Restriction Map of CDC25/YLR310C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CDC25/YLR310C on chromosome XII from coordinates 756993 to 752224.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.8818

EMBOSS_001 AflIII | MaeII TstI Cac8I | |BtrI |MnlI | MwoI TstI | || SetI ||CviRI* | BstAPI Hpy188I | || TaiI ||| MwoI | | BsrDI \ \ \\ \ \\\ \ \ \ \ ATGTCCGATACTAACACGTCTATTCCCAATACAAGTTCTGCAAGGGAGGCAGGCAATGCT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGGCTATGATTGTGCAGATAAGGGTTATGTTCAAGACGTTCCCTCCGTCCGTTACGA / / / // / / / / // / | Hpy188I | |AflIII TstI | | MwoI || BsrDI TstI | |MaeII | CviRI* |BstAPI | BtrI MnlI |MwoI TaiI Cac8I SetI M S D T N T S I P N T S S A R E A G N A C P I L T R L F P I Q V L Q G R Q A M L V R Y * H V Y S Q Y K F C K G G R Q C F ----:----|----:----|----:----|----:----|----:----|----:----| X D S V L V D I G L V L E A L S A P L A X T R Y * C T * E W Y L N Q L P P L C H H G I S V R R N G I C T R C P L C A I S TaqI ClaI |MboI |MboII |TspDTI || DpnI || |BstKTI || ||BccI || ||| AluI TfiI || ||| CviJI SapI HinfI || ||| | SetI Ksp632I* FokI | BseGI \\ \\\ \ \ \ \ \ \ TCACAAACTCCATCGATCAGCTCTTCATCTAACACTTCCACTACCACTAACACAGAATCA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGTTTGAGGTAGCTAGTCGAGAAGTAGATTGTGAAGGTGATGGTGATTGTGTCTTAGT // // /// / / / / || || ||CviJI Ksp632I* FokI | HinfI || || ||AluI SapI | TfiI || || |BccI BseGI || || MboI || || SetI || |DpnI || BstKTI || ClaI || TaqI |MboII TspDTI S Q T P S I S S S S N T S T T T N T E S H K L H R S A L H L T L P L P L T Q N H T N S I D Q L F I * H F H Y H * H R I I ----:----|----:----|----:----|----:----|----:----|----:----| E C V G D I L E E D L V E V V V L V S D K V F E M S * S K M * C K W * W * C L I * L S W R D A R * R V S G S G S V C F * DdeI BbvCI Bpu10I | AluI | CviJI | |MboII | ||SetI | ||| MboII | ||| |MnlI HindII MfeI | ||| || BspCNI Hpy166II TspEI | ||| || |BseMII TaqI MnlI | BsmI | BbvI \ \\\ \\ \\ \ \ \ \ \ \ TCCTCAGCTTCTCTTTCTTCTTCCCCCTCGACAAGTGAGTTGACCAGCATTCGTCCAATT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAGTCGAAGAGAAAGAAGAAGGGGGAGCTGTTCACTCAACTGGTCGTAAGCAGGTTAA /// // // / / / / / ||| || |BseMII TaqI MnlI | BsmI TspEI ||| || BspCNI Hpy166II MfeI ||| |MnlI HindII ||| MboII ||CviJI ||MboII ||AluI |Bpu10I |BbvCI |DdeI SetI S S A S L S S S P S T S E L T S I R P I P Q L L F L L P P R Q V S * P A F V Q L L S F S F F F P L D K * V D Q H S S N W ----:----|----:----|----:----|----:----|----:----|----:----| D E A E R E E E G E V L S N V L M R G I M R L K E K K K G R S L H T S W C E D L G * S R K R R G G R C T L Q G A N T W N TseI |BisI MseI MboII ||BlsI |TspEI MseI | Tsp4CI* \\\ \\ \ \ \ GGAATAGTAGTCGCTGCTTATGACTTTAATTATCCCATTAAAAAAGACAGTTCTTCGCAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTATCATCAGCGACGAATACTGAAATTAATAGGGTAATTTTTTCTGTCAAGAAGCGTT / /// / / / / / BbvI ||TseI | TspEI | | Tsp4CI* |BisI MseI | MboII BlsI MseI G I V V A A Y D F N Y P I K K D S S S Q E * * S L L M T L I I P L K K T V L R N N S S R C L * L * L S H * K R Q F F A T ----:----|----:----|----:----|----:----|----:----|----:----| P I T T A A * S K L * G M L F S L E E C Q F L L R Q K H S * N D W * F L C N K A S Y Y D S S I V K I I G N F F V T R R L TatI Bsp1407I |Csp6I MslI ||RsaI MseI TaqII | BccI \\\ \ \ \ \ CTTTTGTCTGTACAACAAGGGGAAACCATTTATATACTTAACAAAAACTCATCTGGGTGG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAACAGACATGTTGTTCCCCTTTGGTAAATATATGAATTGTTTTTGAGTAGACCCACC /// / / / / ||Bsp1407I | TaqII MslI BccI ||TatI MseI |Csp6I RsaI L L S V Q Q G E T I Y I L N K N S S G W F C L Y N K G K P F I Y L T K T H L G G F V C T T R G N H L Y T * Q K L I W V V ----:----|----:----|----:----|----:----|----:----|----:----| S K D T C C P S V M * I S L L F E D P H V K T Q V V L P F W K Y V * C F S M Q T K Q R Y L L P F G N I Y K V F V * R P P MnlI |MseI ||HpaI ||HindII ||Hpy166II ||| CviJI BseGI FokI Tsp4CI* ||| AlwNI \ \ \ \\\ \ TGGGATGGATTAGTTATTGACGACAGTAATGGGAAAGTTAACAGAGGCTGGTTTCCTCAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCTACCTAATCAATAACTGCTGTCATTACCCTTTCAATTGTCTCCGACCAAAGGAGTT / / / / // / / BseGI | Tsp4CI* | || | CviJI FokI | || AlwNI | |MseI | Hpy166II | HindII | HpaI MnlI W D G L V I D D S N G K V N R G W F P Q G M D * L L T T V M G K L T E A G F L K G W I S Y * R Q * W E S * Q R L V S S K ----:----|----:----|----:----|----:----|----:----|----:----| H S P N T I S S L L P F T L L P Q N G * T P H I L * Q R C Y H S L * C L S T E E P I S * N N V V T I P F N V S A P K R L MnlI | AccI Tsp4CI* | |Hpy166II Tsp4CI* |BspCNI | || BsmAI | DdeI ||BseGI | || |SetI | |FokI ||BseMII | || ||MseI | || Hpy188I ||| Hpy188I \ \\ \\\ \ \\ \ \\\ \ AACTTCGGTAGACCTTTAAGAGACAGTCATCTCAGAAAGCACAGTCATCCGATGAAAAAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAAGCCATCTGGAAATTCTCTGTCAGTAGAGTCTTTCGTGTCAGTAGGCTACTTTTTT / // / / // / // / MnlI |AccI BsmAI Tsp4CI* || FokI || Hpy188I |SetI MseI |DdeI |BseMII Hpy166II Hpy188I |BseGI Tsp4CI* BspCNI N F G R P L R D S H L R K H S H P M K K T S V D L * E T V I S E S T V I R * K N L R * T F K R Q S S Q K A Q S S D E K I ----:----|----:----|----:----|----:----|----:----|----:----| F K P L G K L S L * R L F C L * G I F F F S R Y V K L L C D D * F A C D D S S F V E T S R * S V T M E S L V T M R H F F AluI CviJI Ecl136II |SmlI ||SetI ||SduI ||SacI ||HgiAI* ||HgiJII* ||| MwoI ||| |Hin6I ||| ||GlaI ||| |||TseI ||| |||HhaI ||| ||||BisI ||| |||||BlsI ||| ||||||TseI ||| |||||||BisI ||| ||||||||BlsI ||| |||||||||AluI ||| |||||||||CviJI ||| |||||||||| MseI ||| |||||||||| SetI ||| |||||||||| | MwoI ||| |||||||||| | BbvI ||| |||||||||| | | AluI Bce83I* ||| |||||||||| | | BbvI | TspDTI ||| |||||||||| | | CviJI CviRI* | |BsrI ||| |||||||||| | | | SetI | EcoP15I \ \\ \\\ \\\\\\\\\\ \ \ \ \ \ \ TATAGTTCCAGTAAGAGCTCAAGGCGCAGCAGCTTAAATAGCTTGGGCAATAGTGCATAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ATATCAAGGTCATTCTCGAGTTCCGCGTCGTCGAATTTATCGAACCCGTTATCACGTATA / // / / / / ///////// // / // / / / | |BsrI | | | | ||||||||| || | || BbvI | EcoP15I | TspDTI | | | | ||||||||| || | |BbvI CviRI* Bce83I* | | | | ||||||||| || | CviJI | | | | ||||||||| || | AluI | | | | ||||||||| || SetI | | | | ||||||||| |MseI | | | | ||||||||| MwoI | | | | ||||||||CviJI | | | | ||||||||TseI | | | | ||||||||AluI | | | | |||||||BisI | | | | ||||||BlsI | | | | ||||||SetI | | | | |||||TseI | | | | ||||BisI | | | | |||BlsI | | | | ||Hin6I | | | | |GlaI | | | | HhaI | | | SmlI | | MwoI | Ecl136II | CviJI | AluI HgiJII* HgiAI* SacI SduI SetI Y S S S K S S R R S S L N S L G N S A Y I V P V R A Q G A A A * I A W A I V H I * F Q * E L K A Q Q L K * L G Q * C I F ----:----|----:----|----:----|----:----|----:----|----:----| Y L E L L L E L R L L K F L K P L L A Y I Y N W Y S S L A C C S L Y S P C Y H M I T G T L A * P A A A * I A Q A I T C I FatI AflIII BspLU11I* Hpy188I |CviAII | AloI || NspI | PpiI BsaXI || NlaIII | BsaXI | AloI || | MaeI | | MnlI HgaI | PpiI \\ \ \ \ \ \ \ \ \ TTACATGTGCCTAGAAATCCGAGCAAGAGCAGGAGGGGGAGTTCTACTTTATCAGCGTCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTACACGGATCTTTAGGCTCGTTCTCGTCCTCCCCCTCAAGATGAAATAGTCGCAGA / // / / / / / / | || MaeI | | MnlI | BsaXI | |BspLU11I* | BsaXI | PpiI | |AflIII Hpy188I | AloI | |FatI PpiI HgaI | CviAII AloI NlaIII NspI L H V P R N P S K S R R G S S T L S A S Y M C L E I R A R A G G G V L L Y Q R L T C A * K S E Q E Q E G E F Y F I S V F ----:----|----:----|----:----|----:----|----:----|----:----| K C T G L F G L L L L L P L E V K D A D N V H A * F D S C S C S P S N * K I L T * M H R S I R A L A P P P T R S * * R R HpaII |CfrI Tsp4CI* MwoI || CviJI | TaqI | CviRI* || HaeIII | ClaI TspEI \ \ \\ \ \ \ \ TTATCAAATGCCCACAATGCAGAAACAAGTTCCGGCCACAATAACACCGTATCGATGAAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGTTTACGGGTGTTACGTCTTTGTTCAAGGCCGGTGTTATTGTGGCATAGCTACTTA / / // / / / MwoI CviRI* || CfrI | ClaI |HaeIII | TaqI |CviJI Tsp4CI* HpaII L S N A H N A E T S S G H N N T V S M N Y Q M P T M Q K Q V P A T I T P Y R * I I K C P Q C R N K F R P Q * H R I D E * ----:----|----:----|----:----|----:----|----:----|----:----| K D F A W L A S V L E P W L L V T D I F