Restriction Map of YLR399W-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YLR399W-A on chromosome XII from coordinates 920869 to 920973.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.5236

AciI Cac8I | BsiYI* | | FauI | | |AsuI* | | |AvaII | | ||BmgT120I Tsp4CI* | | ||| Tsp4CI* | MseI | | ||| | ApoI | |HpaI | | ||| | TspEI | |HindII | | ||| | | MseI | |Hpy166II \ \ \\\ \ \ \ \ \\ ATGTTTCTTGCCATTTGTGATATGCCCGCATTTGGACCGTTGAATTTAATACTGTTGTTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAAGAACGGTAAACACTATACGGGCGTAAACCTGGCAACTTAAATTATGACAACAAT / / /// / / / // | BsiYI* ||Tsp4CI* | | | |MseI | AciI ||AvaII | | | Hpy166II Cac8I ||AsuI* | | | HindII |BmgT120I | | | HpaI FauI | | Tsp4CI* | MseI TspEI ApoI M F L A I C D M P A F G P L N L I L L L C F L P F V I C P H L D R * I * Y C C * V S C H L * Y A R I W T V E F N T V V N ----:----|----:----|----:----|----:----|----:----|----:----| X N R A M Q S I G A N P G N F K I S N N X T E Q W K H Y A R M Q V T S N L V T T H K K G N T I H G C K S R Q I * Y Q Q * FatI MnlI |CviAII | TspDTI || NlaIII | | BetI* || | TspGWI | | BspMII* || | | BsaBI | | |HpaII || | | | TsoI | | |Hpy178III* \\ \ \ \ \ \ \ \\ ACCATGAGATTGAAATCCTCCGTGATTTGCTCCGGAACTTCATAA 70 80 90 100 ----:----|----:----|----:----|----:----|----: TGGTACTCTAACTTTAGGAGGCACTAAACGAGGCCTTGAAGTATT / /// // // // | ||| |TsoI |TspDTI |BspMII* | ||| BsaBI MnlI |BetI* | ||TspGWI Hpy178III* | |FatI HpaII | CviAII NlaIII T M R L K S S V I C S G T S * P * D * N P P * F A P E L H X H E I E I L R D L L R N F I X ----:----|----:----|----:----|----:----|----: V M L N F D E T I Q E P V E Y L W S I S I R R S K S R F K M G H S Q F G G H N A G S S * L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI ApoI 1 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BetI* 1 BsaWI BmgT120I 1 BsaBI 1 Bse8I,BseJI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII Cac8I 1 BstC8I CviAII 1 FatI 1 FauI 1 SmuI HindII 1 HincII HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI Hpy166II 1 Hpy8I Hpy178III* 1 Hpy188III MnlI 1 MseI 2 Tru1I,Tru9I NlaIII 1 Hin1II,Hsp92II,FaeI TsoI 1 Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 1 TasI,Tsp509I,Sse9I TspGWI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AluI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BfiI BglI BglII BinI* BisI BlsI BmeT110I BmtI BplI Bpu10I BsaAI BsaXI BseBI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviJI CviQI CviRI* DdeI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI Fnu4HI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindIII HinfI HinP1I HphI Hpy188I Hpy99I HspAI KasI KpnI Ksp632I* MaeI MaeII MaeIII MauBI MboI MboII McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SecI* SetI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaiI TaqI TaqII TatI TauI TfiI TseI Tsp45I TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769