Restriction Map of BDF1/YLR399C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

BDF1/YLR399C on chromosome XII from coordinates 921596 to 919536.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.28542

EMBOSS_001 Csp6I TaqII EcoRV |RsaI BdaI BseGI FokI \ \\ \ \ \ ATGACCGATATCACACCCGTACAGAACGATGTGGATGTCAATGGTAATAATGTCAATGAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGGCTATAGTGTGGGCATGTCTTGCTACACCTACAGTTACCATTATTACAGTTACTG / / // / / / / EcoRV | || BdaI BseGI FokI Hpy99I | |Csp6I | RsaI TaqII M T D I T P V Q N D V D V N G N N V N D * P I S H P Y R T M W M S M V I M S M T D R Y H T R T E R C G C Q W * * C Q * R ----:----|----:----|----:----|----:----|----:----|----:----| X V S I V G T C F S T S T L P L L T L S X S R Y * V R V S R H P H * H Y Y H * H H G I D C G Y L V I H I D I T I I D I V StuI CviJI HaeIII | SfeI* | | MboI | | | DpnI | | | |BstKTI | | | ||BinI* | | | ||| MboI | | | ||| BamHI | | | ||| XhoII | | | ||| | DpnI | | | ||| | NlaIV | | | ||| | |BstKTI | | | ||| | || TaqI | | | ||| | || AsuII | | | ||| | || |MlyI MaeII | | | ||| | || |PleI | Hpy99I | | | ||| | || |BinI* | |SetI | | | ||| | || || BsiYI* | |TaiI | | | ||| | || || | HinfI | || BsrI MnlI | | | ||| | || || | Hin4II* \ \\ \ \ \ \ \ \\\ \ \\ \\ \ \ GACGTTTCCAGTAATCTAAAGAGGCCTATAGATCAAGGGGATCCTTCGAATGGACTCGCA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCAAAGGTCATTAGATTTCTCCGGATATCTAGTTCCCCTAGGAAGCTTACCTGAGCGT / / / / / /// // // / /// / / | | BsrI MnlI | ||| || || | ||| | HinfI | MaeII | ||| || || | ||| Hin4II* TaiI | ||| || || | ||BinI* SetI | ||| || || | ||AsuII | ||| || || | ||TaqI | ||| || || | ||PleI | ||| || || | |MlyI | ||| || || | BsiYI* | ||| || || XhoII | ||| || || BamHI | ||| || || MboI | ||| || |NlaIV | ||| || |DpnI | ||| || BstKTI | ||| |BinI* | ||| MboI | ||DpnI | |BstKTI | SfeI* HaeIII CviJI StuI D V S S N L K R P I D Q G D P S N G L A T F P V I * R G L * I K G I L R M D S Q R F Q * S K E A Y R S R G S F E W T R R ----:----|----:----|----:----|----:----|----:----|----:----| S T E L L R F L G I S * P S G E F P S A R R K W Y D L S A * L D L P D K S H V R V N G T I * L P R Y I L P I R R I S E C TsoI | SfaNI | | CviJI | | |MaeI | | || BccI MboII | | || | SfaNI |AciI | | || | |EcoP15I || MboII | | || | || BsrI || | FauI | | || | || | BtgZI || | | BsrI CviRI* | | || | || | |BseGI \\ \ \ \ \ \ \ \\ \ \\ \ \\ GAAGAAGAAAACCCCGCCAATAACCAGTTGCATCTCAAAAAGGCTAGACTGGATGGAGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTCTTTTGGGGCGGTTATTGGTCAACGTAGAGTTTTTCCGATCTGACCTACCTCTA / // // / / / // // / / | |AciI |FauI | TsoI | || || | BtgZI | MboII BsrI CviRI* | || || BseGI MboII | || |SfaNI | || EcoP15I | || BsrI | |BccI | MaeI SfaNI CviJI E E E N P A N N Q L H L K K A R L D G D K K K T P P I T S C I S K R L D W M E M R R K P R Q * P V A S Q K G * T G W R C ----:----|----:----|----:----|----:----|----:----|----:----| S S S F G A L L W N C R L F A L S S P S L L L F G R W Y G T A D * F P * V P H L F F F V G G I V L Q M E F L S S Q I S I KasI HgiCI* |AcyI |NarI |Hin6I ||GlaI ||DinI ||NlaIV |||HhaI ||||HaeII ||||| BssKI ||||| SecI* ||||| EcoRII ||||| | BglI ||||| | MwoI ||||| | ScrFI ||||| | BseBI ||||| | | AciI MwoI Hin4II* ||||| | | |BisI FokI Cac8I | CviRI* Tsp4CI* ||||| | | ||BlsI \ \ \ \ \ \\\\\ \ \ \\\ GCTCTAACATCATCGCCTGCTGGACTTGCAGAGAACGGTATTGAAGGCGCCACCCTGGCG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGATTGTAGTAGCGGACGACCTGAACGTCTCTTGCCATAACTTCCGCGGTGGGACCGC / / / / / ///// / ///// FokI | MwoI CviRI* Tsp4CI* ||||| | ||||BisI Cac8I Hin4II* ||||| | ||||AciI ||||| | |||BlsI ||||| | ||EcoRII ||||| | ||BssKI ||||| | ||TauI ||||| | |SecI* ||||| | BseBI ||||| | ScrFI ||||| MwoI ||||| BglI ||||HgiCI* ||||KasI |||Hin6I |||NarI |||AcyI ||NlaIV ||DinI ||GlaI |HhaI HaeII A L T S S P A G L A E N G I E G A T L A L * H H R L L D L Q R T V L K A P P W R S N I I A C W T C R E R Y * R R H P G G ----:----|----:----|----:----|----:----|----:----|----:----| A R V D D G A P S A S F P I S P A