TfiI | | AjuI | Ksp632I* Hpy188I N S S E Q E S D Y E P N N E T S V L S S T L Q N R N P I M S Q T M K H L C F Q V L F R T G I R L * A K Q * N I C A F K * ----:----|----:----|----:----|----:----|----:----|----:----| F E E S C S D S * S G F L S V D T S E L L S K L V P I R N H A L C H F M Q A K L V R * F L F G I I L W V I F C R H K * T Hpy166II | BssKI Hin4I | EcoRII HindII | |SecI* Hpy166II | ||ScrFI | CfrI | ||BseBI | XmaIII* | |||SetI BbvII* | | CviJI | |||| Hin4I |SfeI* | | HaeIII ApoI | |||| | CviJI || MboII | | |McrI* TspEI BceAI \ \\\\ \ \ \\ \ \ \ \\ \ \ AAACCTGGGTCAAAGCCAGAGAAGACATCTACAGAACTCGTTGACGGCCGAGAGAATTTT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGACCCAGTTTCGGTCTCTTCTGTAGATGTCTTGAGCAACTGCCGGCTCTCTTAAAA // // / / // / / // / / || || EcoRII CviJI || | | || XmaIII* TspEI || || BssKI || | | || CfrI ApoI || || SecI* || | | |HaeIII || |BseBI || | | |CviJI || |ScrFI || | | McrI* || Hin4I || | Hpy166II |SetI || | HindII Hpy166II || Hin4I |SfeI* BbvII* MboII K P G S K P E K T S T E L V D G R E N F N L G Q S Q R R H L Q N S L T A E R I L T W V K A R E D I Y R T R * R P R E F C ----:----|----:----|----:----|----:----|----:----|----:----| L G P D F G S F V D V S S T S P R S F K Y V Q T L A L S S M * L V R Q R G L S N F R P * L W L L C R C F E N V A S L I K CviRI* | NmeAIII Ksp632I* | | Hpy178III* |MnlI | | | BccI |CviJI MboII \ \ \ \ \\ \ GTATATGCAAATAATCCAGAAGTGAGTGATGATGGTGGGCTTGAAGAGGAAACAGATGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CATATACGTTTATTAGGTCTTCACTCACTACTACCACCCGAACTTCTCCTTTGTCTACTT / / / / / // / / | | | | BccI || Ksp632I* MboII | | | Hpy178III* |CviJI | | NmeAIII MnlI | CviRI* BceAI V Y A N N P E V S D D G G L E E E T D E Y M Q I I Q K * V M M V G L K R K Q M K I C K * S R S E * * W W A * R G N R * S ----:----|----:----|----:----|----:----|----:----|----:----| T Y A F L G S T L S S P P S S S S V S S Q I H L Y D L L S H H H H A Q L P F L H Y I C I I W F H T I I T P K F L F C I F BarI | MaeII | |BtrI | || SetI | || TaiI Hpy188I | || | Hin6I | TspDTI | || | |GlaI | | BarI BsrI | || | ||HhaI | | | Hpy188I |TspDTI | || | |||HaeII \ \ \ \ \\ \ \\ \ \\\\ GTTAGTTCAGAAAGTTCTGATGAAGCAATAATACCAGTAAATAAAAGACGTGGCGCTCAC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CAATCAAGTCTTTCAAGACTACTTCGTTATTATGGTCATTTATTTTCTGCACCGCGAGTG // / // / / // //// |TspDTI Hpy188I |TspDTI BarI | || |||Hin6I |BarI BsrI | || ||GlaI Hpy188I | || |HhaI | || HaeII | |MaeII | BtrI TaiI SetI V S S E S S D E A I I P V N K R R G A H L V Q K V L M K Q * Y Q * I K D V A L T * F R K F * * S N N T S K * K T W R S R ----:----|----:----|----:----|----:----|----:----|----:----| T L E S L E S S A I I G T F L L R P A * L * N L F N Q H L L L V L L Y F V H R E N T * F T R I F C Y Y W Y I F S T A S V TspEI | MwoI | | TspGWI ApoI | | | TspEI Hpy178III* TspEI \ \ \ \ \ \ GGAAGCGAATTGAGCAGTAAAATTAGAAAAATCCACATTCAAGAAACACAAGAATTTTCT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTCGCTTAACTCGTCATTTTAATCTTTTTAGGTGTAAGTTCTTTGTGTTCTTAAAAGA / // / / / | |TspGWI TspEI Hpy178III* TspEI | TspEI ApoI MwoI G S E L S S K I R K I H I Q E T Q E F S E A N * A V K L E K S T F K K H K N F L K R I E Q * N * K N P H S R N T R I F * ----:----|----:----|----:----|----:----|----:----|----:----| P L S N L L L I L F I W M * S V C S N E R F R I S C Y F * F F G C E L F V L I K S A F Q A T F N S F D V N L F C L F K R TspDTI | BssKI | EcoRII | | ScrFI | | BseBI | | TspGWI | | |SetI | | || ApoI | | || TspEI | | || EcoRI | | || | BssKI | | || | SecI* | | || | EcoRII | | || | |PasI | | || | |SecI* | | || | ||ScrFI TspEI SfeI* | | || | ||BseBI \ \ \ \ \\ \ \\\ AAAAATTACACTACAGAAACAGATAACGAAATGAACGGAAATGGAAAACCTGGAATTCCC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTAATGTGATGTCTTTGTCTATTGCTTTACTTGCCTTTACCTTTTGGACCTTAAGGG / / / // / / / TspEI SfeI* | || | | EcoRI | || | | TspEI | || | | ApoI | || | EcoRII | || | BssKI | || BseBI | || ScrFI | |TspGWI | SetI TspDTI K N Y T T E T D N E M N G N G K P G I P K I T L Q K Q I T K * T E M E N L E F P K L H Y R N R * R N E R K W K T W N S Q ----:----|----:----|----:----|----:----|----:----|----:----| L F * V V S V S L S I F P F P F G P I G * F N C * L F L Y R F S R F H F V Q F E F I V S C F C I V F H V S I S F R S N G BsiYI* ApoI | SetI TspDTI TspEI TspDTI | | CviRI* \ \ \ \ \ \ AGGGGCAACACCAAAATTCATAGTATGAACGAAAATCCTACACCAGAAAAAGGTAATGCA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCCGTTGTGGTTTTAAGTATCATACTTGCTTTTAGGATGTGGTCTTTTTCCATTACGT /// / / / / / / ||| TspDTI TspEI TspDTI | SetI CviRI* ||EcoRII ApoI BsiYI* ||BssKI ||SecI* |SecI* |PasI BseBI ScrFI R G N T K I H S M N E N P T P E K G N A G A T P K F I V * T K I L H Q K K V M Q G Q H Q N S * Y E R K S Y T R K R * C K ----:----|----:----|----:----|----:----|----:----|----:----| L P L V L I * L I F S F G V G S F P L A W P C C W F E Y Y S R F D * V L F L Y H P A V G F N M T H V F I R C W F F T I C AgeI BetI* Hpy188I Cfr10I | TspEI |HpaII \ \ \\ AAGATGATTGATTTCGCTACTTTGTCAAAGTTGAAAAAAAAATATCAGATAATTTTAGAC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTACTAACTAAAGCGATGAAACAGTTTCAACTTTTTTTTTATAGTCTATTAAAATCTG / / Hpy188I TspEI K M I D F A T L S K L K K K Y Q I I L D R * L I S L L C Q S * K K N I R * F * T D D * F R Y F V K V E K K I S D N F R P ----:----|----:----|----:----|----:----|----:----|----:----| F I I S K A V K D F N F F F Y * I I K S L S S Q N R * K T L T S F F I D S L K L L H N I E S S Q * L Q F F F I L Y N * V MfeI TspEI | MnlI | | Hin4I | | Hin4I TfiI | | TspEI CviRI* MaeIII HinfI | | | MseI Eam1105I \ \ \ \ \ \ \ \ CGGTTTGCACCAGATAATCAAGTAACAGATTCCTCCCAATTGAACAAATTAACAGACGAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GCCAAACGTGGTCTATTAGTTCATTGTCTAAGGAGGGTTAACTTGTTTAATTGTCTGCTT // / / / / // / || CviRI* | HinfI TspEI |MseI Eam1105I |Cfr10I | TfiI Hin4I TspEI |BetI* MaeIII Hin4I |AgeI MnlI HpaII MfeI R F A P D N Q V T D S S Q L N K L T D E G L H Q I I K * Q I P P N * T N * Q T N V C T R * S S N R F L P I E Q I N R R T ----:----|----:----|----:----|----:----|----:----|----:----| R N A G S L * T V S E E W N F L N V S S G T Q V L Y D L L L N R G I S C I L L R P K C W I I L Y C I G G L Q V F * C V F Tsp4CI* | HindIII | | AluI | | CviJI | | | SetI | | | | MaeII | | | | | SetI | | | | | TaiI | | | | | |Hin4I MboII | | | | | |Hin4I TspDTI | | | | | ||CviRI* | FatI | | | | | ||| MnlI | Bce83I* | | | | | ||| Cac8I | |CviAII | | | | | ||| | StuI | ||Cac8I | | | | | ||| | CviJI | ||| SphI SapI | | | | | ||| | HaeIII | ||| NspI Ksp632I* | | | | | ||| | | SmlI | ||| NlaIII | Hpy178III* \ \ \ \ \ \\\ \ \ \ \ \\\ \ \ \ CAGTCAAGCTTGGACGTTGCAGGCCTTGAGGATAAGTTTAGAAAAGCATGCTCTTCATCT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAGTTCGAACCTGCAACGTCCGGAACTCCTATTCAAATCTTTTCGTACGAGAAGTAGA / / / / / / /// / / /// / /// / | | | | | | ||| | SmlI ||| | ||FatI Ksp632I* | | | | | | ||| HaeIII ||| | |CviAII SapI | | | | | | ||| CviJI ||| | Cac8I | | | | | | ||| StuI ||| NlaIII | | | | | | ||Cac8I ||| NspI | | | | | | |MnlI ||| SphI | | | | | | CviRI* ||Bce83I* | | | | | MaeII |MboII | | | | Hin4I TspDTI | | | | Hin4I | | | | TaiI | | | | SetI | | | HindIII | | CviJI | | AluI | SetI Tsp4CI* Q S S L D V A G L E D K F R K A C S S S S Q A W T L Q A L R I S L E K H A L H L V K L G R C R P * G * V * K S M L F I W ----:----|----:----|----:----|----:----|----:----|----:----| C D L K S T A P R S S L N L F A H E E D V T L S P R Q L G Q P Y T * F L M S K M L * A Q V N C A K L I L K S F C A R * R ApoI MnlI TfiI XmnI TspEI ApoI HinfI | MboII | MseI TspEI | TspEI \ \ \ \ \ \ \ GGAAGAGAAACCATTCTGTCAAATTTTAACGCTGATATAAATTTAGAGGAATCAATTAGA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTCTCTTTGGTAAGACAGTTTAAAATTGCGACTATATTTAAATCTCCTTAGTTAATCT / / / / / / / / / | | MboII | MseI MnlI TspEI | TspEI | XmnI TspEI ApoI HinfI Hpy178III* ApoI TfiI G R E T I L S N F N A D I N L E E S I R E E K P F C Q I L T L I * I * R N Q L E K R N H S V K F * R * Y K F R G I N * R ----:----|----:----|----:----|----:----|----:----|----:----| P L S V M R D F K L A S I F K S S D I L Q F L F W E T L N * R Q Y L N L P I L * S S F G N Q * I K V S I Y I * L F * N S TfiI HinfI MnlI SspI \ \ \ GAATCTTTACAAAAGAGAGAACTACTAAAATCACAAGTGGAGGATTTTACAAGAATATTC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGAAATGTTTTCTCTCTTGATGATTTTAGTGTTCACCTCCTAAAATGTTCTTATAAG / / / HinfI MnlI SspI TfiI E S L Q K R E L L K S Q V E D F T R I F N L Y K R E N Y * N H K W R I L Q E Y S I F T K E R T T K I T S G G F Y K N I P ----:----|----:----|----:----|----:----|----:----|----:----| S D K C F L S S S F D C T S S K V L I N L I K V F S L V V L I V L P P N * L F I F R * L L S F * * F * L H L I K C S Y E Hpy188I | Hin4II* | | Tsp4CI* | | |MboII | | |BbvII* CviRI* \ \ \\ \ CTTCCGATTTACGACAGTTTGATGTCTTCCCAAAATAAACTATTTTATATTACCAATGCA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGGCTAAATGCTGTCAAACTACAGAAGGGTTTTATTTGATAAAATATAATGGTTACGT / / // / / | | || BbvII* CviRI* | | |MboII | | Tsp4CI* | Hin4II* Hpy188I L P I Y D S L M S S Q N K L F Y I T N A F R F T T V * C L P K I N Y F I L P M Q S D L R Q F D V F P K * T I L Y Y Q C R ----:----|----:----|----:----|----:----|----:----|----:----| R G I * S L K I D E W F L S N * I V L A G E S K R C N S T K G F Y V I K Y * W H K R N V V T Q H R G L I F * K I N G I C HphI | BseGI | | MboI | | BclI | | MboII | | | DpnI AluI | | | |BstKTI TfiI ApoI CviJI | | | || FokI AsuI* HinfI TspEI | SetI | | | || | SetI Ksp632I* \ \ \ \ \ \ \ \\ \ \ \ GATGATTCTACTAAATTCCAGCTTGTGAATGATGTAATGGATGAGTTGATCACCTCTTCG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTAAGATGATTTAAGGTCGAACACTTACTACATTACCTACTCAACTAGTGGAGAAGC / / / / / / / // / / HinfI | | CviJI | | | || BclI FokI TfiI | | AluI | | | || MboI | SetI | | | || SetI TspEI | | | |DpnI ApoI | | | BstKTI | | MboII | BseGI HphI D D S T K F Q L V N D V M D E L I T S S M I L L N S S L * M M * W M S * S P L R * F Y * I P A C E * C N G * V D H L F G ----:----|----:----|----:----|----:----|----:----|----:----| S S E V L N W S T F S T I S S N I V E E L H N * * I G A Q S H H L P H T S * R K I I R S F E L K H I I Y H I L Q D G R R CviJI HaeIII SetI BmgT120I | TspDTI StyI SfaNI | MnlI | |TaqI SfaNI MslI