K I L H G C H L F L N R G C Y C R I S S * * I G V I C F C T G A V I V G Y R H I TspDTI | AjuI | | SfaNI | | |Hin6I | | ||GlaI MboII TaqI | | |||HhaI | AjuI AsuII MseI | | ||||HaeII | | AloI |MnlI |TspEI \ \ \\\\\ \ \ \ \\ \\ AATTCTCCCTTTTCAGCGCCAAACGATGCTTCCCACATAACCCCTCAATCTTCGAACTTT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGAGGGAAAAGTCGCGGTTTGCTACGAAGGGTGTATTGGGGAGTTAGAAGCTTGAAA / // ///// /// / / | |TspDTI ||||SfaNI ||AloI | AsuII | AjuI |||Hin6I |MboII | TaqI TspEI ||GlaI AjuI MnlI |HhaI HaeII N S P F S A P N D A S H I T P Q S S N F I L P F Q R Q T M L P T * P L N L R T L F S L F S A K R C F P H N P S I F E L * ----:----|----:----|----:----|----:----|----:----|----:----| L E G K E A G F S A E W M V G * D E F K Y N E R K L A L R H K G C L G E I K S S I R G K * R W V I S G V Y G R L R R V K Hin4I AloI Hin4I | BssKI | BccI | SecI* | | CviRI* | EcoRII | | | BseMII DdeI | | ScrFI | | | |BspCNI |Hpy188I MaeI | | BseBI | | | || CviJI || BsgI \ \ \ \ \ \ \ \\ \ \\ \ AATTCCAATGCTAGTCTATCCCAGGATATGACAAAGAGTGCAGATGGCTCATCTGAGATG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGGTTACGATCAGATAGGGTCCTATACTGTTTCTCACGTCTACCGAGTAGACTCTAC / / / /// / / / // / / // | TspEI AloI ||| Hin4I | | || CviJI | |BsgI MseI MaeI ||| Hin4I | | |BspCNI | DdeI ||EcoRII | | BseMII Hpy188I ||BssKI | CviRI* |SecI* BccI BseBI ScrFI N S N A S L S Q D M T K S A D G S S E M I P M L V Y P R I * Q R V Q M A H L R * F Q C * S I P G Y D K E C R W L I * D E ----:----|----:----|----:----|----:----|----:----|----:----| L E L A L R D W S I V F L A S P E D S I * N W H * D I G P Y S L S H L H S M Q S I G I S T * G L I H C L T C I A * R L H Hin4I Hin4I TspDTI TspDTI | TspEI | ApoI | BslFI | | TspDTI | TspEI | | BspMI \ \ \ \ \ \ \ \ AATACAAACGCAATTATGAATAACAATGAAACAAATTTACAAACTTCTGGTGAGAAAGCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGTTTGCGTTAATACTTATTGTTACTTTGTTTAAATGTTTGAAGACCACTCTTTCGT / / / / / / / / // Hin4I | TspEI TspDTI | TspDTI | BspMI |HphI Hin4I TspDTI TspEI BslFI SetI ApoI N T N A I M N N N E T N L Q T S G E K A I Q T Q L * I T M K Q I Y K L L V R K Q Y K R N Y E * Q * N K F T N F W * E S R ----:----|----:----|----:----|----:----|----:----|----:----| F V F A I I F L L S V F K C V E P S F A S Y L R L * S Y C H F L N V F K Q H S L I C V C N H I V I F C I * L S R T L F C HphI AsuI* AvaII DraII PpuMI MmeI |BmgT120I | TspEI ||SetI SpeI | | MseI Tsp4CI* ||NlaIV |MaeI | | | MboII Ksp632I* MboII \\\ \\ \ \ \ \ \ \ GGTCCCCCACTAGTAGCAGAAGAAACAATTAAGATATTACCGTTGGAAGAGATAGAAATG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGGGGGTGATCATCGTCTTCTTTGTTAATTCTATAATGGCAACCTTCTCTATCTTTAC // // / // / / / |PpuMI |SpeI MmeI |MseI | Ksp632I* MboII |DraII MaeI MboII Tsp4CI* |AvaII TspEI |AsuI* BmgT120I NlaIV G P P L V A E E T I K I L P L E E I E M V P H * * Q K K Q L R Y Y R W K R * K * S P T S S R R N N * D I T V G R D R N D ----:----|----:----|----:----|----:----|----:----|----:----| P G G S T A S S V I L I N G N S S I S I L D G V L L L L F L * S I V T P L S L F T G W * Y C F F C N L Y * R Q F L Y F H AccI |BssNAI |Hpy166II || MaeII || | SetI || | TaiI Tth111I || | |TaqI | AsuI* || | |AsuII | AvaII MseI || | || BsrDI | |BmgT120I VspI || | || |BslFI TaqI | ||NlaIV FokI TspRI \ \\ \ \\ \\ \ \ \\\ \ \ ATTATTAATGGTATACGTTCGAACATTGCTTCGACTTGGTCCCCCATACCACTGATAACG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TAATAATTACCATATGCAAGCTTGTAACGAAGCTGAACCAGGGGGTATGGTGACTATTGC / // / / / / / // / / VspI || | AsuII | | | |AvaII TspRI FokI MseI || | BsrDI | | | |AsuI* || | TaqI | | | BmgT120I || MaeII | | | NlaIV |AccI | | Tth111I |TaiI | TaqI |SetI BslFI Hpy166II BssNAI I I N G I R S N I A S T W S P I P L I T L L M V Y V R T L L R L G P P Y H * * R Y * W Y T F E H C F D L V P H T T D N E ----:----|----:----|----:----|----:----|----:----|----:----| I I L P I R E F M A E V Q D G M G S I V S * * H Y V N S C Q K S K T G W V V S L N N I T Y T R V N S R S P G G Y W Q Y R AccI Tsp4CI* BseGI |BssNAI | Hpy188I | Hpy188I |Hpy166II SetI | |TspEI \ \ \\ \ \ \\ AAAACATCCGATTACAAGTTGGTATACTATAACAAAGACCTTGATATATACTGTTCAGAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGTAGGCTAATGTTCAACCATATGATATTGTTTCTGGAACTATATATGACAAGTCTT / / // / / / BseGI Hpy188I |AccI SetI | Hpy188I Hpy166II Tsp4CI* BssNAI K T S D Y K L V Y Y N K D L D I Y C S E K H P I T S W Y T I T K T L I Y T V Q N N I R L Q V G I L * Q R P * Y I L F R I ----:----|----:----|----:----|----:----|----:----|----:----| F V D S * L N T Y * L L S R S I Y Q E S S F M R N C T P I S Y C L G Q Y I S N L F C G I V L Q Y V I V F V K I Y V T * F TfiI MaeIII HinfI Tsp45I ApoI TspEI | Hpy188I |AloI TspEI \ \ \ \\ \ TTACCCTTGATTTCTAACTCAATTATGGAATCCGATGACATTTGTGACAGCGAACCAAAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AATGGGAACTAAAGATTGAGTTAATACCTTAGGCTACTGTAAACACTGTCGCTTGGTTTT / / // / / TspEI TspEI || AloI Tsp45I |Hpy188I MaeIII HinfI TfiI L P L I S N S I M E S D D I C D S E P K Y P * F L T Q L W N P M T F V T A N Q N T L D F * L N Y G I R * H L * Q R T K I ----:----|----:----|----:----|----:----|----:----|----:----| N G K I E L E I I S D S S M Q S L S G F I V R S K * S L * P I R H C K H C R V L * G Q N R V * N H F G I V N T V A F W F BseMII |MaeI |BspCNI || MnlI || |MboI FauI || |BglII |MboI MseI || |XhoII |BclI |HpaI || || DpnI || DpnI |HindII || || |BstKTI || |BstKTI |Hpy166II || || ||DdeI MnlI AciI || ||AloI || SetI || || |||Hpy188I | SspI \ \\ \\\ \\ \ \\ \\ \\\\ \ \ TTCCCGCCCAATGATCATCTTGTTAACCTATATACTAGAGATCTGAGGAAAAATGCGAAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGGCGGGTTACTAGTAGAACAATTGGATATATGATCTCTAGACTCCTTTTTACGCTTA / / / // / // // / // / / / / | AciI | || BclI |MseI || | || | DdeI | SspI TspEI | || MboI |SetI || | || Hpy188I MnlI ApoI | |DpnI | || | || XhoII | BstKTI | || | || BglII | FauI | || | || MboI AloI | || | |DpnI | || | BstKTI | || MaeI | || MnlI | |BspCNI | BseMII Hpy166II HindII HpaI F P P N D H L V N L Y T R D L R K N A N S R P M I I L L T Y I L E I * G K M R I P A Q * S S C * P I Y * R S E E K C E Y ----:----|----:----|----:----|----:----|----:----|----:----| N G G L S * R T L R Y V L S R L F F A F I G A W H D D Q * G I Y * L D S S F H S E R G I I M K N V * I S S I Q P F I R I MboI MboI | DpnI | DpnI | |TaqI Hpy188I | |BstKTI Tsp4CI* | |BstKTI | Hpy166II | || CviJI \ \ \\ \ \ \ \\ \ ATTGAGGACAGTTCTACGAGATCGAAGCAATCGGAAAGTGAACAAAATAGATCAAGCCTT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTCCTGTCAAGATGCTCTAGCTTCGTTAGCCTTTCACTTGTTTTATCTAGTTCGGAA / // // / / // / / / Tsp4CI* || |TaqI Hpy188I Hpy166II || | | BsiYI* || MboI || | CviJI |DpnI || MboI BstKTI |DpnI BstKTI I E D S S T R S K Q S E S E Q N R S S L L R T V L R D R S N R K V N K I D Q A F * G Q F Y E I E A I G K * T K * I K P S ----:----|----:----|----:----|----:----|----:----|----:----| I S S L E V L D F C D S L S C F L D L R Y Q P C N * S I S A I P F H V F Y I L G N L V T R R S R L L R F T F L I S * A K Tsp4CI* BsiYI* TfiI | MseI | Hin4II* HinfI BccI | VspI \ \ \ \ \ \ CTAATGGAAAAACAGGATTCAAAAGAAACTGATGGAAATAATAACAGTATTAATGATGAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GATTACCTTTTTGTCCTAAGTTTTCTTTGACTACCTTTATTATTGTCATAATTACTACTA / / / / / Hin4II* HinfI BccI | VspI TfiI | MseI Tsp4CI* L M E K Q D S K E T D G N N N S I N D D * W K N R I Q K K L M E I I T V L M M M N G K T G F K R N * W K * * Q Y * * * * ----:----|----:----|----:----|----:----|----:----|----:----| R I S F C S E F S V S P F L L L I L S S E L P F V P N L L F Q H F Y Y C Y * H H * H F F L I * F F S I S I I V T N I I I MseI TspDTI |GsuI ApoI | CviJI |Eco57MI TspEI | | AsuI* |Hin4II* EcoRI | | AvaII ||ApoI | MnlI | | |BmgT120I ||TspEI \ \ \ \ \\ \\\ GATAATAATAACGAAAATAACAAAAACGAATTCAATGAGGCTGGTCCTTCATCATTAAAT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTATTATTGCTTTTATTGTTTTTGCTTAAGTTACTCCGACCAGGAAGTAGTAATTTA / / / / // // / | | | | |AvaII || MseI | | | | |AsuI* |Hin4II* | | | | BmgT120I Eco57MI | | | CviJI GsuI | | TspDTI | EcoRI | TspEI | ApoI MnlI D N N N E N N K N E F N E A G P S S L N I I I T K I T K T N S M R L V L H H * I * * * R K * Q K R I Q * G W S F I I K F ----:----|----:----|----:----|----:----|----:----|----:----| S