V R A H E L M M A Q Q V Q L S R Y Q L R W G P S * C * R R S S K C L V T N F A G G Q R Hin6I BbvII* TauI BetI* |GlaI | MboII CviJI |HpaII ||HhaI | | Hin4II* \ \\ \\\ \ \ \ GCTAACGGGGAAAATGGGTATAACGCCACCGGAAGTGGCGCAGAAGACGAACAGCAGGGG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTGCCCCTTTTACCCATATTGCGGTGGCCTTCACCGCGTCTTCTGCTTGTCGTCCCC / // /// / / CviJI |BetI* ||Hin6I | Hin4II* HpaII |GlaI BbvII* HhaI MboII A N G E N G Y N A T G S G A E D E Q Q G L T G K M G I T P P E V A Q K T N S R G * R G K W V * R H R K W R R R R T A G V ----:----|----:----|----:----|----:----|----:----|----:----| A L P S F P Y L A V P L P A S S S C C P P * R P F H T Y R W R F H R L L R V A P S V P F I P I V G G S T A C F V F L L P MboII EcoP15I | Acc65I | HgiCI* | |Csp6I | ||RsaI | ||SetI | ||NlaIV Hin4II* | ||| KpnI | MnlI MboII | ||| |MnlI Hin4I \ \ \ \ \\\ \\ \ TTGAAGAAGGAAGAAGGAGGACAAGGTACCAAACAAGAGGATTTAGATGAAAACTCAAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTCTTCCTTCTTCCTCCTGTTCCATGGTTTGTTCTCCTAAATCTACTTTTGAGTTTT / / / / /// /// / / | MnlI MboII | ||| ||| Hin4I TspDTI Hin4II* | ||| ||HgiCI* | ||| ||Acc65I | ||| ||MnlI | ||| |Csp6I | ||| NlaIV | ||| RsaI | ||KpnI | |EcoP15I | SetI MboII L K K E E G G Q G T K Q E D L D E N S K * R R K K E D K V P N K R I * M K T Q N E E G R R R T R Y Q T R G F R * K L K T ----:----|----:----|----:----|----:----|----:----|----:----| N F F S S P P C P V L C S S K S S F E F T S S P L L L V L Y W V L P N L H F S L Q L L F F S S L T G F L L I * I F V * F NlaIV | GsuI Hpy178III* TspDTI | BseRI | MnlI | BccI | Eco57MI | |CviJI | | MnlI | |SetI | || SduI | | Hin4I SetI | || BseRI | || MnlI | | | Hpy188I NlaIV | || | BspMI | || HgiJII* \ \ \ \ \ \ \\ \ \ \ \\ \ CAAGAACTTCCGATGGAGGTTCCAAAGGAACCTGCCCCTGCTCCTCCTCCAGAGCCCGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTGAAGGCTACCTCCAAGGTTTCCTTGGACGGGGACGAGGAGGAGGTCTCGGGCTA / // / / / // / / // // | || | | NlaIV || BseRI BspMI || |MnlI | || | SetI |Eco57MI || CviJI | || Hpy188I |BseRI |HgiJII* | |MnlI |GsuI |MnlI | BccI NlaIV |SduI Hin4I SetI Hpy178III* Q E L P M E V P K E P A P A P P P E P D K N F R W R F Q R N L P L L L L Q S P I R T S D G G S K G T C P C S S S R A R Y ----:----|----:----|----:----|----:----|----:----|----:----| C S S G I S T G F S G A G A G G G S G S V L V E S P P E L P V Q G Q E E E L A R L F K R H L N W L F R G R S R R W L G I DdeI FatI | TspDTI |CviAII | |Hpy188I || NspI | ||TfiI || BsrDI | ||HinfI || CviRI* | ||| MnlI || NlaIII | ||| | BspCNI || | EcoT22I | ||| | |AlfI || | | MwoI | ||| | |AlfI || | | BstAPI | ||| | |BseMII || | | |Cac8I \ \\\ \ \\ \\ \ \ \\ ATGAATAATCTCCCTCAGAATCCAATACCAAAGCACCAGCAGAAACATGCATTGCTTGCG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTATTAGAGGGAGTCTTAGGTTATGGTTTCGTGGTCGTCTTTGTACGTAACGAACGC / // // // / /// / / / | || || |BseMII | ||| | | AlfI | || || |AlfI | ||| | | AlfI | || || |AlfI | ||| | Cac8I | || || BspCNI | ||| BstAPI | || |MnlI | ||| MwoI | || HinfI | ||CviRI* | || TfiI | ||FatI | |DdeI | |CviAII | Hpy188I | EcoT22I TspDTI | BsrDI NlaIII NspI M N N L P Q N P I P K H Q Q K H A L L A * I I S L R I Q Y Q S T S R N M H C L R E * S P S E S N T K A P A E T C I A C D ----:----|----:----|----:----|----:----|----:----|----:----| I F L R G * F G I G F C W C F C A N S A Y S Y D G E S D L V L A G A S V H M A Q H I I E R L I W Y W L V L L F M C Q K R MseI AlfI AlfI | MwoI SetI | | AluI |BfiI | | CviJI BsmAI || HindII | | EcoP15I SfaNI Eco31I || Hpy166II | | | SetI Hin4II* | BseGI FokI || | BsrI \ \ \ \ \ \ \ \ \\ \ \ ATTAAAGCTGTCAAACGCTTGAAGGATGCGAGACCCTTTCTACAACCTGTTGACCCAGTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTTCGACAGTTTGCGAACTTCCTACGCTCTGGGAAAGATGTTGGACAACTGGGTCAC / // / / / / / / / / / / | || | | | SfaNI Eco31I | | | | TspRI | || | | Hin4II* BseGI | | | | BsrI | || | EcoP15I BsmAI | | | Hpy166II | || CviJI | | | HindII | || AluI | | BfiI | |SetI | SetI | MseI FokI MwoI I K A V K R L K D A R P F L Q P V D P V L K L S N A * R M R D P F