SecI* | BsrI \ \ \ \\ \ \ \ \ \ GCCCGAAAGGAACTACCTATTTTCGATTACATTCATATTGATGCCTTGGAACTGGCAGGA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CGGGCTTTCCTTGATGGATAAAAGCTAATGTAAGTATAACTACGGAACCTTGACCGTCCT /// / / / / / / / / ||Ksp632I* SetI | TaqI | MslI SecI* | SfaNI ||AsuI* TspDTI SfaNI StyI BsrI |BmgT120I |MnlI HaeIII CviJI A R K E L P I F D Y I H I D A L E L A G P E R N Y L F S I T F I L M P W N W Q E P K G T T Y F R L H S Y * C L G T G R N ----:----|----:----|----:----|----:----|----:----|----:----| A R F S S G I K S * M * I S A K S S A P P G F P V V * K R N C E Y Q H R P V P L G S L F * R N E I V N M N I G Q F Q C S CviRI* | BseGI | EcoT22I | | FokI AciI \ \ \ \ ATGGATGCATTATATGAGAAAATATGGTTCGCCATTTCTAAAGAAAATCTATGCGGTGAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTACGTAATATACTCTTTTATACCAAGCGGTAAAGATTTCTTTTAGATACGCCACTA / / / / | CviRI* FokI AciI | BseGI EcoT22I M D A L Y E K I W F A I S K E N L C G D W M H Y M R K Y G S P F L K K I Y A V I G C I I * E N M V R H F * R K S M R * Y ----:----|----:----|----:----|----:----|----:----|----:----| I S A N Y S F I H N A M E L S F R H P S F P H M I H S F I T R W K * L F D I R H H I C * I L F Y P E G N R F F I * A T I StuI MnlI CviJI | MaeI HaeIII | HphI | MseI BslFI Hpy178III* \ \ \ \ \ \ ATATCACTAGAGGCCTTAAACTTCTATATTACAAATGTCCCGAAAGCAAAAAAGAGAAAG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TATAGTGATCTCCGGAATTTGAAGATATAATGTTTACAGGGCTTTCGTTTTTTCTCTTTC / / / / / / / | | | | MseI BslFI Hpy178III* | | | HaeIII | | | CviJI | | | StuI | | MaeI | HphI MnlI I S L E A L N F Y I T N V P K A K K R K Y H * R P * T S I L Q M S R K Q K R E R I T R G L K L L Y Y K C P E S K K E K D ----:----|----:----|----:----|----:----|----:----|----:----| I D S S A K F K * I V F T G F A F F L F Y I V L P R L S R Y * L H G S L L F S F Y * * L G * V E I N C I D R F C F L S L BetI* MboII SspI BspMII* |SspI | MseI |HpaII || TaqI | VspI |Hpy178III* || |Hpy178III* \ \ \\ \\ \\ ACACTAATATTAATACAAAATCCGGAAAATCTATTGAGTGAGAAGATTTTACAATATTTC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGATTATAATTATGTTTTAGGCCTTTTAGATAACTCACTCTTCTAAAATGTTATAAAG / / // / / | VspI |BspMII* | SspI | MseI |BetI* MboII SspI Hpy178III* HpaII T L I L I Q N P E N L L S E K I L Q Y F H * Y * Y K I R K I Y * V R R F Y N I S T N I N T K S G K S I E * E D F T I F R ----:----|----:----|----:----|----:----|----:----|----:----| V S I N I C F G S F R N L S F I K C Y K S V L I L V F D P F D I S H S S K V I N C * Y * Y L I R F I * Q T L L N * L I E TaqI AsuII | ApoI MaeIII MboII | TspEI TspEI TstI AciI Tsp45I \ \ \ \ \ \ \ GAGAAATGGATTTCTTCGAAAAATTCAAAATTGTCTATCATTTGCGTTGGCGGACATAAT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTTACCTAAAGAAGCTTTTTAAGTTTTAACAGATAGTAAACGCAACCGCCTGTATTA // / / / / / / || MboII AsuII TspEI TspEI TstI AciI |Hpy178III* TaqI ApoI TaqI E K W I S S K N S K L S I I C V G G H N R N G F L R K I Q N C L S F A L A D I M E M D F F E K F K I V Y H L R W R T * C ----:----|----:----|----:----|----:----|----:----|----:----| S F H I E E F F E F N D I M Q T P P C L R S I S K K S F N L I T * * K R Q R V Y L F P N R R F I * F Q R D N A N A S M I MnlI EciI TstI | MnlI \ \ \ \ GTGACGATTAGAGAGCAAATAAATATAATGCCCTCCCTCAAAGCACACTTTACCGAAATC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CACTGCTAATCTCTCGTTTATTTATATTACGGGAGGGAGTTTCGTGTGAAATGGCTTTAG / / / / / | | TstI | MnlI | Tsp45I