Restriction Map of OPI9/YLR338W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

OPI9/YLR338W on chromosome XII from coordinates 804346 to 805203.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.7105

MmeI | HinfI | | BssKI | | EcoRII | | | ScrFI | | | BseBI | | | | PleI | | | | CviJI | | | | HaeIII | | | | |MlyI | | | | ||MfeI | | | | ||TspEI MnlI | | | | ||| PflMI AluI | | | | ||| BsiYI* CviJI | | | | ||| | MnlI | SetI \ \ \ \ \\\ \ \ \ \ ATGTTTTTTGAGTCCAGGCCAATTGTTGGAGTTGGGGGAGGGGGTGGAGCTTGTGGAGGG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAAAAACTCAGGTCCGGTTAACAACCTCAACCCCCTCCCCCACCTCGAACACCTCCC / / / // / / / /// MmeI | | || | TspEI MnlI ||CviJI | | || | MfeI ||AluI | | || BsiYI* |MnlI | | || PflMI SetI | | |PleI | | |MlyI | | EcoRII | | HaeIII | | BssKI | | CviJI | BseBI | ScrFI HinfI M F F E S R P I V G V G G G G G A C G G C F L S P G Q L L E L G E G V E L V E G V F * V Q A N C W S W G R G W S L W R V ----:----|----:----|----:----|----:----|----:----|----:----| X N K S D L G I T P T P P P P P A Q P P X T K Q T W A L Q Q L Q P L P H L K H L H K K L G P W N N S N P S P T S S T S P FatI AflIII BspLU11I* |CviAII || NspI Eco57I || NlaIII Eco57MI || | Esp3I | Ksp632I* || | BsmAI Hin4II* HgaI | |MaeI \\ \ \ \ \ \ \\ TTGCTAACATGTGTTGGCAGAGACGCTGAAGGCAAAGGGGGTGCTGACACACTAGGAAGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AACGATTGTACACAACCGTCTCTGCGACTTCCGTTTCCCCCACGACTGTGTGATCCTTCT / // / / / / / | || | Hin4II* HgaI Eco57MI Ksp632I* | || BsmAI Eco57I MaeI | || Esp3I | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI L L T C V G R D A E G K G G A D T L G R C * H V L A E T L K A K G V L T H * E E A N M C W Q R R * R Q R G C * H T R K R ----:----|----:----|----:----|----:----|----:----|----:----| N S V H T P L S A S P L P P A S V S P L T A L M H Q C L R Q L C L P H Q C V L F Q * C T N A S V S F A F P T S V C * S S SspI | MboII Cac8I | | AluI | CviJI | | CviJI | HaeIII NdeI | | | SetI CviJI | | Hin4II* | AciI \ \ \ \ \ \ \ \ \ \ GAAATATTAGAGCTTTTTCTTTGGTGGCTTCTGTGTGCTGGCCTTACTGAAGGCATATGC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTATAATCTCGAAAAAGAAACCACCGAAGACACACGACCGGAATGACTTCCGTATACG / / / / / / // / | | | CviJI CviJI | |Hin4II* NdeI | | | AluI | HaeIII | | SetI | CviJI | MboII Cac8I SspI E I L E L F L W W L L C A G L T E G I C K Y * S F F F G G F C V L A L L K A Y A N I R A F S L V A S V C W P Y * R H M R ----:----|----:----|----:----|----:----|----:----|----:----| S I N S S K R Q H S R H A P R V S P M H L F I L A K E K T A E T H Q G * Q L C I F Y * L K K K P P K Q T S A K S F A Y A Eco57I Eco57MI | AciI | | Acc65I | | HgiCI* | | |Csp6I | | ||RsaI | | ||NlaIV HgiCI* | | ||| KpnI | NlaIV | | ||| | SetI | | SetI | | ||| | | MnlI | | | BsiYI* AciI BccI \ \ \\\ \ \ \ \ \ \ \ \ \ GGTCTATTTTGCGGTACCTTTGGAGCAGAGGCACCTGATAATGGAAGCGGTGGTGCTGGA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGATAAAACGCCATGGAAACCTCGTCTCCGTGGACTATTACCTTCGCCACCACGACCT / / / /// / / / / / / AciI | | ||| MnlI | | BsiYI* AciI BccI | | ||HgiCI* | HgiCI* | | ||Acc65I NlaIV | | |Csp6I SetI | | NlaIV | | RsaI | | SetI | KpnI | AciI Eco57MI Eco57I G L F C G T F G A E A P D N G S G G A G V Y F A V P L E Q R H L I M E A V V L E S I L R Y L W S R G T * * W K R W C W R ----:----|----:----|----:----|----:----|----:----|----:----| P R N Q P V K P A S A G S L P L P P A P R D I K R Y R Q L L P V Q Y H F R H H Q T * K A T G K S C L C R I I S A T T S S AsuI* |NlaIV |BmgT120I ||Hin4I ||Hin4I ||CviJI ||HaeIII |||AciI |||BisI MboII MnlI ||||BlsI |Hpy178III* SetI Csp6I |GsuI |||||BccI || MnlI Hin4I |RsaI |Eco57MI |||||TauI || |TspEI Hin4I \\ \\ \\\\\\ \\ \\ \ GATGATGGTACAATGGGAATAGGAGGGGCCGCAGAAGATGGAATATCAGGAATTGGAGGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTACCATGTTACCCTTATCCTCCCCGGCGTCTTCTACCTTATAGTCCTTAACCTCCA // / / ////// / // /// || Eco57MI | |||||BccI | || ||SetI || GsuI | ||||AciI | || |Hin4I || MnlI | |||BisI | || |Hin4I |Csp6I | ||AsuI* | || TspEI RsaI | ||BlsI | |Hpy178III* | |BmgT120I | MnlI | |HaeIII MboII | |CviJI | |TauI | NlaIV Hin4I Hin4I D D G T M G I G G A A E D G I S G I G G M M V Q W E * E G P Q K M E Y Q E L E V * W Y N G N R R G R R R W N I R N W R C ----:----|----:----|----:----|----:----|----:----|----:----| S S P V I P I P P A A S S P I D P I P P L H H Y L P F L L P R L L H F I L F Q L I I T C H S Y S P G C F I S Y * S N S T BbvII* | MboII | | MaeI CviRI* | | |BsgI AciI HphI | MnlI | | ||FauI NspBII* CviRI* \ \ \ \ \\\ \ \ GCAGAAGACGAGGGAATACTAGGAACAGCGGGTGCTGGTGATAATGGTGCATTAGGAATG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTTCTGCTCCCTTATGATCCTTGTCGCCCACGACCACTATTACCACGTAATCCTTAC // / / / / / / // |MnlI | | | FauI | AciI |CviRI* CviRI* | | MaeI NspBII* HphI | BsgI BbvII* MboII A E D E G I L G T A G A G D N G A L G M Q K T R E Y * E Q R V L V I M V H * E W R R R G N T R N S G C W * * W C I R N G ----:----|----:----|----:----|----:----|----:----|----:----| A S S S P I S P V A P A P S L P A N P I H L L R P F V L F L P H Q H Y H H M L F C F V L S Y * S C R T S T I I T C * S H HgiCI* | NlaIV | | AciI | | | Hin6I | | | FnuDII* | | | |GlaI | | | ||HhaI NlaIV | | | ||BssKI |CviJI | | | ||| HpaII Hin6I ||AciI | | | ||| ScrFI |GlaI ||BisI | | | ||| CauII* ||HhaI |||BlsI | | | ||| | TspEI |||BccI ||||BccI | | | ||| | | BsiYI* ||||Cac8I ||||TauI | | | ||| | | | AciI ||||| MnlI \\\\\ \ \ \ \\\ \ \ \ \ \\\\\ \ GGGGGAGCCGCAACAGATGGCACCGCGCCCGGAATTGGCGGTGCGCTCGCCGATGGAGAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CCCCCTCGGCGTTGTCTACCGTGGCGCGGGCCTTAACCGCCACGCGAGCGGCTACCTCTC ////// / / /// /// / / /// / / |||||BccI | | ||| ||| | | ||| | MnlI ||||AciI | | ||| ||| | | ||| Cac8I |||BisI | | ||| ||| | | ||| BccI ||BlsI | | ||| ||| | | ||Hin6I |CviJI | | ||| ||| | | |GlaI |TauI | | ||| ||| | | HhaI NlaIV | | ||| ||| | AciI | | ||| ||| TspEI | | ||| ||BssKI | | ||| |BsiYI* | | ||| |HpaII | | ||| CauII* | | ||| ScrFI | | ||Hin6I | | |GlaI | | FnuDII* | | AciI | | HhaI | HgiCI* NlaIV G G A A T D G T A P G I G G A L A D G E G E P Q Q M A P R P E L A V R S P M E R G S R N R W H R A R N W R C A R R W R G ----:----|----:----|----:----|----:----|----:----|----:----| P