L L L S F L L F S N L S A P G E D N F H Y Y Y R F Y C F R I * H P Q D K M M L I I I V F I V F V F E I L S T R * * * I AjuI Hpy178III* FalI | MseI SspI FalI MboII \ \ \ \ \ TCTTTATCTGCTCCAGATTTAACGCAGAATATTCAATCAAGGGTAGTTGCCCCAAGTCGC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAATAGACGAGGTCTAAATTGCGTCTTATAAGTTAGTTCCCATCAACGGGGTTCAGCG / / / / / / TspEI | MseI SspI FalI MboII ApoI Hpy178III* FalI AjuI S L S A P D L T Q N I Q S R V V A P S R L Y L L Q I * R R I F N Q G * L P Q V A F I C S R F N A E Y S I K G S C P K S L ----:----|----:----|----:----|----:----|----:----|----:----| E K D A G S K V C F I * D L T T A G L R N K I Q E L N L A S Y E I L P L Q G L D R * R S W I * R L I N L * P Y N G W T A SapI Ksp632I* | CfrI | | BalI | | CviJI | | HaeIII | | |BsrI | | || AjuI | | || FalI | | || FalI | | || | MaeIII | | || | Tsp45I Hpy178III* TspEI Hpy166II \ \ \\ \ \ \ \ \ TCTTCTATACTGGCCAAGAGTGACATCTTTTATCACTATTCAAGAGATATAAAATTGTGG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGATATGACCGGTTCTCACTGTAGAAAATAGTGATAAGTTCTCTATATTTTAACACC / // / / / / / | || CfrI Tsp45I Hpy178III* | Hpy166II | |HaeIII MaeIII TspEI | |CviJI | |BalI | FalI | FalI | AjuI | BsrI Ksp632I* SapI S S I L A K S D I F Y H Y S R D I K L W L L Y W P R V T S F I T I Q E I * N C G F Y T G Q E * H L L S L F K R Y K I V D ----:----|----:----|----:----|----:----|----:----|----:----| E E I S A L L S M K * * * E L S I F N H S K * V P W S H C R K D S N L L Y L I T R R Y Q G L T V D K I V I * S I Y F Q P SetI BceAI TspEI | Tsp4CI* CviJI | MseI \ \ \ \ \ \ ACAGAATTACAAGACCTAACAGTTTATTATACTAAAACGGCTCACAAGATGTTCCTTAAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTTAATGTTCTGGATTGTCAAATAATATGATTTTGCCGAGTGTTCTACAAGGAATTT / / / / / / | SetI Tsp4CI* CviJI | MseI TspEI BceAI T E L Q D L T V Y Y T K T A H K M F L K Q N Y K T * Q F I I L K R L T R C S L K R I T R P N S L L Y * N G S Q D V P * R ----:----|----:----|----:----|----:----|----:----|----:----| V S N C S R V T * * V L V A * L I N R L S L I V L G L L K N Y * F P E C S T G * C F * L V * C N I I S F R S V L H E K F TspEI EcoRV |BsmAI | Hpy188I |Esp3I | |TfiI || Hpy178III* | |HinfI Hin4I TfiI || | Hin4I | || MboII Hin4I AlfI HinfI || | Hin4I | || BbvII* |BbvI AlfI \ \\ \ \ \ \\ \ \\ \ GAGAATCGTCTCAATTTCACGAAATACTTTGATTTGATATCAGATTCAATAGTCTTCACA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTAGCAGAGTTAAAGTGCTTTATGAAACTAAACTATAGTCTAAGTTATCAGAAGTGT / // / / / / / / // HinfI || Hpy178III* | | | | BbvII* |BbvI TfiI |Esp3I | | | | Hin4I AlfI |BsmAI | | | | Hin4I AlfI |Hin4I | | | HinfI |Hin4I | | | TfiI TspEI | | MboII | Hpy188I EcoRV E N R L N F T K Y F D L I S D S I V F T R I V S I S R N T L I * Y Q I Q * S S H E S S Q F H E I L * F D I R F N S L H T ----:----|----:----|----:----|----:----|----:----|----:----| S F R R L K V F Y K S K I D S E I T K V L S D D * N * S I S Q N S I L N L L R * L I T E I E R F V K I Q Y * I * Y D E C CviRI* | FatI | |CviAII | || NlaIII Tsp4CI* | || |TspEI | TseI | || || MseI | CviJI | || || | AlfI | |BisI | || || | AlfI | |SfeI* | || || | | CviJI | ||BlsI | || || | | | TspDTI | |||CviRI* | || || | | | | TseI | |||| PstI | || || | | | | CviRI* | |||| Cac8I | || || | | | | |BisI MseI | |||| | CviJI | || || | | | | ||BlsI BbvI \ \\\\ \ \ \ \\ \\ \ \ \ \ \\\ \ CAGTTAGGCTGCAGGCTAATGCAACATGAAATTAAAGCCAAAAGTTGCAGCAAGGAGATT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAATCCGACGTCCGATTACGTTGTACTTTAATTTCGGTTTTCAACGTCGTTCCTCTAA / //// / / / / // /// / / //// | |||| | CviJI | | || ||| | TspDTI |||TseI | |||| SfeI* | | || ||| CviJI ||BisI | |||| Cac8I | | || ||MseI |BlsI | |||CviRI* | | || |TspEI CviRI* | |||TseI | | || AlfI | ||BisI | | || AlfI | |BlsI | | |FatI | |PstI | | CviAII | CviJI | NlaIII Tsp4CI* CviRI* Q L G C R L M Q H E I K A K S C S K E I S * A A G * C N M K L K P K V A A R R L V R L Q A N A T * N * S Q K L Q Q G D * ----:----|----:----|----:----|----:----|----:----|----:----| C N P Q L S I C C S I L A L L Q L L S I V T L S C A L A V H F * L W F N C C P S L * A A P * H L M F N F G F T A A L L N MboII | MboII | TspDTI BsaBI XmnI | |SetI Ksp632I* | TspEI \ \ \\ \ \ \ AAGAAGATTTTCAAAGGTCTAATCTCTTCATTGTCAAGGATAAGTATCAATTCTCATTTA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTCTAAAAGTTTCCAGATTAGAGAAGTAACAGTTCCTATTCATAGTTAAGAGTAAAT / / / /// / / / | | XmnI ||MboII Ksp632I* BsaBI TspEI | BbvI |TspDTI MseI MboII SetI K K I F K G L I S S L S R I S I N S H L R R F S K V * S L H C Q G * V S I L I Y E D F Q R S N L F I V K D K Y Q F S F I ----:----|----:----|----:----|----:----|----:----|----:----| L F I K L P R I E E N D L I L I L E * K * S S K * L D L R K M T L S L Y * N E N L L N E F T * D R * Q * P Y T D I R M * TaqI AluI | TfiI CviJI | HinfI | SetI BciVI TspDTI \ \ \ \ \ \ TATTTCGATTCAGCTTTTCACAGAAAAAAAATGGATACTATGAATGACAAGGATAACGAT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAAGCTAAGTCGAAAAGTGTCTTTTTTTTACCTATGATACTTACTGTTCCTATTGCTA / // / / / | || CviJI BciVI TspDTI | || AluI | |SetI | HinfI | TfiI TaqI Y F D S A F H R K K M D T M N D K D N D I S I Q L F T E K K W I L * M T R I T I F R F S F S Q K K N G Y Y E * Q G * R * ----:----|----:----|----:----|----:----|----:----|----:----| Y K S E A K * L F F I S V I F S L S L S I N R N L K E C F F F P Y * S H C P Y R I E I * S K V S F F H I S H I V L I V I BseGI |TspGWI Hpy178III* MaeI || TspEI TatI | TspEI | Hin4II* BccI || | FokI Bsp1407I \ \ \ \ \ \\ \ \ \ AATCAGGAAAATAATTGTTCTAGGACGGAAGGGGATGATGGTAAAATTGAAGTAGATAGT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTCCTTTTATTAACAAGATCCTGCCTTCCCCTACTACCATTTTAACTTCATCTATCA / / // / // / / | | |MaeI BccI |TspGWI | FokI | | Hin4II* BseGI TspEI | TspEI Hpy178III* N Q E N N C S R T E G D D G K I E V D S I R K I I V L G R K G M M V K L K * I V S G K * L F * D G R G * W * N * S R * C ----:----|----:----|----:----|----:----|----:----|----:----| L * S F L Q E L V S P S S P L I S T S L Y D P F Y N N * S P L P H H Y F Q L L Y I L F I I T R P R F P I I T F N F Y I T Csp6I Hpy166II |RsaI Csp6I ||FatI BetI* |RsaI |||CviAII BsiYI* || BsrI |||| MboI |HpaII || | TatI |||| |NlaIII || Hpy166II || | |Csp6I |||| ||DpnI || | MaeII || | ||RsaI |||| |||BstKTI || | | SetI || | ||BciVI |||| ||||MaeI || | | TaiI || | ||BsaXI \\\\ \\\\\ \\ \ \ \ \\ \ \\\ GTACATGATCTAGTTTCAGTTCCATTGTCCGGTAAACGTAATGTAAGTACCAGTACAACG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CATGTACTAGATCAAAGTCAAGGTAACAGGCCATTTGCATTACATTCATGGTCATGTTGC //// /// / / / // // / // / //// |||| ||| | MaeI | || || MaeII || | |||TatI |||| ||| MboI | || |TaiI || | ||Csp6I |||| ||DpnI | || |SetI || | |RsaI |||| |BstKTI | || Hpy166II || | BciVI |||| |FatI | |BetI* || BsaXI |||| CviAII | HpaII |Csp6I |||Bsp1407I BsiYI* RsaI |||TatI BsrI ||NlaIII ||Csp6I |RsaI Hpy166II V H D L V S V P L S G K R N V S T S T T Y M I * F Q F H C P V N V M * V P V Q R T * S S F S S I V R * T * C K Y Q Y N G ----:----|----:----|----:----|----:----|----:----|----:----| T C S R T E T G N D P L R L T L V L V V H V H D L K L E M T R Y V Y H L Y W Y L Y M I * N * N W Q G T F T I Y T G T C R HinfI | TspGWI | | MboI TatI | | | DpnI |Csp6I MlyI | | | |BstKTI ||RsaI ApoI PleI | | | || BsaXI ||| Tsp4CI* TspEI \ \ \ \ \\ \ \\\ \ \ GATACATTGACTCCAATGAGATCATCATTCAGTACAGTCAATGAGAACGATATGGAAAAT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGTAACTGAGGTTACTCTAGTAGTAAGTCATGTCAGTTACTCTTGCTATACCTTTTA // // // / /// |PleI |HinfI || MboI ||Tsp4CI* MlyI TspGWI |BsaXI ||TatI |DpnI |Csp6I BstKTI RsaI D T L T P M R S S F S T V N E N D M E N I H * L Q * D H H S V Q S M R T I W K I Y I D S N E I I I Q Y S Q * E R Y G K F ----:----|----:----|----:----|----:----|----:----|----:----| S V N V G I L D D N L V T L S F S I S F P Y M S E L S I M M * Y L * H S R Y P F I C Q S W H S * * E T C D I L V I H F I DdeI | AsuI* | AvaII | |BmgT120I | ||SetI | |||BspCNI MseI StyI DdeI | ||||BseMII |TspEI MaeIII SecI* \ \ \\\\\ \\ \ \ TTCTCAGTCTTAGGTCCAAGAAATAGTGTTAATTCTGTCGTAACACCAAGGACTTCAATA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AAGAGTCAGAATCCAGGTTCTTTATCACAATTAAGACAGCATTGTGGTTCCTGAAGTTAT / / // /// / / / / | DdeI || ||AvaII | TspEI | SecI* TspEI || ||AsuI* MseI | StyI ApoI || |BmgT120I MaeIII || |BseMII || BspCNI |DdeI SetI F S V L G P R N S V N S V V T P R T S I S Q S * V Q E I V L I L S * H Q G L Q Y L S L R S K K * C * F C R N T K D F N T ----:----|----:----|----:----|----:----|----:----|----:----| K E T K P G L F L T L E T T V G L V E I N R L R L D L F Y H * N Q R L V L S K L E * D * T W S I T N I R D Y C W P S * Y AluI CviJI | SetI ApoI | | MmeI ApoI MboII TspEI | | | TaqI TspEI HphI |Tsp4CI* | MseI | | | ClaI \ \ \\ \ \ \ \ \ \ CAAAATTCTACTTTGGAAGATTTTTCACCGTCCAACAAAAATTTTAAGTCAGCTAAATCG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTAAGATGAAACCTTCTAAAAAGTGGCAGGTTGTTTTTAAAATTCAGTCGATTTAGC / / // / / / / / / TspEI HphI |Tsp4CI* | | | | MmeI ClaI ApoI MboII | | | CviJI TaqI | | | AluI | | SetI | MseI TspEI ApoI Q N S T L E D F S P S N K N F K S A K S K I L L W K I F H R P T K I L S Q L N R K F Y F G R F F T V Q Q K F * V S * I D ----:----|----:----|----:----|----:----|----:----|----:----| C F E V K S S K E G D L L F K L D A L D V F N * K P L N K V T W C F N * T L * I L I R S Q F I K * R G V F I K L * S F R ApoI TspEI EcoRI FatI | Hpy178III* |CviAII | |TaqI || NspI | || ApoI || NlaIII | || TspEI MseI || | MaeIII \ \\ \ \ \\ \ \ ATTTACGAAATGGTTGATGTGGAATTCTCGAAATTTTTAAGGCATGTTCAGTTACTTTAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TAAATGCTTTACCAACTACACCTTAAGAGCTTTAAAAATTCCGTACAAGTCAATGAAATA / // / / / // / | |TaqI | | | |FatI MaeIII | | | | | CviAII | | | | NlaIII | | | | NspI | | | MseI | | TspEI | | ApoI | Hpy178III* EcoRI TspEI ApoI I Y E M V D V E F S K F L R H V Q L L Y F T K W L M W N S R N F * G M F S Y F I L R N G * C G I L E I F K A C S V T L F ----:----|----:----|----:----|----:----|----:----|----:----| I * S I T S T S N E F N K L C T * N S * S K R F P Q H P I R S I K L A H E T V K N V F H N I H F E R F K * P M N L * K I MboII BbvII* | AluI | CviJI DdeI | Ecl136II | Hpy188I | |DdeI | |BspCNI | ||SetI | ||BseMII | ||SduI | ||| TstI | ||SacI | ||| BsaXI | ||HgiAI* | ||| | BspCNI MaeIII | ||HgiJII* | ||| | |BseMII Tsp4CI* \ \ \\\ \ \\\ \ \\ \ TTTGTGTTACAGAGCTCAGTCTTCTCAGATGATAATACTTTACCACAGTTGCTCCCAAGA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| AAACACAATGTCTCGAGTCAGAAGAGTCTACTATTATGAAATGGTGTCAACGAGGGTTCT /// / / / // / / // / / ||| | | DdeI || | | |BseMII Tsp4CI* TspDTI ||| | BbvII* || | | BspCNI ||| Ecl136II || | BsaXI ||| CviJI || TstI ||| AluI |BseMII ||HgiJII* |DdeI ||HgiAI* Hpy188I ||SacI BspCNI ||SduI ||SetI |MboII MaeIII F V L Q S S V F S D D N T L P Q L L P R L C Y R A Q S S Q M I I L Y H S C S Q D C V T E L S L L R * * Y F T T V A P K I ----:----|----:----|----:----|----:----|----:----|----:----| K T N C L E T K E S S L V K G C N S G L N Q T V S S L R R L H Y Y K V V T A G L K H * L A * D E * I I I S * W L Q E W S TspDTI | MseI | BsaXI | |AhaIII* | ||TstI SetI AciI TaqI \ \\\ \ \ \ TTTTTTAAAGGTTCATTTAGCGGTGGTTCTTGGACAAATCCATTTTCGACTTTTATTACG 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAAATTTCCAAGTAAATCGCCACCAAGAACCTGTTTAGGTAAAAGCTGAAAATAATGC / /// / / | ||SetI AciI TaqI | |MseI | AhaIII* BsaXI TstI F F K G S F S G G S W T N P F S T F I T F L K V H L A V V L G Q I H F R L L L R F * R F I * R W F L D K S I F D F Y Y G ----:----|----:----|----:----|----:----|----:----|----:----| N K L P E N L P P E Q V F G N E V K I V I K * L N M * R H N K S L D M K S K * * K K F T * K A T T R P C I W K R S K N R AluI MaeIII CviJI Tsp45I ApoI FokI | SetI | AciI TspEI TspGWI | MaeIII | | DrdI | BseGI | TspDTI | Tsp45I | | | TspDTI \ \ \ \ \ \ \ \ \ \ GATGAATTTGGTAATGCGACAAAGAACAAAGCTGTCACATCTAATGAAGTGACCGCTTCG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTAAACCATTACGCTGTTTCTTGTTTCGACAGTGTAGATTACTTCACTGGCGAAGC / / / / / / / / / / // | | | | FokI | CviJI Tsp45I | | |Hpy99I | | | TspDTI | AluI MaeIII | | TspDTI | | TspGWI SetI | DrdI | TspEI | AciI | ApoI Tsp45I BseGI MaeIII D E F G N A T K N K A V T S N E V T A S M N L V M R Q R T K L S H L M K * P L R * I W * C D K E Q S C H I * * S D R F V ----:----|----:----|----:----|----:----|----:----|----:----| S S N P L A V F F L A T V D L S T V A E P H I Q Y H S L S C L Q * M * H L S R K I F K T I R C L V F S D C R I F H G S R Hpy99I MnlI | ApoI | TfiI BccI | TspEI | HinfI | SfaNI HgaI \ \ \ \ \ \ \ TCGTCCAAAAATTCCTCAATATCAAGGATTCCACCAAAGATGGCAGATGCTATTGCCTCT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AGCAGGTTTTTAAGGAGTTATAGTTCCTAAGGTGGTTTCTACCGTCTACGATAACGGAGA / / / / / / TspEI MnlI | BccI SfaNI HgaI ApoI HinfI TfiI S S K N S S I S R I P P K M A D A I A S R P K I P Q Y Q G F H Q R W Q M L L P L V Q K F L N I K D S T K D G R C Y C L C ----:----|----:----|----:----|----:----|----:----|----:----| D D L F E E I D L I G G F I A S A I A E T T W F N R L I L S E V L S P L H * Q R R G F I G * Y * P N W W L H C I S N G R Hpy178III* | Hin6I MseI | |GlaI |AhaIII* | |Eco47III || HgaI | ||HhaI Hpy188I || |Cac8I | |||HaeII | ApoI || || MwoI |MnlI ||||TspEI | TspEI TspEI || || BstAPI \\ \\\\\ \ \ \ \\ \\ \ GCGTCAGGATATAGCGCTAATTCAGAAACAAATTCCCAAATTGATTTAAAAGCAAGCAGT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CGCAGTCCTATATCGCGATTAAGTCTTTGTTTAAGGGTTTAACTAAATTTTCGTTCGTCA / / //// // / / // // / | | |||Hin6I |Hpy188I TspEI | |MseI || HgaI | | ||| TspEI ApoI | | |BstAPI | | ||Eco47III | | |MwoI | | ||GlaI | | Cac8I | | |HhaI | | TspRI | | HaeII | AhaIII* | Hpy178III* TspEI MnlI A S G Y S A N S E T N S Q I D L K A S S R Q D I A L I Q K Q I P K L I * K Q A V V R I * R * F R N K F P N * F K S K Q C ----:----|----:----|----:----|----:----|----:----|----:----| A D P Y L A L E S V F E W I S K F A L L Q T L I Y R * N L F L N G F Q N L L L C R * S I A S I * F C I G L N I * F C A T AciI BisI |BlsI |BtsI Hin4II* |TspRI | XmnI ||TauI | |SetI ||FnuDII* SetI Tsp4CI* | || Hpy178III* \\\ \ \ \ \\ \ GCCGCGTCTGGTTCAGTTTTTACACCTTTCAACCGTCCTTCTCATAACAGAACCTTTTCA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCGCAGACCAAGTCAAAAATGTGGAAAGTTGGCAGGAAGAGTATTGTCTTGGAAAAGT //// / / / / / |||FnuDII* SetI Tsp4CI* | | XmnI |||AciI | SetI ||BisI Hin4II* |BlsI BtsI TauI A A S G S V F T P F N R P S H N R T F S P R L V Q F L H L S T V L L I T E P F Q R V W F S F Y T F Q P S F S * Q N L F K ----:----|----:----|----:----|----:----|----:----|----:----| A A D P E T K V G K L R G E * L L V K E H R T Q N L K * V K * G D K E Y C F R K G R R T * N K C R E V T R R M V S G K * MboII | MseI | | SfeI* | | |Tsp4CI* | | || AccI | | || |Hpy166II \ \ \\ \\ AGAGCAAGAGTTTCAAAAAGGAAGAAAAAATATCCATTAACTGTAGACACTTTGAATACA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCGTTCTCAAAGTTTTTCCTTCTTTTTTATAGGTAATTGACATCTGTGAAACTTATGT / / / / // Hpy178III* MboII | | |AccI | | Hpy166II | | SfeI* | Tsp4CI* MseI R A R V S K R K K K Y P L T V D T L N T E Q E F Q K G R K N I H * L * T L * I Q S K S F K K E E K I S I N C R H F E Y N ----:----|----:----|----:----|----:----|----:----|----:----| L A L T E F L F F F Y G N V T S V K F V L L L L K L F S S F I D M L Q L C K S Y S C S N * F P L F F I W * S Y V S Q I C MboII |TspDTI || MboII || | ApoI SetI || | TspEI TspEI |Hpy166II || | | MnlI | MseI SfeI* || MseI \\ \ \ \ \ \ \ \\ \ ATGAAGAAGAAATCCTCGCAAATTTTTGAAAAATTAAATAATGCTACAGGTGAACACTTA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTCTTCTTTAGGAGCGTTTAAAAACTTTTTAATTTATTACGATGTCCACTTGTGAAT / / // // // / / | MboII |TspEI |MseI || | HphI TspDTI |ApoI TspEI || | MseI MboII MnlI || Hpy166II |SfeI* SetI M K K K S S Q I F E K L N N A T G E H L * R R N P R K F L K N * I M L Q V N T * E E E I L A N F * K I K * C Y R * T L K ----:----|----:----|----:----|----:----|----:----|----:----| I F F F D E C I K S F N F L A V P S C K L S S S I R A F K Q F I L Y H * L H V S H L L F G R L N K F F * I I S C T F V * HphI |TspEI ApoI ApoI || PsiI Hpy166II TspEI TspEI TspEI \\ \ \ \ \ \ AAAATTATAAGTAAACCCAAAAGCAGAATTAGGAATTTGGAAATAAATTCAAGCACATAC 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAATATTCATTTGGGTTTTCGTCTTAATCCTTAAACCTTTATTTAAGTTCGTGTATG // / / / / |PsiI Hpy166II TspEI TspEI TspEI TspEI ApoI ApoI K I I S K P K S R I R N L E I N S S T Y K L * V N P K A E L G I W K * I Q A H T N Y K * T