MnlI | MaeIII EciI V T I R E Q I N I M P S L K A H F T E I * R L E S K * I * C P P S K H T L P K S D D * R A N K Y N A L P Q S T L Y R N Q ----:----|----:----|----:----|----:----|----:----|----:----| T V I L S C I F I I G E R L A C K V S I H S S * L A F L Y L A R G * L V S * R F H R N S L L Y I Y H G G E F C V K G F D MboI BclI TspDTI | DpnI | |BstKTI | || MlyI | || PleI SetI TspEI | || | FnuDII* MseI |Hpy166II | CviRI* | || | | HinfI \ \\ \ \ \ \\ \ \ \ AAACTTAATAAGGTGGACAAGAATGAATTGCAACAAATGATCATCACGCGACTCAAATCT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGAATTATTCCACCTGTTCTTACTTAACGTTGTTTACTAGTAGTGCGCTGAGTTTAGA / / / // / // / // / / | SetI Hpy166II || | || | || | HinfI MseI || | || | || FnuDII* || | || | |PleI || | || | MlyI || | || BclI || | || MboI || | |DpnI || | BstKTI || TspDTI |CviRI* TspEI K L N K V D K N E L Q Q M I I T R L K S N L I R W T R M N C N K * S S R D S N L T * * G G Q E * I A T N D H H A T Q I F ----:----|----:----|----:----|----:----|----:----|----:----| L S L L T S L F S N C C I I M V R S L D * V * Y P P C S H I A V F S * * A V * I F K I L H V L I F Q L L H D D R S E F R SetI | FatI | |CviAII TspDTI | || NlaIII Hin4II* SspI \ \ \\ \ \ \ TTATTGAAACCTTTTCATGTCAAAGTAAATGATAAGAAGGAAATGACTATTTACAATAAT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AATAACTTTGGAAAAGTACAGTTTCATTTACTATTCTTCCTTTACTGATAAATGTTATTA / / / // / / | SetI | |FatI Hin4II* Hin4II* TspDTI | CviAII SspI NlaIII L L K P F H V K V N D K K E M T I Y N N Y * N L F M S K * M I R R K * L F T I I I E T F S C Q S K * * E G N D Y L Q * Y ----:----|----:----|----:----|----:----|----:----|----:----| K N F G K * T L T F S L F S I V I * L L K I S V K E H * L L H Y S P F S * K C Y * Q F R K M D F Y I I L L F H S N V I I Hin4II* | Hpy178III* MboI | |NruI BdaI | DpnI | |FnuDII* BdaI BsaBI | |BstKTI \ \\ \ \ \ \\ ATTCGCGAAGGACAGAACCAGAAAATACCAGATAATGTGATAGTAATCAATCATAAGATC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGCGCTTCCTGTCTTGGTCTTTTATGGTCTATTACACTATCATTAGTTAGTATTCTAG // / / //// |Hpy178III* BdaI BsaBI |||MboI FnuDII* BdaI ||BdaI NruI ||BdaI |DpnI BstKTI I R E G Q N Q K I P D N V I V I N H K I F A K D R T R K Y Q I M * * * S I I R S S R R T E P E N T R * C D S N Q S * D Q ----:----|----:----|----:----|----:----|----:----|----:----| I R S P C F W F I G S L T I T I L * L I Y E R L V S G S F V L Y H S L L * D Y S N A F S L V L F Y W I I H Y Y D I M L D CviRI* | CspCI | | MaeII | | | SetI | | | TaiI TsoI | | | | CviJI |TatI | | | | | MaeII ||Csp6I BdaI | | | | | | SetI |||RsaI BdaI | | | | | | TaiI |||ScaI \ \ \ \ \ \ \ \ \\\\ AACAACAAAATCACTCAACTTATTGCAAAGAACGTAGCCAACGTAAGTGGTAGTACTGAA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTGTTTTAGTGAGTTGAATAACGTTTCTTGCATCGGTTGCATTCACCATCATGACTT / / / / / / / /// / | | | | | MaeII TsoI ||| CspCI | | | | TaiI ||TatI | | | | SetI |Csp6I | | | CviJI ScaI | | MaeII RsaI | TaiI | SetI CviRI* CspCI N N K I T Q L I A K N V A N V S G S T E T T K S L N L L Q R T * P T * V V V L K Q Q N H S T Y C K E R S Q R K W * Y * K ----:----|----:----|----:----|----:----|----:----|----:----| L L L I V * S I A F F T A L T L P L V S * C C F * E V * Q L S R L W R L H Y Y Q V V F D S L K N C L V Y G V Y T T T S F TseI AluI CviJI |BisI SplI* CspCI BbvI ||BlsI ApoI |Csp6I | BsmI |BceAI ||SetI TspEI ||RsaI \ \ \\ \\\ \ \\\ AAAGCATTCAAAATATGTGAAGCTGCCGTAGAAATTTCTAAAAAAGACTTCGTACGGAAA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCGTAAGTTTTATACACTTCGACGGCATCTTTAAAGATTTTTTCTGAAGCATGCCTTT / // / //// / /// / BsmI |BbvI | |||TseI TspEI ||| SetI BceAI | ||BisI ApoI ||SplI* | |BlsI |Csp6I | CviJI RsaI | AluI SetI K A F K I C E A A V E I S K K D F V R K K H S K Y V K L P * K F L K K T S Y G K S I Q N M * S C R R N F * K R L R T E R ----:----|----:----|----:----|----:----|----:----|----:----| F A N L I H S A A T S I E L F S K T R F F L M * F I H L Q R L F K * F L S R V S F C E F Y T F S G Y F N R F F V E Y P F Acc65I HgiCI* SetI |Csp6I | AccI MaeIII ||RsaI | |Hpy166II Tsp45I ||NlaIV DdeI | || TspGWI TspEI | BccI ||| KpnI | Hpy188I \ \\ \ \ \ \ \\\ \ \ \ GGTGGTCTACAAAAGGGTAAATTGGTAGTGTCACAGGAGATGGTACCACGCTATTTCTCA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCAGATGTTTTCCCATTTAACCATCACAGTGTCCTCTACCATGGTGCGATAAAGAGT // / / / /// // |AccI TspEI Tsp45I | ||HgiCI* |DdeI Hpy166II MaeIII | ||Acc65I Hpy188I TspGWI BccI | |Csp6I | NlaIV | RsaI KpnI G G L Q K G K L V V S Q E M V P R Y F S V V Y K R V N W * C H R R W Y H A I S Q W S T K G * I G S V T G D G T T L F L R ----:----|----:----|----:----|----:----|----:----|----:----| P P R C F P L N T T D C S I T G R * K E L H D V F P Y I P L T V P S P V V S N R T T * L L T F Q Y H * L L H Y W A I E * AluI CviJI | SetI | | MseI | | | BspCNI | | | |BseMII | | | || TfiI TspGWI FokI | | | || HinfI |BseGI | TspDTI MboII BsmAI \ \ \ \\ \ \\ \ \ \ \ GAAGCTATTAACGGATTCAAGGATGAAACTATTTCAAAGAAGATTATAGGAATGTCTCTG 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGATAATTGCCTAAGTTCCTACTTTGATAAAGTTTCTTCTAATATCCTTACAGAGAC / / /// / // / / / | | ||MseI HinfI |BseGI | FokI MboII | | |BseMII TfiI TspGWI TspDTI | | BspCNI | CviJI | AluI SetI E A I N G F K D E T I S K K I I G M S L K L L T D S R M K L F Q R R L * E C L C S Y * R I Q G * N Y F K E D Y R N V S V ----:----|----:----|----:----|----:----|----:----|----:----| S A I L P N L S S V I E F F I I P I D R L L * * R I * P H F * K L S S * L F T E F S N V S E L I F S N * L L N Y S H R Q BssKI SecI* EcoRII | ScrFI | BseBI | | Hin6I | | |GlaI | | ||HhaI TfiI | | ||| Hin4II* HinfI \ \ \\\ \ \ TTGATGAGAACATTTTTATATACCCTGGCGCAAGAAACCGAAGGCACGAATCGTCATACG 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| AACTACTCTTGTAAAAATATATGGGACCGCGTTCTTTGGCTTCCGTGCTTAGCAGTATGC / ///// / / BsmAI ||||| Hin4II* HinfI ||||Hin6I TfiI |||GlaI ||EcoRII ||BssKI ||HhaI |SecI* BseBI ScrFI L M R T F L Y T L A Q E T E G T N R H T * * E H F Y I P W R K K P K A R I V I R D E N I F I Y P G A R N R R H E S S Y A ----:----|----:----|----:----|----:----|----:----|----:----| N I L V N K Y V R A C S V S P V F R * V T S S F M K I Y G P A L F R L C S D D Y Q H S C K * I G Q R L F G F A R I T M R BssKI SecI* Cac8I EcoRII | BsmAI |PasI | Eco31I |SecI* | | Hpy178III* ||HgaI | | | Tsp4CI* ||ScrFI | | | | Hpy178III* ||BseBI | | | | | GsuI AciI ||| Csp6I | | | | | BccI Eco57MI HphI ||| |RsaI | | | | | | MseI | FauI | MboII ||| |BslFI \ \ \ \ \ \ \ \ \ \ \ \\\ \\ CTTGCTCTGGAGACCGTCCTGATTAAGATGGTGAAGATGTTGCGGGACAACCCAGGGTAC 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGAGACCTCTGGCAGGACTAATTCTACCACTTCTACAACGCCCTGTTGGGTCCCATG / // / / / // / / / /// // Cac8I || | | | |Eco57MI | | MboII ||| |Csp6I || | | | |GsuI | | AciI ||| RsaI || | | | MseI | HphI ||| HgaI || | | BccI FauI ||EcoRII || | Hpy178III* ||BssKI || Tsp4CI* ||SecI* |Hpy178III* |SecI* Eco31I |PasI BsmAI BseBI ScrFI L A L E T V L I K M V K M L R D N P G Y L L W R P S * L R W * R C C G T T Q G T C S G D R P D * D G E D V A G Q P R V Q ----:----|----:----|----:----|----:----|----:----|----:----| S A R S V T R I L I T F I N R S L G P Y A Q E P S R G S * S P S S T A P C G L T K S Q L G D Q N L H H L H Q P V V W P V SetI | NdeI | | AciI | | | HgiCI* | | | | NlaIV | | | | |BssKI | | | | |EcoRII | | | | ||SecI* | | | | |||ScrFI | | | | |||BseBI | | | | |||| NlaIV | | | | |||| |CviJI | | | | |||| || AciI | | | | |||| || SduI | | | | |||| || Cac8I TspEI | | | | |||| || HgiJII* |Hin4II* | | | | |||| || | FauI AcyI || MseI | | | | |||| || | | SfeI* \ \\ \ \ \ \ \ \\\\ \\ \ \ \ AAGGCGTCAAAAGAAATTAAGAAGGTCATATGCGGTGCCTGGGAGCCCGCAATAACTATA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGCAGTTTTCTTTAATTCTTCCAGTATACGCCACGGACCCTCGGGCGTTATTGATAT / / / // / / / / / / //// / / / / | AcyI | || SetI | | | | | |||| | AciI | SfeI* BslFI | |MseI | | | | | |||| Cac8I FauI | TspEI | | | | | |||CviJI Hin4II* | | | | | ||NlaIV | | | | | |HgiJII* | | | | | |SduI | | | | | EcoRII | | | | | BssKI | | | | | SecI* | | | | BseBI | | | | ScrFI | | | HgiCI* | | NlaIV | AciI NdeI K A S K E I K K V I C G A W E P A I T I R R Q K K L R R S Y A V P G S P Q * L * G V K R N * E G H M R C L G A R N N Y R ----:----|----:----|----:----|----:----|----:----|----:----| L A D F S I L F T M H P A Q S G A I V I C P T L L F * S P * I R H R P A R L L * L R * F F N L L D Y A T G P L G C Y S Y TspEI TspEI \ \ GAGAAACTAAAGCAATTTTCTTGGATAAGTGTAGTGAATGATTTAGTGGGAGAAAAATTA 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTTGATTTCGTTAAAAGAACCTATTCACATCACTTACTAAATCACCCTCTTTTTAAT / / TspEI TspEI E K L K Q F S W I S V V N D L V G E K L R N * S N F L G * V * * M I * W E K N * E T K A I F L D K C S E * F S G R K I S ----:----|----:----|----:----|----:----|----:----|----:----| S F S F C N E Q I L T T F S K T P S F N L S V L A I K K S L H L S H N L P L F I L F * L L K R P Y T Y H I I * H S F F * MnlI | AvaI | XhoI | SmlI | PspXI | |TaqI | |SduI | |HgiAI* | |BmeT110I | || BfiI | || |MwoI | || || NlaIV | || || |CviJI | || || || BsrI | || || || SduI | || || || HgiJII* | || || || | CviRI* | || || || | | Cac8I | || || || | | TspRI | || || || | | |BseRI \ \\ \\ \\ \ \ \\ GTTGTTGTGGTGCTCGAGGAGCCCAGTGCAAGCATTATGGTAGAACTAAAACTTCCTTTA 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| CAACAACACCACGAGCTCCTCGGGTCACGTTCGTAATACCATCTTGATTTTGAAGGAAAT / / /// /// /// | | ||| ||CviJI ||Cac8I | | ||| ||TspRI |BseRI | | ||| ||BsrI CviRI* | | ||| |NlaIV | | ||| HgiJII* | | ||| SduI | | ||PspXI | | ||SmlI | | ||XhoI | | ||AvaI | | |BmeT110I | | |TaqI | | |BfiI | | MwoI | HgiAI* | SduI MnlI V V V V L E E P S A S I M V E L K L P L L L W C S R S P V Q A L W * N * N F L * C C G A R G A Q C K H Y G R T K T S F R ----:----|----:----|----:----|----:----|----:----|----:----| T T T T S S S G L A L M I T S S F S G K L Q Q P A R P A W H L C * P L V L V E K N N H H E L L G T C A N H Y F * F K R * BseGI |ApoI FokI BccI |TspEI | MboII TspEI | TaqI |EcoRI | |TspDTI CviRI* \ \ \ \\ \ \\ \ GAAATAAATTACGCCTTTTCGATGGATGAAGAATTCAAAAATATGGACTGCATTTGA 2890 2900 2910 2920 2930 ----:----|----:----|----:----|----:----|----:----|----:-- CTTTATTTAATGCGGAAAAGCTACCTACTTCTTAAGTTTTTATACCTGACGTAAACT / / / / / / / / TspEI BccI TaqI BseGI | | FokI CviRI* | TspDTI | MboII