Y N L L T Q * * S C Q T L E G C E T L S T T C * P S E ----:----|----:----|----:----|----:----|----:----|----:----| I L A T L R K F S A L G K R C G T S G T S * L Q * V S S P H S V R E V V Q Q G L N F S D F A Q L I R S G K * L R N V W H AccI |Hpy166II TspEI CviJI || MnlI |TspRI MseI MnlI HaeIII || SfeI* \\ \ \ \ \\ \ AAATTGGATATTCCCTTTTACTTTAACTACATAAAGAGGCCAATGGACTTGTCTACTATA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAACCTATAAGGGAAAATGAAATTGATGTATTTCTCCGGTTACCTGAACAGATGATAT / / / / /// / TspEI | MnlI HaeIII ||MnlI SfeI* MseI CviJI |AccI Hpy166II K L D I P F Y F N Y I K R P M D L S T I N W I F P F T L T T * R G Q W T C L L * I G Y S L L L * L H K E A N G L V Y Y R ----:----|----:----|----:----|----:----|----:----|----:----| F N S I G K * K L * M F L G I S K D V I S I P Y E R K S * S C L S A L P S T * * F Q I N G K V K V V Y L P W H V Q R S Y MaeII | SetI BetI* | TaiI BspMII* | | Hin6I |HpaII | | |GlaI |Hpy178III* | | ||HhaI || TspDTI TsoI | | |||HaeII || |MnlI |BsaBI \ \ \\\\ \\ \\ \\ GAGAGGAAGTTGAACGTAGGCGCTTATGAAGTTCCGGAGCAAATCACGGAGGATTTCAAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTCCTTCAACTTGCATCCGCGAATACTTCAAGGCCTCGTTTAGTGCCTCCTAAAGTTA / / //// // / / / / / | | |||Hin6I || | MnlI | | TspGWI | | ||GlaI || TspDTI | BsaBI | | |HhaI |BspMII* TsoI | | HaeII |BetI* | MaeII Hpy178III* TaiI HpaII SetI E R K L N V G A Y E V P E Q I T E D F N R G S * T * A L M K F R S K S R R I S I E E V E R R R L * S S G A N H G G F Q S ----:----|----:----|----:----|----:----|----:----|----:----| S L F N F T P A * S T G S C I V S S K L L S S T S R L R K H L E P A F * P P N * L P L Q V Y A S I F N R L L D R L I E I TspGWI |FatI ||CviAII ||| NlaIII ||| | MseI ||| | |HpaI AsuI* ||| | |HindII AvaII ||| | |Hpy166II Tsp4CI* ||| | || Tsp4CI* |BmgT120I ||| | || | MseI || AciI ||| | || | | ApoI || BsiYI* ||| | || | | TspEI ||FauI | Cac8I \\\ \ \\ \ \ \ \\\ \ \ CTCATGGTTAACAACAGTATTAAATTCAACGGTCCAAATGCGGGCATATCACAAATGGCA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTACCAATTGTTGTCATAATTTAAGTTGCCAGGTTTACGCCCGTATAGTGTTTACCGT / // // / / / / /// / / | || |MseI | | | | ||| | Cac8I | || | | | | | ||| | AciI | || | | | | | ||| BsiYI* | || | | | | | ||FauI | || | | | | | |AvaII | || | | | | | |AsuI* | || | | | | | BmgT120I | || | | | | Tsp4CI* | || | | | TspEI | || | | | ApoI | || | | MseI | || | Tsp4CI* | || Hpy166II | || HindII | || HpaI | |FatI | CviAII NlaIII L M V N N S I K F N G P N A G I S Q M A S W L T T V L N S T V Q M R A Y H K W Q H G * Q Q Y * I Q R S K C G H I T N G K ----:----|----:----|----:----|----:----|----:----|----:----| R M T L L L I L N L P G F A P M D C I A D * P * C C Y * I * R D L H P C I V F P E H N V V T N F E V T W I R A Y * L H C MwoI | SfaNI HindIII | | Cac8I | AluI TaqI | | | DdeI | CviJI |Hpy178III* | | | Bpu10I | | SetI || NdeI | | | | MwoI BseGI \ \ \ \\ \ \ \ \ \ \ \ AGAAACATACAAGCTTCTTTCGAGAAACATATGCTAAATATGCCTGCTAAGGATGCTCCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTGTATGTTCGAAGAAAGCTCTTTGTATACGATTTATACGGACGATTCCTACGAGGT / / / // / / / / // / / | | | || NdeI MwoI | | || | SetI | | | |Hpy178III* | | || BseGI | | | TaqI | | |Bpu10I | | HindIII | | |DdeI | CviJI | | MwoI | AluI | SfaNI SetI Cac8I R N I Q A S F E K H M L N M P A K D A P E T Y K L L S R N I C * I C L L R M L H K H T S F F R E T Y A K Y A C * G C S T ----:----|----:----|----:----|----:----|----:----|----:----| L F M C A E K S F C I S F I G A L S A G L F C V L K K R S V Y A L Y A Q * P H E S V Y L S R E L F M H * I H R S L I S W BsiYI* | AciI | PshAI | | TsoI | | | MaeI | | | | BslFI | | | | |MnlI BseGI | | | | |SfaNI | MfeI CviJI | | | | || SduI | TspEI SetI |StyI | | | | || BseSI | | FokI |FokI |SecI* | | | | || |BceAI | | |TspEI \\ \\ \ \ \ \ \\ \\ \ \ \\ CCTGTAATAGCCAAGGGACGGCGGTCTAGTGCCCAAGAGGATGCCCCAATTGTAATTAGA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GGACATTATCGGTTCCCTGCCGCCAGATCACGGGTTCTCCTACGGGGTTAACATTAATCT / / // /// // // / / / // | | |SecI* ||AciI || || BceAI