Q K Q N * E F G N K F K H I R ----:----|----:----|----:----|----:----|----:----|----:----| F I I L L G L L L I L F K S I F E L V Y L F * L Y V W F C F * S N P F L N L C M F N Y T F G F A S N P I Q F Y I * A C V MboI BglII XhoII | DpnI | |TspDTI | |BstKTI BsrI | || TspEI |ApoI | || | GsuI Hpy188I |TspEI | || | Eco57MI \ \\ \ \\ \ \ GAACAAATAAATCAGAATGTTTTACTATTGGAGATACTGGAGAATTTAGATCTGTCAATT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTTTATTTAGTCTTACAAAATGATAACCTCTATGACCTCTTAAATCTAGACAGTTAA / / / // / / / Hpy188I BsrI | || | | TspEI | || | Eco57MI | || | GsuI | || XhoII | || BglII | || MboI | |DpnI | BstKTI | TspDTI TspEI ApoI E Q I N Q N V L L L E I L E N L D L S I N K * I R M F Y Y W R Y W R I * I C Q F T N K S E C F T I G D T G E F R S V N F ----:----|----:----|----:----|----:----|----:----|----:----| S C I F * F T K S N S I S S F K S R D I R V F L D S H K V I P S V P S N L D T L F L Y I L I N * * Q L Y Q L I * I Q * N SetI | MmeI | MseI TspEI | | BfiI BsrI XcmI TaqII MnlI \ \ \ \ \ \ \ \ TTCATCAATTTGAAAAACCTGATTAAGACACCCAGTATTTTGTTGGATTTGGAAAGCGAG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAGTTAAACTTTTTGGACTAATTCTGTGGGTCATAAAACAACCTAAACCTTTCGCTC / / / / / / / / TspEI SetI | MseI BsrI XcmI TaqII MnlI | BfiI MmeI F I N L K N L I K T P S I L L D L E S E S S I * K T * L R H P V F C W I W K A R H Q F E K P D * D T Q Y F V G F G K R G ----:----|----:----|----:----|----:----|----:----|----:----| K M L K F F R I L V G L I K N S K S L S K * * N S F G S * S V W Y K T P N P F R E D I Q F V Q N L C G T N Q Q I Q F A L DdeI BsmAI Hpy166II Eco31I | MboII | TatI | BbvII* | |Csp6I | |TaqII | ||RsaI | || FatI | ||ScaI | || |CviAII | ||| MnlI ApoI | || || BseRI | ||| | BspCNI TspEI | || || NlaIII | ||| | |BseMII \ \ \\ \\ \ \ \\\ \ \\ GAATTTTTAGTTCACGCCATGTCTTCGGTCTCCTCAGTACTAACAGAGTTTTTTGATATA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAAAAATCAAGTGCGGTACAGAAGCCAGAGGAGTCATGATTGTCTCAAAAAACTATAT / // ///// ////// // / TspEI || ||||FatI |||||| |BseMII TspDTI ApoI || |||CviAII |||||| BspCNI || ||BseRI |||||MnlI || |BbvII* ||||TatI || NlaIII |||Csp6I |MboII ||ScaI |TaqII ||RsaI Hpy166II |Eco31I |BsmAI DdeI E F L V H A M S S V S S V L T E F F D I N F * F T P C L R S P Q Y * Q S F L I * I F S S R H V F G L L S T N R V F * Y K ----:----|----:----|----:----|----:----|----:----|----:----| S N K T * A M D E T E E T S V S N K S I P I K L E R W T K P R R L V L L T K Q Y F K * N V G H R R D G * Y * C L K K I Y TspDTI | Cac8I | | CviJI | | | FatI | | | BspHI | | | |CviAII | | | |Hpy178III* Hpy188I | | | || NlaIII | MseI DdeI | | | || | Tth111I | VspI |SetI \ \ \ \\ \ \ \ \ \\ AAGCAGGCTTTTCATGACATCGTCATCAGATTAATAATGACAACGCAACAAACGACCTTA 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGTCCGAAAAGTACTGTAGCAGTAGTCTAATTATTACTGTTGCGTTGTTTGCTGGAAT / / / // / / / / / | | | || | | VspI SetI DdeI | | | || | | MseI | | | || | Hpy188I | | | || Tth111I | | | |BspHI | | | |FatI | | | Hpy178III* | | | CviAII | | NlaIII | CviJI Cac8I K Q A F H D I V I R L I M T T Q Q T T L S R L F M T S S S D * * * Q R N K R P * A G F S * H R H Q I N N D N A T N D L R ----:----|----:----|----:----|----:----|----:----|----:----| F C A K * S M T M L N I I V V C C V V K L A P K E H C R * * I L L S L A V F S R L L S K M V D D D S * Y H C R L L R G * MnlI | MmeI | EcoNI | | BsiYI* Hpy188I | | | AsuI* | FatI | | | AvaII | BspHI | | | |MnlI | |CviAII | | | |BmgT120I | |Hpy178III* | | | ||SetI | || NlaIII | | | ||| TspEI | || | SetI \ \ \ \\\ \ \ \\ \ \ GACGACCCGTATTTGTTTTCCTCAATGAGGTCCAATTTCCCTGTCGGACATCATGAACCT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTGGGCATAAACAAAAGGAGTTACTCCAGGTTAAAGGGACAGCCTGTAGTACTTGGA / // / / / // / / / /// | || | | | || TspEI | | ||SetI | || | | | |AvaII | | |BspHI | || | | | |AsuI* | | |FatI | || | | | BmgT120I | | Hpy178III* | || | | MnlI | | CviAII | || | SetI | NlaIII | || EcoNI Hpy188I | |BsiYI* | MmeI MnlI D D P Y L F S S M R S N F P V G H H E P T T R I C F P Q * G P I S L S D I M N L R P V F V F L N E V Q F P C R T S * T F ----:----|----:----|----:----|----:----|----:----|----:----| S S G Y K N E E I L D L K G T P C * S G L R G T N T K R L S T W N G Q R V D H V V V R I Q K G * H P G I E R D S M M F R AsuI* DraII Bsp120I |AsuI* |DraII |BmgT120I ||CviJI ||NlaIV ||HaeIII ||BmgT120I |||NlaIV Hin4II* ||||ApaI | FalI FalI ||||SduI | FalI Hpy178III* FalI ||||BseSI | | MfeI | TspDTI | SetI ||||HgiJII* | | TspEI \ \ \ \ \\\\\ \ \ \ TTCAAGAATATCTCTAATACACCTTTGGTCAAGGGCCCCTTCCATAAAAAAAATGAACAA 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTCTTATAGAGATTATGTGGAAACCAGTTCCCGGGGAAGGTATTTTTTTTACTTGTT // / / / /// / / |TspDTI | SetI | ||Bsp120I | FalI Hpy178III* FalI | ||DraII | FalI FalI | ||AsuI* Hin4II* | |BmgT120I | |DraII | |AsuI* | |NlaIV | BmgT120I | HaeIII | NlaIV | CviJI HgiJII* BseSI SduI ApaI F K N I S N T P L V K G P F H K K N E Q S R I S L I H L W S R A P S I K K M N N Q E Y L * Y T F G Q G P L P * K K * T I ----:----|----:----|----:----|----:----|----:----|----:----| K L F I E L V G K T L P G K W L F F S C K * S Y R * Y V K P * P G R G Y F F H V E L I D R I C R Q D L A G E M F F I F L HinfI MaeII | Hpy178III* |BsaAI | | PleI SetI || SetI | | |MlyI | ApoI TspDTI || TaiI | | |HphI | TspEI \ \\ \ \ \ \\ \ \ TTGGCACTCTCCTTATTTCACGTATTGGTGAGTCAAGATGTGGAGTTCAATAACCTTGAA 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGTGAGAGGAATAAAGTGCATAACCACTCAGTTCTACACCTCAAGTTATTGGAACTT / / / // / / // / | TspDTI | |MaeII | | |PleI SetI TspEI | BsaAI | | |MlyI MfeI TaiI | | HphI SetI | Hpy178III* HinfI L A L S L F H V L V S Q D V E F N N L E W H S P Y F T Y W * V K M W S S I T L N G T L L I S R I G E S R C G V Q * P * I ----:----|----:----|----:----|----:----|----:----|----:----| N A S E K N * T N T L * S T S N L L R S I P V R R I E R I P S D L H P T * Y G Q Q C E G * K V Y Q H T L I H L E I V K F Hpy188I MmeI | SfaNI | Hin4I | |Hpy99I | Hin4I MseI | || MseI | | TaqI |AhaIII* | || |AhaIII* | | |Hpy178III* \\ \ \\ \\ \ \ \\ TTTTTAAACAACTCCGACGATTTTAAAGATGCTTGTGAAAAGTATGTCGAGATTTCTAAT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAATTTGTTGAGGCTGCTAAAATTTCTACGAACACTTTTCATACAGCTCTAAAGATTA / // / / // // // | |MseI Hpy188I | |MseI |Hin4I |Hpy178III* | AhaIII* Hpy99I | AhaIII* |Hin4I TaqI TspEI SfaNI MmeI ApoI F L N N S D D F K D A C E K Y V E I S N F * T T P T I L K M L V K S M S R F L I F K Q L R R F * R C L * K V C R D F * S ----:----|----:----|----:----|----:----|----:----|----:----| N K F L E S S K L S A Q S F Y T S I E L I K L C S R R N * L H K H F T H R S K * K * V V G V I K F I S T F L I D L N R I Hin4I Hin4I | MboI | BclI | | DpnI | | |BstKTI ApoI TseI | | ||MfeI TspEI |BisI | | ||TspEI |MboII ||BlsI \ \ \\\ \\ \\\ CTTGCGTGTATTATTGTTGATCAATTGATTGAAGAAAGAGAAAATTTGCTGAACTACGCA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGCACATAATAACAACTAGTTAACTAACTTCTTTCTCTTTTAAACGACTTGATGCGT / // / / / / // Hin4I || | TspEI | TspEI |BisI Hin4I || | MfeI | ApoI BlsI || BclI MboII || MboI |DpnI BstKTI L A C I I V D Q L I E E R E N L L N Y A L R V L L L I N * L K K E K I C * T T Q C V Y Y C * S I D * R K R K F A E L R S ----:----|----:----|----:----|----:----|----:----|----:----| R A H I I T S * N I S S L S F K S F * A D Q T Y * Q Q D I S Q L F L F N A S S R K R T N N N I L Q N F F S F I Q Q V V C MboII |TspDTI ||SfeI* ||| CviRI* BbvI TspEI ||| | PstI SetI HphI \ \ \\\ \ \ \ \ GCAAGAATGATGAAGAATAATTTGACTGCAGAACTATTGAAAGGTGAGCAAGAAAAATGG 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTCTTACTACTTCTTATTAAACTGACGTCTTGATAACTTTCCACTCGTTCTTTTTACC / / // / / / / / TseI BbvI || | | SfeI* SetI HphI || | CviRI* || PstI |TspDTI |MboII TspEI A R M M K N N L T A E L L K G E Q E K W Q E * * R I I * L Q N Y * K V S K K N G K N D E E * F D C R T I E R * A R K M V ----:----|----:----|----:----|----:----|----:----|----:----| A L I I F F L K V A S S N F P S C S F H L L F S S S Y N S Q L V I S L H A L F I C S H H L I I Q S C F * Q F T L L F F P SecI* TfiI AluI |Hpy188I HinfI CviJI TaqI MnlI || SfeI* | Hpy188I | SetI ClaI \ \\ \ \ \ \ \ \ TTTGATATTTATTCCGAGGACTATAGTGATGACGATTCAGAAAATGATGAAGCTATCATC 