EcoRI TspEI ApoI E I N Y A F S M D E E F K N M D C I * K * I T P F R W M K N S K I W T A F X N K L R L F D G * R I Q K Y G L H L X ----:----|----:----|----:----|----:----|----:----|----:-- S I F * A K E I S S S N L F I S Q M Q L F L N R R K S P H L I * F Y P S C K F Y I V G K R H I F F E F I H V A N S # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 2 FblI,XmiI AciI 6 BspACI,SsiI AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AgeI 1 AsiGI,BshTI,CspAI,PinAI AjuI 1 AluI 5 AluBI AlwNI 1 CaiI ApoI 14 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 7 Bce83I* 2 BpuEI BceAI 2 BcgI 2 BclI 3 FbaI,Ksp22I BdaI 4 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglII 3 BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmeT110I 1 BmgT120I 1 BsaBI 2 Bse8I,BseJI BsaXI 1 BseBI 6 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 3 BseRI 3 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 3 BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 1 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BstKTI 11 BtrI 1 BmgBI,AjiI Cac8I 6 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 8 CviQI,RsaNI CspCI 1 CviAII 5 CviJI 19 CviKI-1 CviRI* 14 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 11 MalI Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 2 EcoP15I 1 EcoRI 2 EcoRII 6 AjnI,Psp6I,PspGI EcoT22I 3 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 5 FauI 2 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 GlaI 3 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 3 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 8 HpyAV Hin6I 3 HinP1I,HspAI HindII 2 HincII HindIII 1 HinfI 12 HpaII 2 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 10 Hpy188III Hpy188I 13 KpnI 1 Ksp632I* 6 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 8 HpyCH4IV MaeIII 5 MboI 11 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 20 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 2 MunI MlyI 4 SchI MmeI 1 MnlI 17 MseI 13 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NmeAIII 1 NruI 1 BtuMI,Bsp68I NspI 2 BstNSI,XceI PasI 2 PflMI 1 BasI,AccB7I,Van91I PleI 4 PpsI PspXI 1 PstI 1 RsaI 8 AfaI SapI 1 LguI,PciSI,BspQI ScaI 1 BmcAI,AssI,ZrmI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 8 BseDI,BssECI,BsaJI SetI 26 SfaNI 3 LweI SfeI* 5 BstSFI,SfcI,BfmI SmlI 4 SmoI SphI 2 PaeI,BbuI SplI* 1 Pfl23II,PspLI,BsiWI SspI 4 StuI 2 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 8 TaqI 8 TatI 2 TfiI 8 PfeI TseI 1 ApeKI TsoI 1 Tsp45I 4 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 15 TspEI 33 TasI,Tsp509I,Sse9I TspGWI 5 TspRI 2 TscAI TstI 1 VspI 1 PshBI,AseI XcmI 1 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 3 BstYI,MflI,PsuI,BstX2I XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AflIII AhaIII* AlfI AloI ApaI ApaLI AscI AvaII AvrII BaeI BalI BamHI BbvCI BciVI BglI BmtI BplI Bpu10I BsaAI BsePI BseSI BseYI BsgI BsiI* Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtsI CauII* Cfr9I DinI DraII DraIII DrdI DsaI* Ecl136II Eco47III EcoICRI EcoNI EcoRV EgeI EheI FalI FseI FspAI GsaI HpaI Hpy99I KasI MauBI MluI MroNI MstI* NaeI NarI NcoI NgoMIV NheI NotI NspBII* OliI PacI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SrfI Sse232I* Sse8387I SwaI TaqII TauI TspMI Tth111I XbaI XmaCI XmaI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769