BseGI | |TspEI | | |StyI |TsoI || |SfaNI | FokI | | BsiYI* PshAI || BslFI TspEI | CviJI |BseSI MfeI FokI |SduI |MnlI MaeI P V I A K G R R S S A Q E D A P I V I R L * * P R D G G L V P K R M P Q L * L D C N S Q G T A V * C P R G C P N C N * T ----:----|----:----|----:----|----:----|----:----|----:----| G T I A L P R R D L A W S S A G I T I L V Q L L W P V A T * H G L P H G L Q L * R Y Y G L S P P R T G L L I G W N Y N S CviJI Hin4I | SduI Hin4I | HgiJII* CviJI | | XcmI HaeIII BseGI Hin4I | | |MnlI | FokI EciI | AciI Hin4I \ \ \\ \ \ \ \ \ \ CGAGCCCAAACTCATAATGGGAGGCCGAAAAGGACTATACATCCGCCGAAATCAAAGGAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GCTCGGGTTTGAGTATTACCCTCCGGCTTTTCCTGATATGTAGGCGGCTTTAGTTTCCTA / / // / / / / / / | CviJI |MnlI | | FokI BseGI AciI Hin4I HgiJII* XcmI | | EciI Hin4I SduI | HaeIII | CviJI Hin4I Hin4I R A Q T H N G R P K R T I H P P K S K D E P K L I M G G R K G L Y I R R N Q R I S P N S * W E A E K D Y T S A E I K G Y ----:----|----:----|----:----|----:----|----:----|----:----| R A W V * L P L G F L V I C G G F D F S V L G F E Y H S A S F S * V D A S I L P S G L S M I P P R F P S Y M R R F * L I TfiI ApoI HinfI TspDTI TspEI BsaBI | TaqI | MboII |BsrDI \ \ \ \ \ \\ ATTTATCCTTATGAATCGAAGAAACCGAAATCCAAAAGACTACAACAAGCAATGAAATTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TAAATAGGAATACTTAGCTTCTTTGGCTTTAGGTTTTCTGATGTTGTTCGTTACTTTAAA / / / / / / / BsaBI | TaqI | MboII | TspEI HinfI TspDTI | ApoI TfiI BsrDI I Y P Y E S K K P K S K R L Q Q A M K F F I L M N R R N R N P K D Y N K Q * N F L S L * I E E T E I Q K T T T S N E I L ----:----|----:----|----:----|----:----|----:----|----:----| I * G * S D F F G F D L L S C C A I F N Y K D K H I S S V S I W F V V V L L S I N I R I F R L F R F G F S * L L C H F K CfrI | BalI Hpy188I BccI | CviJI PsiI | TspDTI |TspEI | HaeIII Cac8I | MnlI BsiYI* \ \ \\ \ \ \ \ \ \ TGTCAGAGTGTGCTAAAGGAATTGATGGCCAAGAAGCACGCCTCTTATAACTACCCATTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ACAGTCTCACACGATTTCCTTAACTACCGGTTCTTCGTGCGGAGAATATTGATGGGTAAA // / / / / / / / / |TspDTI | | | CfrI Cac8I | MnlI BsiYI* Hpy188I | | HaeIII PsiI | | CviJI | | BalI | TspEI BccI C Q S V L K E L M A K K H A S Y N Y P F V R V C * R N * W P R S T P L I T T H F S E C A K G I D G Q E A R L L * L P I F ----:----|----:----|----:----|----:----|----:----|----:----| Q * L T S F S N I A L F C A E * L * G N K D S H A L P I S P W S A R R K Y S G M T L T H * L F Q H G L L V G R I V V W K NlaIV | BsrI | | BfiI | | |AccI | | ||Hpy166II ApoI TspDTI | | ||| BsrI TspEI | TaqI MseI CviJI \ \ \\\ \ \ \ \ \ \ TTGGAACCAGTAGACCCAGTTTCTATGAATTTGCCGACTTATTTCGATTATGTTAAAGAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTTGGTCATCTGGGTCAAAGATACTTAAACGGCTGAATAAAGCTAATACAATTTCTC / / /// / / / / / | | ||BsrI TspEI TspDTI TaqI MseI CviJI | | |AccI ApoI | | Hpy166II | BfiI NlaIV BsrI L E P V D P V S M N L P T Y F D Y V K E W N Q * T Q F L * I C R L I S I M L K S G T S R P S F Y E F A D L F R L C * R A ----:----|----:----|----:----|----:----|----:----|----:----| K S G T S G T E I F K G V * K S * T L S K P V L L G L K * S N A S K N R N H * L Q F W Y V W N R H I Q R S I E I I N F L TspEI | MseI BsrI MnlI \ \ \ \ CCAATGGATTTAGGCACAATCGCCAAGAAATTAAATGACTGGCAGTATCAAACAATGGAG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTACCTAAATCCGTGTTAGCGGTTCTTTAATTTACTGACCGTCATAGTTTGTTACCTC // / / |MseI BsrI MnlI TspEI P M D L G T I A K K L N D W Q Y Q T M E Q W I * A Q S P R N * M T G S I K Q W R N G F R H N R Q E I K * L A V S N N G G ----:----|----:----|----:----|----:----|----:----|----:----| G I S K P V I A L F N F S Q C Y * V I S A L P N L C L R W S I L H S A T D F L P W H I * A C D G L F * I V P L I L C H L AflIII | MaeII | | SetI | | TaiI | | | BccI MnlI | | | | BetI* | MaeII | | | | BspMII* | |BtrI MseI | | | | |HpaII Esp3I | || SetI |AhaIII* | | | | |Hpy178III* BsmAI | || TaiI SetI || TstI | | | | || BseGI \ \ \\ \ \ \\ \ \ \ \ \ \\ \ GATTTTGAGAGAGACGTGAGGTTGGTCTTTAAAAACTGCTACACGTTCAATCCGGATGGC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAACTCTCTCTGCACTCCAACCAGAAATTTTTGACGATGTGCAAGTTAGGCCTACCG // / // / / // / / / // / / || | || SetI | |MseI | | | || | TstI || | |MaeII | AhaIII* | | | || BseGI || | BtrI TstI | | | |BspMII* || TaiI | | | |BetI* || SetI | | | Hpy178III* |MnlI | | | HpaII BsmAI | | BccI Esp3I | AflIII | MaeII TaiI SetI D F E R D V R L V F K N C Y T F N P D G I L R E T * G W S L K T A T R S I R M A F * E R R E V G L * K L L H V Q S G W H ----:----|----:----|----:----|----:----|----:----|----:----| S K S L S T L N T K L F Q * V N L G S P P N Q S L R S T P R * F S S C T * D P H I K L S V H P Q D K F V A V R E I R I A MboI | DpnI | |PvuI | |TstI | |McrI* MnlI | |BstKTI | XbaI | ||Hin4I | |MaeI | ||Hin4I | |Hpy178III* | |||FokI | || Hin4I | ||||MseI | || Hin4I | |||||BccI | || | TspEI AciI \ \\\\\\ \ \\ \ \ \ ACGATCGTTAATATGATGGGTCATCGTCTAGAGGAAGTTTTCAATTCCAAATGGGCGGAT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTAGCAATTATACTACCCAGTAGCAGATCTCCTTCAAAAGTTAAGGTTTACCCGCCTA / // / // / // / / / | || | |FokI MnlI || Hin4I TspEI AciI | || | MseI || Hin4I | || | BccI |XbaI | || MboI Hpy178III* | |DpnI MaeI | BstKTI | McrI* | PvuI Hin4I Hin4I T I V N M M G H R L E E V F N S K W A D R S L I * W V I V * R K F S I P N G R I D R * Y D G S S S R G S F Q F Q M G G * ----:----|----:----|----:----|----:----|----:----|----:----| V I T L I I P * R R S S T K L E L H A S C S R * Y S P D D D L P L K * N W I P P R D N I H H T M T * L F N E I G F P R I BseGI | TfiI | HinfI | | FokI | | | Hpy188I | | | | MnlI | | | | | TfiI | | | | | HinfI | | | | | | TaqI | | | | | | | AsuI* | | | | | | | AvaII | | | | | | | DraII | | | | | | | PpuMI | | | | | | | |BmgT120I StuI | | | | | | | ||NlaIV CviJI | | | | | | | ||MboII HaeIII | | | | | | | |||TspDTI | TspEI | | | | | | | ||||StyI Hin4I | | EciI | | | | | | | ||||SecI* Hin4I \ \ \ \ \ \ \ \ \ \ \\\\\ \ AGGCCTAATTTGGATGACTACGATTCCGATGAAGATTCGAGGACCCAAGGCGACTACGAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCCGGATTAAACCTACTGATGCTAAGGCTACTTCTAAGCTCCTGGGTTCCGCTGATGCTG / / / / // / / / / /// / / / / | | TspEI BseGI || | MnlI | | ||| | SecI* | BseMII | EciI || FokI | | ||| | StyI Hpy99I HaeIII |Hpy188I | | ||| Hin4I CviJI HinfI | | ||| Hin4I StuI TfiI | | ||PpuMI | | ||DraII | | ||AvaII | | ||AsuI* | | |BmgT120I | | |NlaIV | | TspDTI | | MboII | TaqI HinfI TfiI R P N L D D Y D S D E D S R T Q G D Y D G L I W M T T I P M K I R G P K A T T T A * F G * L R F R * R F E D P R R L R R ----:----|----:----|----:----|----:----|----:----|----:----| L G L K S S * S E S S S E L V W P S * S Y A * N P H S R N R H L N S S G L R S R P R I Q I V V I G I F I R P G L A V V V TspDTI |Hpy188I ||HinfI ||| Hin4I Hpy99I ||| Hin4I |BseMII ||| |AlwNI ||BspCNI ||| || Hpy188I ||| TfiI ||| || | PleI ||| HinfI ||| || | |MlyI TspEI ||| | DdeI ||| || | ||TaqI | FokI CviJI ||| | |Hpy188I ||| || | ||ClaI | | TspDTI |BseGI \\\ \ \\ \\\ \\ \ \\\ \ \ \ \\ GATTATGAATCTGAGTATTCAGAGTCTGACATCGATGAAACTATAATTACAAATCCAGCC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTAATACTTAGACTCATAAGTCTCAGACTGTAGCTACTTTGATATTAATGTTTAGGTCGG / // / /// / // / / / / // / BspCNI || | ||| | || | ClaI | FokI || FalI || | ||| | || | TaqI TspDTI || FalI || | ||| | || PleI TspEI |CviJI || | ||| | || MlyI BseGI || | ||| | |Hpy188I || | ||| | HinfI || | ||| AlwNI || | ||Hpy188I || | |Hin4I || | |Hin4I || | TspDTI || DdeI |Hpy188I HinfI TfiI D Y E S E Y S E S D I D E T I I T N P A I M N L S I Q S L T S M K L * L Q I Q P L * I * V F R V * H R * N Y N Y K S S H ----:----|----:----|----:----|----:----|----:----|----:----| S * S D S Y E S D S M S S V I I V F G A R N H I Q T N L T Q C R H F * L * L D L I I F R L I * L R V D I F S Y N C I W G BsrI | FalI | FalI MboII FokI | |XcmI | Hpy188I | CviRI* | ||BccI | | BseGI | |TspDTI | ||| PflMI | | | FalI | || TspEI | ||| BsiYI* | | | FalI | || | MseI \ \\\ \ \ \ \ \ \ \\ \ \ ATCCAGTATTTGGAAGAACAACTTGCTCGGATGAAAGTGGAGTTGCAACAATTAAAAAAG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGTCATAAACCTTCTTGTTGAACGAGCCTACTTTCACCTCAACGTTGTTAATTTTTTC / // / / / // /// // | || BccI | | |BseGI ||FokI |MseI | |BsiYI* | | FalI |CviRI* TspEI | |PflMI | | FalI TspDTI | XcmI | Hpy188I BsrI MboII I Q Y L E E Q L A R M K V E L Q Q L K K S S I W K N N L L G * K W S C N N * K S P V F G R T T C S D E S G V A T I K K A ----:----|----:----|----:----|----:----|----:----|----:----| M W Y K S S C S A R I F T S N C C N F F W G T N P L V V Q E S S L P T A V I L F D L I Q F F L K S P H F H L Q L L * F L MaeII |PmaCI |BsaAI || SetI || TaiI || |MboI || || DpnI || || |BstKTI Hin6I || || || BinI* |GlaI || || || | AciI ||HhaI || || || | FnuDII* |||DdeI || || || | |BisI |||EspI* || || || | ||BlsI BsrI MnlI |||HaeII || || || | |||TauI \ \ \\\\ \\ \\ \\ \ \\\\ CAAGAACTGGAAAAAATAAGAAAAGAGAGGCGCTTAGCACGTGGATCAAAGAAACGCGGC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTGACCTTTTTTATTCTTTTCTCTCCGCGAATCGTGCACCTAGTTTCTTTGCGCCG / / //// / / // // / / /// BsrI MnlI |||| | | || || MboI | ||BisI |||| | | || |DpnI | ||AciI |||| | | || BstKTI | |BlsI |||| | | |MaeII | FnuDII* |||| | | BsaAI | TauI |||| | | PmaCI BinI* |||| | TaiI |||| | SetI |||| EspI* |||| DdeI |||Hin6I ||GlaI |HhaI HaeII Q E L E K I R K E R R L A R G S K K R G K N W K K * E K R G A * H V D Q R N A A R T G K N K K R E A L S T W I K E T R Q ----:----|----:----|----:----|----:----|----:----|----:----| C S S S F I L F S L R K A R P D F F R P A L V P F F L F L S A S L V H I L S V R L F Q F F Y S F L P A * C T S * L F A A Hin4II* |MboI || DpnI || |TaqI TaqI || |BstKTI DdeI AsuII || ||Hin4II* | MboII |Hin4II* \\ \\\ \ \ \\ AAAAGATCGAAGGGAAGGAGTGGGTCTAAGAACGCTTCTTCGAAAGGAAGGCGAGATAAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCTAGCTTCCCTTCCTCACCCAGATTCTTGCGAAGAAGCTTTCCTTCCGCTCTATTT / ///// // / / | ||||TaqI |DdeI | AsuII | |||MboI MboII | TaqI | ||Hin4II* Hin4II* | |DpnI | BstKTI Hin4II* K R S K G R S G S K N A S S K G R R D K K D R R E G V G L R T L L R K E G E I K K I E G K E W V * E R F F E R K A R * K ----:----|----:----|----:----|----:----|----:----|----:----| L L D F P L L P D L F A E E F P L R S L C F I S P F S H T * S R K K S L F A L Y F S R L S P T P R L V S R R F S P S I F Tsp4CI* | MaeIII MboI | Tsp45I | DpnI | | BdaI MaeII | BdaI | | BdaI | SetI MnlI | BdaI TspEI | | | NdeI | TaiI | TspDTI | |BstKTI \ \ \ \ \ \ \ \ \ \ \\ AAGAATAAATTGAAAACAGTAGTGACATATGATATGAAACGTATCATTACAGAGAGGATC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTATTTAACTTTTGTCATCACTGTATACTATACTTTGCATAGTAATGTCTCTCCTAG / / / / / / / // /// / TspEI | | | NdeI | | |TspDTI ||| MboI | | Tsp45I | | MnlI ||DpnI | | MaeIII | MaeII |BstKTI | BdaI TaiI BdaI | BdaI SetI BdaI Tsp4CI* K N K L K T V V T Y D M K R I I T E R I R I N * K Q * * H M I * N V S L Q R G S E * I E N S S D I * Y E T Y H Y R E D Q ----:----|----:----|----:----|----:----|----:----|----:----| F F L N F V T T V Y S I F R I M V S L I F S Y I S F L L S M H Y S V Y * * L S S L I F Q F C Y H C I I H F T D N C L P D FatI |CviAII BinI* TspEI TaqI || NlaIII \ \ \ \\ \ AATGATTTACCAACTTCCAAATTAGAAAGAGCAATCGACATAATAAAAAAATCCATGCCC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTAAATGGTTGAAGGTTTAATCTTTCTCGTTAGCTGTATTATTTTTTTAGGTACGGG / / / / // BinI* TspEI TaqI | |FatI | CviAII NlaIII N D L P T S K L E R A I D I I K K S M P M I Y Q L P N * K E Q S T * * K N P C P * F T N F Q I R K S N R H N K K I H A Q ----:----|----:----|----:----|----:----|----:----|----:----| L S K G V E L N S L A I S M I F F D M G * H N V L K W I L F L L R C L L F I W A I I * W S G F * F S C D V Y Y F F G H G Eco57I Eco57MI Hpy188I PpiI | TspDTI MnlI | FalI BbvII* | | TaqI FalI SspI | FalI | MboII | | SetI FalI PpiI \ \ \ \ \ \ \ \ \ \ AATATTTCTGAAGACGATGAAGTAGAACTTGACCTCGACACTTTAGATAATCACACCATC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TTATAAAGACTTCTGCTACTTCATCTTGAACTGGAGCTGTGAAATCTATTAGTGTGGTAG / / / / / / // // / / | | | PpiI | | |SetI || | PpiI | | Hpy188I | | TspDTI || MnlI | FalI | Eco57MI |FalI | FalI | Eco57I |FalI SspI BbvII* TaqI MboII N I S E D D E V E L D L D T L D N H T I I F L K T M K * N L T S T L * I I T P S Y F * R R * S R T * P R H F R * S H H L ----:----|----:----|----:----|----:----|----:----|----:----| L I E S S S S T S S S R S V K S L * V M W Y K Q L R H L L V Q G R C K L Y D C W I N R F V I F Y F K V E V S * I I V G D AluI MseI CviJI | BccI | SetI | | TatI | BseGI | | Bsp1407I | | BetI* Eco57I | | |Csp6I | | |HpaII Eco57MI | | ||RsaI FokI | | || TspDTI | Tsp4CI* \ \ \\\ \ \ \ \\ \ \ \ TTAACATTGTACAACACTTTCTTTAGACAATATGAAAGCTCATCCGGTGCTTCTAACGGT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AATTGTAACATGTTGTGAAAGAAATCTGTTATACTTTCGAGTAGGCCACGAAGATTGCCA / / /// / / / /// / / | BccI ||Bsp1407I FokI | CviJI ||BetI* | Tsp4CI* MseI ||TatI | BseGI |HpaII Eco57MI |Csp6I | AluI TspDTI Eco57I RsaI SetI L T L Y N T F F R Q Y E S S S G A S N G * H C T T L S L D N M K A H P V L L T V N I V Q H F L * T I * K L I R C F * R F ----:----|----:----|----:----|----:----|----:----|----:----| K V N Y L V K K L C Y S L E D P A E L P R L M T C C K R * V I H F S M R H K * R * C Q V V S E K S L I F A * G T S R V T SetI SfaNI MaeIII FauI Tsp4CI* |Hin4I | Hin4I |Csp6I |Hin4I | Hin4I ||RsaI || FnuDII* | | AciI \\\ \\ \ \ \ \ TTGGACGGTACTTCAGGTGTTACGCGAGATGCTTCGTCCTTGTCGCCTACAAGTGCGGGA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTGCCATGAAGTCCACAATGCGCTCTACGAAGCAGGAACAGCGGATGTTCACGCCCT / // / /// / / / | || Hin4I ||FnuDII* | FauI AciI | || Hin4I |MaeIII Hin4I | || SetI SfaNI Hin4I | |Csp6I | RsaI Tsp4CI* L D G T S G V T R D A S S L S P T S A G W T V L Q V L R E M L R P C R L Q V R E G R Y F R C Y A R C F V L V A Y K C G K ----:----|----:----|----:----|----:----|----:----|----:----| K S P V E P T V R S A E D K D G V L A P N P R Y K L H * A L H K T R T A * L H P Q V T S * T N R S I S R G Q R R C T R S MboI BglII XhoII MboII | DpnI | MseI | |BstKTI | | MnlI MwoI | ||DdeI | | | CviJI | BseRI \ \\\ \ \ \ \ \ \ AGCAGAAAGAGAAGATCTAAGGCATTAAGCCAAGAGGAGCAGAGTAGGCAGATAGAAAAG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTCTTTCTCTTCTAGATTCCGTAATTCGGTTCTCCTCGTCTCATCCGTCTATCTTTTC // / / / // / / / || | | | || CviJI MwoI BseRI || | | | |MseI || | | | MnlI || | | MboII || | DdeI || XhoII || BglII || MboI |DpnI BstKTI S R K R R S K A L S Q E E Q S R Q I E K A E R E D L R H * A K R S R V G R * K R Q K E K I * G I K P R G A E * A D R K D ----:----|----:----|----:----|----:----|----:----|----:----| L L F L L D L A N L W S S C L L C I S F F C F S F I * P M L G L P A S Y A S L F A S L S S R L C * A L L L L T P L Y F L SetI |DdeI ||Hpy188I ||| CviJI ||| | MnlI ||| | | BglI ||| | | MwoI ||| | | | CviJI ||| | | | |NlaIV ||| | | | || BssKI MaeI HphI ||| | | | || SecI* | AluI | Tsp4CI* ||| | | | || EcoRII | CviJI | | BseMII ||| | | | || | MwoI | | SetI | | |BspCNI ||| | | | || | ScrFI | | | DdeI | | ||TspRI ||| | | | || | BseBI \ \ \ \ \ \ \\\ \\\ \ \ \ \\ \ \ ATAAAAAATAAACTAGCTATCTTAGACAGTGCTTCACCTCTGAGCCAAAACGGCTCCCCA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTTTTATTTGATCGATAGAATCTGTCACGAAGTGGAGACTCGGTTTTGCCGAGGGGT /// // / // / / // // // / / ||CviJI || | || SetI | || |MwoI || | BseBI ||AluI || | |BspCNI | || |BglI || | ScrFI |MaeI || | BseMII | || MnlI || | BsgI SetI || Tsp4CI* | |CviJI || MwoI |HphI | DdeI |NlaIV TspRI Hpy188I CviJI DdeI I K N K L A I L D S A S P L S Q N G S P * K I N * L S * T V L H L * A K T A P Q K K * T S Y L R Q C F T S E P K R L P R ----:----|----:----|----:----|----:----|----:----|----:----| I F F L S A I K S L A E G R L W F P E G S L F Y V L * R L C H K V E S G F R S G Y F I F * S D * V T S * R Q A L V A G W Hin6I |GlaI BsgI |Eco47III CviJI ||TseI HaeIII ||HhaI |BbvI |||BisI || ApoI |||HaeII Eco57I || TspEI ||||BlsI Eco57MI MnlI TseI || |BceAI |||||CviRI* | MboII Hpy188I |BisI \\ \\ \\\\\\ \ \ \ \\ GGCCAAATTCAAAGCGCTGCACACAACGGGTTTTCCTCATCTTCAGATGACGATGTTAGC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGTTTAAGTTTCGCGACGTGTGTTGCCCAAAAGGAGTAGAAGTCTACTGCTACAATCG // /// /////// / / / / || ||| ||||||| | MboII Hpy188I BlsI || ||| ||||||| Eco57MI MnlI || ||| ||||||| Eco57I || ||| ||||||CviRI* || ||| ||||||TseI || ||| |||||BisI || ||| ||||BlsI || ||| |||Hin6I || ||| ||Eco47III || ||| ||GlaI || ||| |HhaI || ||| HaeII || ||TspEI || ||ApoI || |BceAI || BbvI |EcoRII |HaeIII |BssKI |CviJI SecI* G Q I Q S A A H N G F S S S S D D D V S A K F K A L H T T G F P H L Q M T M L A P N S K R C T Q R V F L I F R * R C * Q ----:----|----:----|----:----|----:----|----:----|----:----| P W I * L A A C L P N E E D E S S S T L L G F E F R Q V C R T K R M K L H R H * A L N L A S C V V P K G * R * I V I N A Ksp632I* | BbvI BlsI | |BdaI \ \ \\ AGCGAAAGTGAAGAAGAGTGA 2050 2060 ----:----|----:----|- TCGCTTTCACTTCTTCTCACT // // / |TseI || BbvI BisI |Ksp632I* BdaI S E S E E E * A K V K K S X R K * R R V X ----:----|----:----|- L S L S S S H C R F H L L T A F T F F L S # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 2 FblI,XmiI AciI 8 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AhaIII* 1 DraI AlfI 2 AluI 4 AluBI AlwNI 1 CaiI ApoI 4 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 7 BceAI 2 BdaI 3 BetI* 4 BsaWI BfiI 2 BmrI,BmuI BglI 2 BglII 1 BinI* 4 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmgT120I 2 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 11 BstF5I,BtsCI BseMII 3 BseRI 3 BseSI 1 BaeGI,BstSLI BsgI 1 BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 3 BspMI 1 BfuAI,Acc36I,BveI BspMII* 2 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 2 BseMI,Bse3DI BsrI 9 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstAPI 1 BstKTI 7 BtgZI 1 BtrI 1 BmgBI,AjiI Cac8I 5 BstC8I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 3 CviJI 20 CviKI-1 CviRI* 5 HpyCH4V DdeI 8 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 7 MalI DraII 1 EcoO109I EciI 2 Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 3 AcuI Eco57MI 4 EcoP15I 3 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 4 FatI 3 FauI 3 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 11 GlaI 5 GsuI 1 BpmI HaeII 4 BstH2I HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 5 BstHHI,CfoI,AspLEI Hin4I 9 Hin4II* 8 HpyAV Hin6I 5 HinP1I,HspAI HindII 2 HincII HindIII 1 HinfI 7 HpaI 1 KspAI HpaII 4 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 11 Hpy99I 2 KasI 1 KpnI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 2 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 12 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 2 SchI MnlI 23 MseI 11 Tru1I,Tru9I MwoI 9 HpyF10VI,BstMWI NarI 1 Mly113I NdeI 2 FauNDI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 8 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 2 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PpiI 1 PpuMI 1 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PsiI 1 AanI PvuI 1 MvrI,Ple19I,BpvUI RsaI 4 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 19 SfaNI 6 LweI SfeI* 2 BstSFI,SfcI,BfmI SspI 1 StuI 2 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 6 TaqI 10 TaqII 1 TatI 1 TauI 2 TfiI 5 PfeI TseI 2 ApeKI TsoI 3 Tsp45I 1 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 13 TspEI 15 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI TstI 1 XbaI 1 XcmI 2 XhoII 2 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AflII AgeI AjuI AloI ApaI ApaLI AscI AvaI AvrII BaeI BarI BbvCI Bce83I* BcgI BciVI BclI BmeT110I BmtI BplI BsaXI BsePI BseYI BsiI* BsmI Bsp120I BspHI BspLU11I* BspOI BsrBI BssNAI Bst1107I BstEII BstXI BstZ17I BtsI CauII* Cfr10I Cfr9I CspCI DraIII DrdI DsaI* Eam1105I Ecl136II EcoICRI EcoNI EcoRI FseI FspAI GsaI HgaI HgiAI* MauBI MluI MmeI MroNI MslI MstI* NaeI NcoI NgoMIV NheI NmeAIII NotI NruI NspBII* OliI PacI PasI PfoI PmeI PspOMI PspXI PsrI PstI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TspMI Tth111I VspI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769