Restriction Map of THI7/YLR237W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

THI7/YLR237W on chromosome XII from coordinates 612367 to 614163.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.28189

BssKI EcoRII |SecI* ||ScrFI ApoI ||BseBI TspEI GsuI ||BsmAI | Hin4I Eco57MI ||| CviJI | Hin4I \ \\\ \ \ \ ATGAGTTTCGGTAGTAAAGTCTCCAGGGCTTTGAGATTTTTGGAAATTCCTGTCAAAGAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCAAAGCCATCATTTCAGAGGTCCCGAAACTCTAAAAACCTTTAAGGACAGTTTCTG / / // / / Eco57MI | |BsmAI | TspEI GsuI | |CviJI | ApoI | EcoRII Hin4I | BssKI Hin4I | SecI* BseBI ScrFI M S F G S K V S R A L R F L E I P V K D * V S V V K S P G L * D F W K F L S K T E F R * * S L Q G F E I F G N S C Q R Q ----:----|----:----|----:----|----:----|----:----|----:----| X L K P L L T E L A K L N K S I G T L S X S N R Y Y L R W P K S I K P F E Q * L H T E T T F D G P S Q S K Q F N R D F V SfaNI | Hpy178III* | | Hin4I | | Hin4I | | | BssKI | | | | HpaII | | | | ScrFI | | | | CauII* | | | | | MboII | | | | | | CviRI* | | | | | | | SetI | | | | | | | | MseI CviJI \ \ \ \ \ \ \ \ \ \ AGGGCATCTGTGAGTTTCTTGAAGAACCCGGATTTGCAACCTATTAAGTCGGCTAACCAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCGTAGACACTCAAAGAACTTCTTGGGCCTAAACGTTGGATAATTCAGCCGATTGGTT // / //// / / / / / || | |||| | SetI MseI CviJI BsiYI* || | |||| CviRI* || | |||MboII || | ||BssKI || | |HpaII || | CauII* || | ScrFI || Hpy178III* |SfaNI Hin4I Hin4I R A S V S F L K N P D L Q P I K S A N Q G H L * V S * R T R I C N L L S R L T K G I C E F L E E P G F A T Y * V G * P N ----:----|----:----|----:----|----:----|----:----|----:----| L A D T L K K F F G S K C G I L D A L W C P M Q S N R S S G P N A V * * T P * G P C R H T E Q L V R I Q L R N L R S V L FatI Csp6I |CviAII TspRI ||BsiYI* |RsaI ||| NlaIII ||FatI ||| | TsoI TspEI CviRI* |||CviAII \\\ \ \ \ \ \\\\ ACATGGGGGTTCTGGTCTAATTTTGCATATTGGGGTGTTATGTCCTTTTCAGTGGGTACA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGTACCCCCAAGACCAGATTAAAACGTATAACCCCACAATACAGGAAAAGTCACCCATGT / // / / / / // / | || TsoI | CviRI* TspRI || BsgI | |FatI TspEI |NlaIII | CviAII |Csp6I NlaIII RsaI T W G F W S N F A Y W G V M S F S V G T H G G S G L I L H I G V L C P F Q W V H M G V L V * F C I L G C Y V L F S G Y M ----:----|----:----|----:----|----:----|----:----|----:----| V H P N Q D L K A Y Q P T I D K E T P V F M P T R T * N Q M N P H * T R K L P Y C P P E P R I K C I P T N H G K * H T C FokI |MwoI || Ksp632I* BsgI || |CviRI* NlaIII || || MnlI | MboII || || |MaeI | | BseGI || || || DraIII MseI Csp6I | | |MmeI || || || | SetI | MaeIII |RsaI \ \ \\ \\ \\ \\ \ \ \ \ \\ TGGATGAGTGCCTCTTCTGCACTAGGTGTTGGATTAAGTTACCCAGAAACCATTGGTACA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTACTCACGGAGAAGACGTGATCCACAACCTAATTCAATGGGTCTTTGGTAACCATGT // / // / ////// / / // || | |MmeI MwoI |||||MaeI MseI MaeIII |Csp6I || | BseGI ||||SetI RsaI || MboII |||DraIII |FatI ||Ksp632I* CviAII |MnlI CviRI* FokI W M S A S S A L G V G L S Y P E T I G T G * V P L L H * V L D * V T Q K P L V H D E C L F C T R C W I K L P R N H W Y I ----:----|----:----|----:----|----:----|----:----|----:----| H I L A E E A S P T P N L * G S V M P V M S S H R K Q V L H Q I L N G