P A A V S P V A G P I P P A S A S P S P P L R L L H C R A R F Q R H A R R H L P S G C C I A G R G S N A T R E G I S L AccI |BssNAI |Hpy166II || SetI || | AluI GsuI || | CviJI Cac8I MseI || | | SetI | CviRI* Eco57MI || | | | MnlI \ \ \ \\ \ \ \ \ GGTTTAGTGCTTGCATTGTTATTGATATGTTTTAACTTCGGTATACCTCCAGCTAAAATA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAATCACGAACGTAACAATAACTATACAAAATTGAAGCCATATGGAGGTCGATTTTAT / / / / // / / / / | CviRI* | MseI |AccI | | MnlI Hin4I Cac8I Eco57MI |SetI | CviJI GsuI | | AluI | SetI Hpy166II BssNAI G L V L A L L L I C F N F G I P P A K I V * C L H C Y * Y V L T S V Y L Q L K Y F S A C I V I D M F * L R Y T S S * N I ----:----|----:----|----:----|----:----|----:----|----:----| P K T S A N N N I H K L K P I G G A L I P N L A Q M T I S I N * S R Y V E L * F T * H K C Q * Q Y T K V E T Y R W S F Y Hin4I | FokI | | BsiYI* | | | Hin6I | | | |GlaI | | | ||HhaI | | | |||HaeII | | | ||||BseGI | | | ||||| BssKI | | | ||||| SecI* | | | ||||| EcoRII | | | ||||| |PasI | | | ||||| |SecI* | | | ||||| |BsiYI* | | | ||||| ||ScrFI | | | ||||| ||BseBI | | | ||||| ||BsiYI* | | | ||||| ||| MnlI | | | ||||| ||| BccI | | | ||||| ||| | PflMI BseRI | | | ||||| ||| | BsiYI* | AsuI* | | | ||||| ||| | | Hin4I | AvaII | | | ||||| ||| | | | AluI | DraII | | | ||||| ||| | | | CviJI | PpuMI | | | ||||| ||| | | | | MnlI | |NlaIV | | |AciI ||||| ||| | | | | SetI | |BmgT120I \ \ \\ \\\\\ \\\ \ \ \ \ \ \ \\ TCGCCCAACTGCGGAGCGCCCATCCCAGGGATTGGAGGAGCTGACATAGAGGGTCCTTTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGCGGGTTGACGCCTCGCGGGTAGGGTCCCTAACCTCCTCGACTGTATCTCCCAGGAAAT / / / //// // /// / / // / /// / | | | |||| || ||| Hin4I | |MnlI | ||| BarI | | | |||| || ||EcoRII | CviJI | ||PpuMI | | | |||| || ||BssKI | AluI | ||DraII | | | |||| || ||SecI* SetI | ||AvaII | | | |||| || ||BccI | ||AsuI* | | | |||| || |BsiYI* | |BmgT120I | | | |||| || |SecI* | NlaIV | | | |||| || |PflMI BseRI | | | |||| || |PasI | | | |||| || BseBI | | | |||| || ScrFI | | | |||| || MnlI | | | |||| |BsiYI* | | | |||| BsiYI* | | | |||Hin6I | | | |||BseGI | | | ||GlaI | | | |HhaI | | | HaeII | | AciI | FokI BsiYI* S P N C G A P I P G I G G A D I E G P L R P T A E R P S Q G L E E L T * R V L Y A Q L R S A H P R D W R S * H R G S F T ----:----|----:----|----:----|----:----|----:----|----:----| D G L Q P A G M G P I P P A S M S P G K I A W S R L A W G L S Q L L Q C L P D K R G V A S R G D W P N S S S V Y L T R * Acc65I HgiCI* Tsp4CI* |Csp6I ||RsaI ||NlaIV ||| KpnI ||| |BseMII ||| ||BspCNI ||| ||| MnlI ||| ||| | Hpy178III* ||| ||| | |DdeI ||| ||| | |SauI* ||| ||| | || CviJI ||| ||| | || HaeIII BsiYI* ||| ||| | || | BsaXI |MnlI ||| ||| | || | Hin4I TspDTI |BsiYI* BarI ||| ||| | || | | BarI |SetI || BsaXI \ \\\ \\\ \ \\ \ \ \ \\ \\ \ CTACTGACGGTACCAGAACTTCCTGAGGCCGATGAAACGACACCACCTCCCACGATTGGG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GATGACTGCCATGGTCTTGAAGGACTCCGGCTACTTTGCTGTGGTGGAGGGTGCTAACCC // /// / ////// // // / / / || ||| MnlI |||||BarI |TspDTI || | | BseSI || ||HgiCI* ||||HaeIII