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTATAAATAAGGCTCCTGATATCACTACTGCTAAGTCTTTTACTACTTCGATAGTAG / / / / // / / / MnlI | SecI* SfeI* |Hpy188I | CviJI TspDTI Hpy188I HinfI | AluI TfiI SetI F D I Y S E D Y S D D D S E N D E A I I L I F I P R T I V M T I Q K M M K L S S * Y L F R G L * * * R F R K * * S Y H R ----:----|----:----|----:----|----:----|----:----|----:----| N S I * E S S * L S S S E S F S S A I M T Q Y K N R P S Y H H R N L F H H L * * K I N I G L V I T I V I * F I I F S D D TspDTI | TspEI | |BseMII | ||BspCNI | ||| MnlI | ||| |MboI | ||| |XhoII TseI | ||| || DpnI AluI | ||| || |BstKTI CviJI | ||| || ||DdeI |BisI | ||| || |||Hpy188I ||BlsI | ||| || |||| BinI* BbvI ||SetI \ \\\ \\ \\\\ \ \ \\\ GATGACGAATTAGGATCTGAGGACTATATTGAACGCAAAGCTGCGAACATAGAGAAAAAC 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGCTTAATCCTAGACTCCTGATATAACTTGCGTTTCGACGCTTGTATCTCTTTTTG / // / // / / / / / //// / / ClaI || | || | | BinI* BbvI | |||TseI | Eco57MI TaqI || | || | DdeI | ||BisI | Eco57I || | || Hpy188I | |BlsI SetI || | || XhoII | CviJI || | || MboI | AluI || | |DpnI SetI || | BstKTI || TspEI || MnlI |BspCNI BseMII D D E L G S E D Y I E R K A A N I E K N M T N * D L R T I L N A K L R T * R K T * R I R I * G L Y * T Q S C E H R E K P ----:----|----:----|----:----|----:----|----:----|----:----| S S S N P D S S * I S R L A A F M S F F R H R I L I Q P S Y Q V C L Q S C L S F I V F * S R L V I N F A F S R V Y L F V SetI SpeI Eco57I |MaeI Eco57MI ||Bce83I* | FatI ||| MlyI | NcoI ||| PleI | StyI ||| |TspDTI | SecI* ||| || MnlI | DsaI* ||| || HinfI | |CviAII ||| || | SmlI | || NlaIII ||| || | | Hpy178III* | || | Hin4II* ||| || | | | ApoI | || | | MseI Hpy188I ||| || | | | TspEI \ \\ \ \ \ \ \\\ \\ \ \ \ \ CTTCCATGGTTTTTAACTTCAGATTATGAAACTAGTCTTGTCTATGACTCAAGAGGAAAA 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGGTACCAAAAATTGAAGTCTAATACTTTGATCAGAACAGATACTGAGTTCTCCTTTT / /// / / / // /// / / / | ||| MseI Hpy188I | || ||| | | Hpy178III* | ||Hin4II* | || ||| | | SmlI | |DsaI* | || ||| | HinfI | |SecI* | || ||| MnlI | |StyI | || ||PleI | |NcoI | || |MlyI | |FatI | || TspDTI | CviAII | |SpeI NlaIII | MaeI Bce83I* L P W F L T S D Y E T S L V Y D S R G K F H G F * L Q I M K L V L S M T Q E E K S M V F N F R L * N * S C L * L K R K N ----:----|----:----|----:----|----:----|----:----|----:----| R G H N K V E S * S V L R T * S E L P F G E M T K L K L N H F * D Q R H S L L F K W P K * S * I I F S T K D I V * S S F MseI | BsrI | | FatI | | BspHI | | |CviAII | | |Hpy178III* | | || SfaNI AciI BslFI | | || |NlaIII FauI | MnlI | TspRI | | || || TsoI \ \ \ \ \ \ \ \\ \\ \ ATTCGTGGCGGGACAAAAGAGGCACTGATTGAACATTTAACCAGTCATGAACTTGTTGAT 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGCACCGCCCTGTTTTCTCCGTGACTAACTTGTAAATTGGTCAGTACTTGAACAACTA / // / / / / // / / TspEI |MnlI TspRI BslFI MseI | || SfaNI TspDTI ApoI AciI BsrI | || TsoI FauI | |BspHI | |FatI | Hpy178III* | CviAII NlaIII I R G G T K E A L I E H L T S H E L V D F V A G Q K R H * L N I * P V M N L L M S W R D K R G T D * T F N Q S * T C * C ----:----|----:----|----:----|----:----|----:----|----:----| I R P P V F S A S I S C K V L * S S T S F E H R S L L P V S Q V N L W D H V Q Q N T A P C F L C Q N F M * G T M F K N I AciI |BisI |TspDTI ||BlsI |||TauI |||CviJI MaeIII MseI Hpy188I MseI TsoI \\\\ \ \ \ \ \ GCGGCTTTCAATGTTACAATGTTAATAACTTTCAGAAGTATATTAACCACAAGAGAGTTT 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| CGCCGAAAGTTACAATGTTACAATTATTGAAAGTCTTCATATAATTGGTGTTCTCTCAAA //// / / / / / |||CviJI MaeIII MseI Hpy188I MseI TsoI ||BisI ||AciI |BlsI TauI A A F N V T M L I T F R S I L T T R E F R L S M L Q C * * L S E V Y * P Q E S F G F Q C Y N V N N F Q K Y I N H K R V F ----:----|----:----|----:----|----:----|----:----|----:----| A A K L T V I N I V K L L I N V V L S N H P K * H * L T L L K * F Y I L W L L T R S E I N C H * Y S E S T Y * G C S L K Hin4II* | BseMII | Hpy178III* | |EcoNI | |BspCNI | || BsiYI* | || |BciVI | || || MnlI Csp6I | || || |CviJI |RsaI | || || ||DdeI Eco57I |SetI | || || ||| MaeIII Eco57MI \\ \ \\ \\ \\\ \ \ TTTTATGCCCTGATTTACAGGTACAACTTGTATCCTCCTGAAGGGCTGAGTTACGATGAT 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| AAAATACGGGACTAAATGTCCATGTTGAACATAGGAGGACTTCCCGACTCAATGCTACTA / // / /// // / / / / / | |Csp6I | ||| || | | DdeI | Eco57MI | RsaI | ||| || | CviJI | Eco57I SetI | ||| || MnlI MaeIII | ||| |BciVI | ||| Hpy178III* | ||| EcoNI | ||BsiYI* | |BspCNI | BseMII Hin4II* F Y A L I Y R Y N L Y P P E G L S Y D D F M P * F T G T T C I L L K G * V T M I L C P D L Q V Q L V S S * R A E L R * L ----:----|----:----|----:----|----:----|----:----|----:----| K * A R I * L Y L K Y G G S P S L * S S K K H G S K C T C S T D E Q L A S N R H K I G Q N V P V V Q I R R F P Q T V I I HindII SspI BceAI MseI Hpy166II \ \ \ \ TACAATATTTGGATAGAAAAAAAGTCAAACCCGATTAAATGCCGTGTGGTCAACATTATG 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTATAAACCTATCTTTTTTTCAGTTTGGGCTAATTTACGGCACACCAGTTGTAATAC / / / / SspI BceAI MseI Hpy166II HindII Y N I W I E K K S N P I K C R V V N I M T I F G * K K S Q T R L N A V W S T L * Q Y L D R K K V K P D * M P C G Q H Y E ----:----|----:----|----:----|----:----|----:----|----:----| * L I Q I S F F D F G I L H R T T L M I N C Y K S L F F T L G S * I G H P * C * V I N P Y F F L * V R N F A T H D V N H BssKI EcoRII TspDTI | ScrFI | TfiI TspEI | BseBI | HinfI HgaI | PsrI | |SetI | | TspRI \ \ \ \ \\ \ \ \ AGAACATTTTTGACGCAGTATTGGACAAGAAATTATTATGAACCTGGCATACCACTGATT 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTGTAAAAACTGCGTCATAACCTGTTCTTTAATAATACTTGGACCGTATGGTGACTAA // / / / / // // |PsrI TspEI | | | |TspDTI |HinfI HgaI | | | TspRI |TfiI | | EcoRII PsrI | | BssKI | BseBI | ScrFI SetI R T F L T Q Y W T R N Y Y E P G I P L I E H F * R S I G Q E I I M N L A Y H * F N I F D A V L D K K L L * T W H T T D S ----:----|----:----|----:----|----:----|----:----|----:----| L V N K V C Y Q V L F * * S G P M G S I S F M K S A T N S L F N N H V Q C V V S S C K Q R L I P C S I I I F R A Y W Q N BssKI MboI |SecI* XhoII |HpaII | DpnI ApoI ||ScrFI | |BstKTI TspEI ||CauII* | || BinI* |PsrI BccI Hpy188I |||MnlI | || |CviRI* \\ \ \ \\\\ \ \\ \\ CTAAATTTTGCCAAGATGGTTGTATCGGAGAAAATACCGGGGGCAGAGGATCTTTTGCAA 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| GATTTAAAACGGTTCTACCAACATAGCCTCTTTTATGGCCCCCGTCTCCTAGAAAACGTT / / / // / // / / | BccI Hpy188I || BssKI || | CviRI* TspEI || SecI* || | BinI* ApoI |CauII* || XhoII |HpaII || MboI |ScrFI |DpnI MnlI BstKTI L N F A K M V V S E K I P G A E D L L Q * I L P R W L Y R R K Y R G Q R I F C K K F C Q D G C I G E N T G G R G S F A K ----:----|----:----|----:----|----:----|----:----|----:----| R F K A L I T T D S F I G P A S S R K C E L N Q W S P Q I P S F V P P L P D K A * I K G L H N Y R L F Y R P C L I K Q L BsrI BinI* | MboI | BamHI | XhoII | | DpnI | | NlaIV | | TspRI | | |BstKTI | | || DdeI | | || Bpu10I | | || | Hin4I | | || | Hin4I TspDTI | | || | |BinI* \ \ \ \\ \ \\ AAGATAAATGAAAAACTGATAAATGAGAATGAGAAAGAACCAGTGGATCCTAAGCAACAA 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTATTTACTTTTTGACTATTTACTCTTACTCTTTCTTGGTCACCTAGGATTCGTTGTT / / / // / // TspDTI | | || | |BinI* | | || | Bpu10I | | || | DdeI | | || XhoII | | || BamHI | | || MboI | | |NlaIV | | |Hin4I | | |Hin4I | | |DpnI | | BstKTI | BinI* TspRI BsrI K I N E K L I N E N E K E P V D P K Q Q R * M K N * * M R M R K N Q W I L S N K D K * K T D K * E * E R T S G S * A T R ----:----|----:----|----:----|----:----|----:----|----:----| F I F S F S I F S F S F S G T S G L C C F S L H F V S L H S H S L V L P D * A V L Y I F F Q Y I L I L F F W H I R L L L Csp6I MboII |RsaI BbvII* || Hin4I | FatI || Hin4I | AflIII || | Hin4I | BspLU11I* || | Hin4I | |CviAII || | | MaeII | || MboII || | | |MaeIII | || BbvII* || | | |Tsp45I | || |NspI || | | || SetI | || |Hin4I TfiI || | | || TaiI | || |Hin4I HinfI || | | || | HphI BaeI | || |NlaIII \ \\ \ \ \\ \ \ \ \ \\ \\ GATTCGGTATCGGCAGTCGTACAGACAACTAAACGTGACAATAAATCACCGATACACATG 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGCCATAGCCGTCAGCATGTCTGTTGATTTGCACTGTTATTTAGTGGCTATGTGTAC / /// / / / /// / ////// HinfI ||| Hin4I | | ||Tsp45I | |||||BspLU11I* TfiI ||| Hin4I | | ||MaeIII | |||||AflIII ||Csp6I | | |BaeI | |||||FatI |RsaI | | HphI | ||||CviAII Hin4I | MaeII | |||MboII Hin4I TaiI | ||BbvII* SetI | |NlaIII | |NspI | Hin4I | Hin4I MboII D S V S A V V Q T T K R D N K S P I H M I R Y R Q S Y R Q L N V T I N H R Y T C F G I G S R T D N * T * Q * I T D T H V ----:----|----:----|----:----|----:----|----:----|----:----| S E T D A T T C V V L R S L L D G I C M L N P I P L R V S L * V H C Y I V S V C I R Y R C D Y L C S F T V I F * R Y V H MboII | Eco57I | Eco57MI | | BaeI AluI | | | MboII CviJI | | | | BccI MwoI TspEI MboII \ \ \ \ \ \ \ \ TCTTCGTCTTCTTTACCATCTTCTGCTTCTTCAGCGTTTTTTAGATTGAAGAAATTGAAG 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGCAGAAGAAATGGTAGAAGACGAAGAAGTCGCAAAAAATCTAACTTCTTTAACTTC / /// / / / / /// BbvII* ||| MboII | MwoI | ||CviJI ||Eco57MI BccI | ||AluI ||Eco57I | |MboII |BaeI | SetI MboII TspEI S S S S L P S S A S S A F F R L K K L K L R L L Y H L L L L Q R F L D * R N * S F V F F T I F C F F S V F * I E E I E A ----:----|----:----|----:----|----:----|----:----|----:----| D E D E K G D E A E E A N K L N F F N F T K T K K V M K Q K K L T K * I S S I S R R R R * W R R S R * R K K S Q L F Q L TatI Tsp4CI* FatI MfeI |Csp6I |CviAII SetI NdeI TspEI ||RsaI || NlaIII \ \ \ \\\ \\ \ CTCTTGGATATTGACCCATACACATATGCCACACAATTGACTGTACTTGAACATGACTTA 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| GAGAACCTATAACTGGGTATGTGTATACGGTGTGTTAACTGACATGAACTTGTACTGAAT / / / /// / // NdeI | | ||TatI | |FatI | | |Csp6I | CviAII | | RsaI NlaIII | Tsp4CI* TspEI MfeI L L D I D P Y T Y A T Q L T V L E H D L S W I L T H T H M P H N * L Y L N M T Y L G Y * P I H I C H T I D C T * T * L I ----:----|----:----|----:----|----:----|----:----|----:----| S K S I S G Y V Y A V C N V T S S C S K A R P Y Q G M C M H W V I S Q V Q V H S E Q I N V W V C I G C L Q S Y K F M V * DdeI SauI* |SetI FatI ||Hpy178III* |CviAII ||| MboI || NlaIII ||| | DpnI || | Acc65I ||| | |BstKTI || | HgiCI* ||| | || MnlI || | |Csp6I ||| | || | BinI* || | ||RsaI ||| | || | |BspCNI || | ||NlaIV ||| | || | ||BseMII BsmI || | ||| KpnI TaqII \\\ \ \\ \ \\\ \ \\ \ \\\ \ \ TACCTCAGGATCACTATGTTTGAATGCTTGGATAGGGCATGGGGTACCAAGTATTGTAAT 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGAGTCCTAGTGATACAAACTTACGAACCTATCCCGTACCCCATGGTTCATAACATTA / //// / /// / / // / /// / SetI |||| | ||BinI* BsmI | || | ||| TaqII |||| | |BseMII | || | ||HgiCI* |||| | BspCNI | || | ||Acc65I |||| MnlI | || | |Csp6I |||| MboI | || | NlaIV |||DpnI | || | RsaI ||BstKTI | || KpnI |Hpy178III* | |FatI SauI* | CviAII DdeI NlaIII Y L R I T M F E C L D R A W G T K Y C N T S G S L C L N A W I G H G V P S I V I P Q D H Y V * M L G * G M G Y Q V L * Y ----:----|----:----|----:----|----:----|----:----|----:----| Y R L I V I N S H K S L A H P V L Y Q L I G * S * * T Q I S P Y P M P Y W T N Y V E P D S H K F A Q I P C P T G L I T I AluI ApoI CviJI Hpy188I TspEI | SetI TspEI \ \ \ \ \ ATGGGTGGTTCTCCGAACATTACGAAATTTATAGCTAATGCTAATACGCTAACTAATTTT 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCACCAAGAGGCTTGTAATGCTTTAAATATCGATTACGATTATGCGATTGATTAAAA / / / / / Hpy188I | | CviJI TspEI | | AluI | SetI TspEI ApoI M G G S P N I T K F I A N A N T L T N F W V V L R T L R N L * L M L I R * L I L G W F S E H Y E I Y S * C * Y A N * F C ----:----|----:----|----:----|----:----|----:----|----:----| I P P E G F M V F N I A L A L V S V L K Y P H N E S C * S I * L * H * Y A L * N H T T R R V N R F K Y S I S I R * S I K Hpy178III* | AflIII | | MaeII | | | SetI | | | TaiI | | | | TspEI | | | | | MseI SspI \ \ \ \ \ \ \ GTTTCTCATACCATTGTAAAACAGGCAGATGTCAAGACACGTTCAAAATTAACGCAATAT 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGAGTATGGTAACATTTTGTCCGTCTACAGTTCTGTGCAAGTTTTAATTGCGTTATA / / / // / | | AflIII |MseI SspI | | MaeII TspEI | TaiI | SetI Hpy178III* V S H T I V K Q A D V K T R S K L T Q Y F L I P L * N R Q M S R H V Q N * R N I F S Y H C K T G R C Q D T F K I N A I F ----:----|----:----|----:----|----:----|----:----|----:----| T E * V M T F C A S T L V R E F N V C Y Q K E Y W Q L V P L H * S V N L I L A I N R M G N Y F L C I D L C T * F * R L I MaeIII | Tsp4CI* | | BseYI MboII | | | GsaI |TspEI \ \ \ \ \\ TTTGTTACCGTTGCCCAGCATTGTAAAGAGTTGAATAATTTTTCTTCAATGACTGCCATA 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| AAACAATGGCAACGGGTCGTAACATTTCTCAACTTATTAAAAAGAAGTTACTGACGGTAT / / / / / | | BseYI MboII TspEI | GsaI Tsp4CI* MaeIII F V T V A Q H C K E L N N F S S M T A I L L P L P S I V K S * I I F L Q * L P * C Y R C P A L * R V E * F F F N D C H S ----:----|----:----|----:----|----:----|----:----|----:----| K T V T A W C Q L S N F L K E E I V A M N Q * R Q G A N Y L T S Y N K K L S Q W K N G N G L M T F L Q I I K R * H S G Y FatI |CviAII || NlaIII || | BseMII AciI MnlI || | |BspCNI \ \ \\ \ \\ GTGTCCGCTTTGTATTCCTCCCCAATCTACCGACTGAAAAAGACATGGGATTTAGTTTCC 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| CACAGGCGAAACATAAGGAGGGGTTAGATGGCTGACTTTTTCTGTACCCTAAATCAAAGG / / / // // / AciI MnlI | || || TspRI | || |BspCNI | || BseMII | |FatI | CviAII NlaIII V S A L Y S S P I Y R L K K T W D L V S C P L C I P P Q S T D * K R H G I * F P V R F V F L P N L P T E K D M G F S F H ----:----|----:----|----:----|----:----|----:----|----:----| T D A K Y E E G I * R S F F V H S K T E L T R K T N R G L R G V S F S M P N L K H G S Q I G G W D V S Q F L C P I * N G PleI AsuI* AvaII DraII PpuMI |MlyI |BmgT120I || SetI || | Hpy188I || | | Hin4II* || | | | SetI || | | | | MboII DdeI || | | | | | SetI |Hin4II* || | | | | | | Eco57I ||HinfI || | | | | | | Eco57MI ||| TspRI || | | | | | | | TfiI ApoI ||| |TaqI || | | | | | | | HinfI TspEI \\\ \\ \\ \ \ \ \ \ \ \ \ \ ACTGAGTCGAAGGACCTTCTGAAGAACCTAAACAACCTTATGGATTCCAAGAGAAATTTT 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTCAGCTTCCTGGAAGACTTCTTGGATTTGTTGGAATACCTAAGGTTCTCTTTAAAA / / / / /// / // / / / / / | | | | ||| | |SetI | | Eco57MI HinfI TspEI | | | | ||| | Hin4II* | | Eco57I TfiI ApoI | | | | ||| Hpy188I | SetI | | | | ||PpuMI MboII | | | | ||DraII | | | | ||AvaII | | | | ||AsuI* | | | | |BmgT120I | | | | PleI | | | | MlyI | | | | SetI | | | TaqI | | HinfI | DdeI Hin4II* T E S K D L L K N L N N L M D S K R N F L S R R T F * R T * T T L W I P R E I L * V E G P S E E P K Q P Y G F Q E K F C ----:----|----:----|----:----|----:----|----:----|----:----| V S D F S R R F F R F L R I S E L L F K W Q T S P G E S S G L C G * P N W S F N S L R L V K Q L V * V V K H I G L S I K AluI CviJI MaeII TspGWI | SetI | SetI | TaiI | BinI* | | FatI | | MboI | | CviRI* | | | DpnI | | |CviAII | | | |BstKTI | | || NspI | | | || MaeIII | | || NlaIII | | | || Tsp45I | | || | TspGWI BsiYI* \ \ \ \\ \ \ \ \\ \ \ \ GTGAAGTATAGAGAGCTGTTGCGATCCGTGACGGACGTTGCATGTGTTCCCTTTTTTGGT 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| CACTTCATATCTCTCGACAACGCTAGGCACTGCCTGCAACGTACACAAGGGAAAAAACCA / / / // / / / / / // / | | | || MboI | | | | |TspGWI BsiYI* | | | |DpnI | | | | |FatI | | | BstKTI | | | | CviAII | | BinI* | | | CviRI* | CviJI | | | NlaIII | AluI | | | NspI TspGWI | | MaeII SetI | TaiI | SetI Tsp45I MaeIII V K Y R E L L R S V T D V A C V P F F G * S I E S C C D P * R T L H V F P F L V E V * R A V A I R D G R C M C S L F W C ----:----|----:----|----:----|----:----|----:----|----:----| T F Y L S S N R D T V S T A H T G K K P Q S T Y L A T A I R S P R Q M H E R K Q H L I S L Q Q S G H R V N C T N G K K T AccI |BssNAI |Hpy166II || SetI || | MmeI MaeII || | Hpy188I | SetI Hpy188I Eco57I || | | MseI | TaiI | MboII TspEI Eco57MI \\ \ \ \ \ \ \ \ \ \ GTATACCTATCTGATTTAACATTTACGTTTGTCGGAAACCCAGATTTTCTTCACAATTCA 4390 4400 4410 4420 4430 4440 ----:----|----:----|----:----|----:----|----:----|----:----| CATATGGATAGACTAAATTGTAAATGCAAACAGCCTTTGGGTCTAAAAGAAGTGTTAAGT // // / / / / / / |AccI || MseI | MaeII | MboII Eco57MI |SetI |Hpy188I TaiI Hpy188I Eco57I | MmeI SetI TspEI Hpy166II BssNAI V Y L S D L T F T F V G N P D F L H N S Y T Y L I * H L R L S E T Q I F F T I Q I P I * F N I Y V C R K P R F S S Q F N ----:----|----:----|----:----|----:----|----:----|----:----| T Y R D S K V N V N T P F G S K R * L E H I G I Q N L M * T Q R F G L N E E C N Y V * R I * C K R K D S V W I K K V I * TspEI | PsiI MnlI CspCI MnlI | | HindIII \ \ \ \ \ \ ACCAACATAATAAACTTCAGCAAGAGGACTAAAATCGCAAATATAGTGGAGGAAATTATA 4450 4460 4470 4480 4490 4500 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTGTATTATTTGAAGTCGTTCTCCTGATTTTAGCGTTTATATCACCTCCTTTAATAT / / / //// MnlI CspCI MnlI |||SetI ||CspCI |PsiI TspEI T N I I N F S K R T K I A N I V E E I I P T * * T S A R G L K S Q I * W R K L * Q H N K L Q Q E D * N R K Y S G G N Y K ----:----|----:----|----:----|----:----|----:----|----:----| V L M I F K L L L V L I A F I T S S I I L W C L L S * C S S * F R L Y L P P F * G V Y Y V E A L P S F D C I Y H L F N Y CspCI |AluI |CviJI || SetI BseGI || |MseI | Hpy188I || ||AhaIII* AluI | | FokI || ||| TfiI CviJI | | |HgaI || ||| HinfI | SetI | | ||Tsp4CI* \\ \\\ \ \ \ \ \ \\\ AGCTTTAAAAGATTCCATTACAAGCTGAAACGATTGGATGATATTCAGACCGTTATAGAA 4510 4520 4530 4540 4550 4560 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAAATTTTCTAAGGTAATGTTCGACTTTGCTAACCTACTATAAGTCTGGCAATATCTT / / // / / / / / / / / | | |MseI HinfI | CviJI BseGI | | | HgaI | | AhaIII* TfiI | AluI | | FokI | HindIII SetI | Tsp4CI* CviJI Hpy188I AluI S F K R F H Y K L K R L D D I Q T V I E A L K D S I T S * N D W M I F R P L * K L * K I P L Q A E T I G * Y S D R Y R S ----:----|----:----|----:----|----:----|----:----|----:----| L K L L N W * L S F R N S S I * V T I S L S * F I G N C A S V I P H Y E S R * L A K F S E M V L Q F S Q I I N L G N Y F CviRI* BslFI TspEI BtsI | TspRI NlaIV \ \ \ \ \ \ GCGTCTTTGGAAAATGTCCCCCACATTGAAAAGCAGTATCAATTATCACTGCAAGTGGAA 4570 4580 4590 4600 4610 4620 ----:----|----:----|----:----|----:----|----:----|----:----| CGCAGAAACCTTTTACAGGGGGTGTAACTTTTCGTCATAGTTAATAGTGACGTTCACCTT / / / / BslFI TspEI CviRI* NlaIV TspRI BtsI A S L E N V P H I E K Q Y Q L S L Q V E R L W K M S P T L K S S I N Y H C K W N V F G K C P P H * K A V S I I T A S G T ----:----|----:----|----:----|----:----|----:----|----:----| A D K S F T G W M S F C Y * N D S C T S L T K P F H G G C Q F A T D I I V A L P R R Q F I D G V N F L L I L * * Q L H F Csp6I |RsaI || MboII || |FatI || ||CviAII || |||Cac8I || |||| SphI || |||| NspI || |||| NlaIII || |||| | MwoI || |||| | | NheI || |||| | | |MaeI MboI || |||| | | ||Cac8I | DpnI || |||| | | ||| AciI | |BstKTI || |||| | | ||| BmtI | |BsiYI* || |||| | | ||| | BarI | ||Hpy178III* || |||| | | ||| | Csp6I | ||| BarI || |||| | | ||| | |RsaI \ \\\ \ \\ \\\\ \ \ \\\ \ \\ CCGAGATCAGGAAACACCAAAGGCAGTACGCATGCTTCTTCTGCTAGCGGTACAAAAACT 4630 4640 4650 4660 4670 4680 ----:----|----:----|----:----|----:----|----:----|----:----| GGCTCTAGTCCTTTGTGGTTTCCGTCATGCGTACGAAGAAGACGATCGCCATGTTTTTGA /// / / / // / /// / / /// / // ||| | | BarI || | ||| MwoI | ||| | |Csp6I ||| | Hpy178III* || | ||FatI | ||| | RsaI ||| MboI || | |CviAII | ||| AciI ||DpnI || | Cac8I | ||NheI |BstKTI || NlaIII | |MaeI BsiYI* || NspI | Cac8I || SphI | BarI |Csp6I BmtI |MboII RsaI P R S G N T K G S T H A S S A S G T K T R D Q E T P K A V R M L L L L A V Q K L E I R K H Q R Q Y A C F F C * R Y K N C ----:----|----:----|----:----|----:----|----:----|----:----| G L D P F V L P L V C A E E A L P V F V V S I L F C W L C Y A H K K Q * R Y L F R S * S V G F A T R M S R R S A T C F S AluI CviJI CviRI* |MaeI | ApoI ApoI ||SetI | TspEI DdeI TspEI TspEI ||| SetI \ \ \ \ \ \\\ \ GCAAAATTCCTAAGTGAATTTACAGATGATAAAAATGGCAATTTTTTGAAGCTAGGTAAG 4690 4700 4710 4720 4730 4740 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTTAAGGATTCACTTAAATGTCTACTATTTTTACCGTTAAAAAACTTCGATCCATTC / / / / / / / // CviRI* | DdeI TspEI TspEI | | |MaeI TspEI ApoI | | SetI ApoI | CviJI | AluI SetI A K F L S E F T D D K N G N F L K L G K Q N S * V N L Q M I K M A I F * S * V R K I P K * I Y R * * K W Q F F E A R * E ----:----|----:----|----:----|----:----|----:----|----:----| A F N R L S N V S S L F P L K K F S P L Q L I G L H I * L H Y F H C N K S A L Y C F E * T F K C I I F I A I K Q L * T L MaeI | MnlI | | SetI | | |Hin4II* SetI | | || TaqI \ \ \ \\ \ AAAAAACCTCCTTCTAGGTTATTTCGATAA 4750 4760 4770 ----:----|----:----|----:----| TTTTTTGGAGGAAGATCCAATAAAGCTATT / // / / SetI || | TaqI || Hin4II* |MnlI |MaeI SetI K K P P S R L F R * K N L L L G Y F D X K T S F * V I S I X ----:----|----:----|----:----| F F G G E L N N R Y S F V E K * T I E I F F R R R P * K S L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 5 FblI,XmiI AciI 8 BspACI,SsiI AflIII 4 AhaIII* 5 DraI AjuI 2 AlfI 2 AloI 3 AluI 17 AluBI AlwNI 1 CaiI ApaI 1 ApoI 25 AcsI,XapI AsuI* 8 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 6 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BarI 1 BbvCI 1 BbvI 7 BseXI,BstV1I,Lsp1109I BbvII* 5 BpiI,BpuAI,BstV2I,BbsI BccI 8 Bce83I* 2 BpuEI BceAI 2 BciVI 3 BfuI BclI 2 FbaI,Ksp22I BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglII 2 BinI* 6 AlwI,BspPI,AclWI BisI 9 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 9 BmgT120I 8 BmtI 1 BspOI Bpu10I 2 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsaXI 3 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 7 BstF5I,BtsCI BseMII 12 BseRI 1 BseSI 1 BaeGI,BstSLI BseYI 1 BsgI 1 BsiYI* 6 Bsc4I,BseLI,BslI,AfiI BslFI 4 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp120I 1 PspOMI Bsp1407I 2 BsrGI,BstAUI BspCNI 12 BspHI 3 CciI,PagI,RcaI BspLU11I* 2 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrDI 2 BseMI,Bse3DI BsrI 7 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BssNAI 3 Bst1107I,BstZ17I BstAPI 2 BstKTI 15 BtrI 1 BmgBI,AjiI BtsI 2 Cac8I 6 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 2 AcoI,EaeI ClaI 4 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 12 CviQI,RsaNI CspCI 1 CviAII 15 CviJI 31 CviKI-1 CviRI* 12 HpyCH4V DdeI 16 BstDEI,HpyF3I DpnI 15 MalI DraII 4 EcoO109I DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Ecl136II 2 EcoICRI Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 5 AcuI Eco57MI 7 EcoNI 2 BstENI,XagI EcoP15I 1 EcoRI 2 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI FalI 4 FatI 15 FauI 2 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 7 GlaI 3 GsaI 1 GsuI 2 BpmI HaeII 2 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 5 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 3 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 10 Hin4II* 10 HpyAV Hin6I 3 HinP1I,HspAI HindII 4 HincII HindIII 1 HinfI 16 HpaI 2 KspAI HpaII 3 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 16 Hpy8I Hpy178III* 18 Hpy188III Hpy188I 28 Hpy99I 2 KpnI 1 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 10 FspBI,BfaI,XspI MaeII 8 HpyCH4IV MaeIII 12 MboI 15 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 28 MfeI 4 MunI MlyI 4 SchI MmeI 6 MnlI 28 MseI 36 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 8 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 1 FauNDI NheI 1 AsuNHI NlaIII 15 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NspI 5 BstNSI,XceI PleI 4 PpsI PpiI 1 PpuMI 2 Psp5II,PspPPI PsiI 2 AanI PsrI 1 PstI 2 RsaI 12 AfaI SacI 2 Psp124BI,SstI SapI 2 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 54 SfaNI 4 LweI SfeI* 5 BstSFI,SfcI,BfmI SmlI 2 SmoI SpeI 2 BcuI,AhlI SphI 1 PaeI,BbuI SspI 4 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 8 TaqI 15 TaqII 4 TatI 6 TauI 2 TfiI 12 PfeI TseI 7 ApeKI TsoI 2 Tsp45I 6 NmuCI Tsp4CI* 19 HpyCH4III,TaaI,Bst4CI TspDTI 24 TspEI 63 TasI,Tsp509I,Sse9I TspGWI 5 TspRI 7 TscAI TstI 2 Tth111I 2 PflFI,PsyI,AspI VspI 3 PshBI,AseI XcmI 1 XhoII 5 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AcyI AflII AgeI ApaLI AscI AvaI AvrII BcgI BdaI BglI BmeT110I BplI BsePI BsiI* BspMII* BsrBI BstEII BstXI BtgZI Cfr10I Cfr9I DinI DraIII Eam1105I EciI EcoT22I EgeI EheI EspI* FseI FspAI KasI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NgoMIV NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PmaCI PmeI PshAI PspXI PvuI PvuII RsrII SacII SalI SanDI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI XbaI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769