SetI || | | SduI || ||Acc65I ||||CviJI || | Hin4I || ||BspCNI |||BsaXI || | BsaXI || |BseMII ||SauI* || MnlI || |Csp6I ||DdeI |BsiYI* || NlaIV |Hin4I BsiYI* || RsaI Hpy178III* |KpnI Tsp4CI* L L T V P E L P E A D E T T P P P T I G Y * R Y Q N F L R P M K R H H L P R L G T D G T R T S * G R * N D T T S H D W G ----:----|----:----|----:----|----:----|----:----|----:----| S S V T G S S G S A S S V V G G G V I P V V S P V L V E Q P R H F S V V E W S Q * Q R Y W F K R L G I F R C W R G R N P DdeI | BsmAI | Eco31I | |AluI MaeIII Hin4I | |CviJI Tsp45I |SduI | || SetI BspCNI | HgaI |BseSI | || TspDTI |BseMII HphI | | SetI \\ \ \\ \ \\ \ \ \ \ GCACTTCTATCATTGGTCTCAGCTTTCTTTAGTTTCATTCCCTTTCTAATGTCACCTAAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGAAGATAGTAACCAGAGTCGAAAGAAATCAAAGTAAGGGAAAGATTACAGTGGATTG /// / // / / / / ||| | |BseMII HphI | | HgaI ||| | BspCNI | Tsp45I ||| Eco31I | MaeIII ||| BsmAI SetI ||TspDTI ||CviJI ||AluI |DdeI SetI A L L S L V S A F F S F I P F L M S P N H F Y H W S Q L S L V S F P F * C H L T T S I I G L S F L * F H S L S N V T * Q ----:----|----:----|----:----|----:----|----:----|----:----| A S R D N T E A K K L K M G K R I D G L P V E I M P R L K R * N * E R E L T V * C K * * Q D * S E K T E N G K * H * R V AcyI |MaeIII |Tsp45I || AsuI* || |CviJI BceAI || |HaeIII |SfaNI SetI || |BmgT120I || Cfr10I SduI | MnlI || || CviRI* || |HpaII HgiAI* | BsiYI* \\ \\ \ \\ \\ \ \ \ AGGGCGTCACGGCCCTGCATCACAGATTTTGCCGGTTTAGGAGCACTACCACCTAATGCT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCGCAGTGCCGGGACGTAGTGTCTAAAACGGCCAAATCCTCGTGATGGTGGATTACGA / / /// / / / // / / / / | | ||| CviRI* | | || HgiAI* SetI | MnlI | | ||AsuI* | | || SduI BsiYI* | | |BmgT120I | | |Cfr10I | | HaeIII | | HpaII | | CviJI | SfaNI | Tsp45I BceAI | MaeIII AcyI R A S R P C I T D F A G L G A L P P N A G R H G P A S Q I L P V * E H Y H L M L G V T A L H H R F C R F R S T T T * C W ----:----|----:----|----:----|----:----|----:----|----:----| L A D R G Q M V S K A P K P A S G G L A C P T V A R C * L N Q R N L L V V V * H P R * P G A D C I K G T * S C * W R I S AluI CviJI | SetI | | BseRI | | | BseRI AarI MnlI | | | |SduI BspMI |AciI | | | |HgiAI* | GsuI || MnlI | | | || BseRI | TspEI || | MnlI | | | || |SetI | Eco57MI \\ \ \ \ \ \ \\ \\ \ \ GGTGGAGGCGGTGGAGGAGGAGGAGCTGGAGCACCTGCCATTTCAACAATTCGTTATATA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCTCCGCCACCTCCTCCTCCTCGACCTCGTGGACGGTAAAGTTGTTAAGCAATATAT / // / / / / // // // / | || MnlI | | | || |BseRI || TspEI | |AciI | | | || SetI |BspMI | MnlI | | | |BseRI |AarI MnlI | | | HgiAI* Eco57MI | | | SduI GsuI | | BseRI | CviJI | AluI SetI G G G G G G G G A G A P A I S T I R Y I V E A V E E E E L E H L P F Q Q F V I Y W R R W R R R S W S T C H F N N S L Y I ----:----|----:----|----:----|----:----|----:----|----:----| P P P P P P P P A P A G A M E V I R * I Q H L R H L L L L Q L V Q W K L L E N Y T S A T S S S S S S C R G N * C N T I Y Tsp4CI* | Hin6I MboII | |GlaI | CviJI | ||HhaI BsmAI \ \ \ \\\ \ TATGGTAGGCTTCTTCAACAAACGGTTGTGCGCTTTTTAGTCGTATGCTTTGTCTCATAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ATACCATCCGAAGAAGTTGTTTGCCAACACGCGAAAAATCAGCATACGAAACAGAGTATA / / / /// / MboII CviJI | ||Hin6I TspDTI | |GlaI | HhaI Tsp4CI* Y G R L L Q Q T V V R F L V V C F V S Y M V G F F N K R L C A F * S Y A L S H I W * A S S T N G C A L F S R M L C L I S ----:----|----:----|----:----|----:----|----:----|----:----| Y P L S R * C V T T R K K T T H K T E Y I H Y A E E V F P Q A S K L R I S Q R M I T P K K L L R N H A K * D Y A K D * I MboII TspDTI \ CAAAAACTTTCTTCATAA 850 ----:----|----:--- GTTTTTGAAAGAAGTATT / BsmAI MboII Q K L S S * K N F L H X K T F F I X ----:----|----:--- * F S E E Y D F V K K M L F K R * L # Enzymes that cut Frequency Isoschizomers AarI 1 Acc65I 2 Asp718I AccI 1 FblI,XmiI AciI 10 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AluI 6 AluBI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BarI 1 BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 5 BceAI 1 BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 3 BsaXI 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 2 BseRI 4 BseSI 1 BaeGI,BstSLI BsgI 1 BsiYI* 10 Bsc4I,BseLI,BslI,AfiI BsmAI 3 Alw26I,BstMAI BspCNI 2 BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BssKI 3 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 3 CviQI,RsaNI CviAII 1 CviJI 14 CviKI-1 CviRI* 4 HpyCH4V DdeI 2 BstDEI,HpyF3I DraII 1 EcoO109I Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 5 EcoRII 2 AjnI,Psp6I,PspGI Esp3I 1 BsmBI FatI 1 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GlaI 4 GsuI 3 BpmI HaeII 1 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 4 BanI,BshNI,BspT107I,AccB1I HhaI 4 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 2 HpyAV Hin6I 4 HinP1I,HspAI HinfI 1 HpaII 2 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 2 Hpy188III KpnI 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeIII 2 MboII 5 MfeI 1 MunI MlyI 1 SchI MmeI 1 MnlI 16 MseI 1 Tru1I,Tru9I NdeI 1 FauNDI NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 1 BstNSI,XceI PasI 1 PflMI 2 BasI,AccB7I,Van91I PleI 1 PpsI PpuMI 1 Psp5II,PspPPI RsaI 3 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 14 SfaNI 1 LweI SspI 1 TauI 2 Tsp45I 2 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 4 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI AclI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI AsuII AvaI AvrII BaeI BalI BamHI BbvCI BbvI Bce83I* BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsePI BseYI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspMII* BspOI BsrBI BsrDI BsrI BstAPI BstEII BstKTI BstXI BtgZI BtrI BtsI Cfr9I CfrI ClaI CspCI DinI DpnI DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI EspI* FalI FaqI FseI FspAI GsaI HgiJII* HindII HindIII HpaI Hpy188I Hpy99I KasI MaeII MauBI MboI McrI* MluI Mph1103I MroNI MslI MstI* MwoI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI ScaI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaiI TaqI TaqII TatI TfiI TseI TsoI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769