L F W Q Y P H T G R R C * T N S * T V W F G N T C BssKI EcoRII | ScrFI HindII | BseBI Hpy166II TsoI | | MaeIII Hpy99I | HphI |BsiI* | | | Hin4II* \ \ \ \\ \ \ \ \ TTTATCGTCGGTGATGTGTTGACCATTATTTTCACATTGGCAAACTCGTGTCCTGGTTAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAATAGCAGCCACTACACAACTGGTAATAAAAGTGTAACCGTTTGAGCACAGGACCAATG / // / / / / // Hpy99I |HphI TsoI | | | |MaeIII Hpy166II | | | Hin4II* HindII | | EcoRII | | BssKI | BseBI | ScrFI BsiI* F I V G D V L T I I F T L A N S C P G Y L S S V M C * P L F S H W Q T R V L V T Y R R * C V D H Y F H I G K L V S W L R ----:----|----:----|----:----|----:----|----:----|----:----| N I T P S T N V M I K V N A F E H G P * M * R R H H T S W * K * M P L S T D Q N K D D T I H Q G N N E C Q C V R T R T V AsuI* |CviJI |HaeIII |BmgT120I BsrI || TfiI DrdI || HinfI | SetI || | PsrI Tsp4CI* \ \ \\ \ \ \ GACTGGAAGGTCGGTTTCACTTTGGCCCAAAGATTCGTCTTTGGTATTTACGGTTCTGCC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTGACCTTCCAGCCAAAGTGAAACCGGGTTTCTAAGCAGAAACCATAAATGCCAAGACGG / / /// / / / | SetI ||| | HinfI Tsp4CI* DrdI ||| | TfiI BsrI ||| PsrI ||AsuI* |BmgT120I HaeIII CviJI D W K V G F T L A Q R F V F G I Y G S A T G R S V S L W P K D S S L V F T V L P L E G R F H F G P K I R L W Y L R F C L ----:----|----:----|----:----|----:----|----:----|----:----| S Q F T P K V K A W L N T K P I * P E A R S S P R N * K P G F I R R Q Y K R N Q V P L D T E S Q G L S E D K T N V T R G HindII Hpy166II | AsuI* | AvaII | |TaqII | |NlaIV PsrI | |BmgT120I |Hin4II* | || BdaI || BdaI | || BdaI || BdaI | || | PflMI || |Hpy188I | || | BsiYI* || ||ApoI | || | |XcmI || ||TspEI | || | ||MnlI \\ \\\ \ \\ \ \\\ TTCGGTATCATCATCAGAATTTTGATGAGTATTGTCAACTACGGGTCCAACGCTTGGGTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCCATAGTAGTAGTCTTAAAACTACTCATAACAGTTGATGCCCAGGTTGCGAACCCAC / / / / / / / /// / // PsrI | | | TspEI | | ||| | |MnlI | | | ApoI | | ||| | XcmI | | Hpy188I | | ||| BsiYI* | BdaI | | ||| PflMI | BdaI | | ||AvaII Hin4II* | | ||AsuI* | | ||BdaI | | ||BdaI | | |BmgT120I | | NlaIV | TaqII Hpy166II HindII F G I I I R I L M S I V N Y G S N A W V S V S S S E F * * V L S T T G P T L G W R Y H H Q N F D E Y C Q L R V Q R L G G ----:----|----:----|----:----|----:----|----:----|----:----| K P I M M L I K I L I T L * P D L A Q T R R Y * * * F K S S Y Q * S R T W R K P E T D D D S N Q H T N D V V P G V S P H Hin4I Hin4I |MboI |TspDTI || DpnI || |BstKTI || || TfiI || || HinfI || || | HphI || || | FatI || || | |CviAII Hin4I || || | || NlaIII Hin4I || || | || | BsmAI CviRI* SetI MmeI || || | || | Eco31I | SetI \ \ \\ \\ \ \\ \ \ \ \ GGAGGTCTTTGTATCAATATGATCTTGGATTCATGGTCTCACCATTATTTGCACCTGCCA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CCTCCAGAAACATAGTTATACTAGAACCTAAGTACCAGAGTGGTAATAAACGTGGACGGT / / / / // / // // // // SetI MmeI | | || MboI || |FatI || |SetI | | |DpnI || CviAII || CviRI* | | BstKTI |NlaIII |Hin4I | TspDTI |HinfI |Hin4I Hin4I |TfiI Eco31I Hin4I HphI BsmAI G G L C I N M I L D S W S H H Y L H L P E V F V S I * S W I H G L T I I C T C Q R S L Y Q Y D L G F M V S P L F A P A K ----:----|----:----|----:----|----:----|----:----|----:----| P P R Q I L I I K S E H D * W * K C R G P L D K Y * Y S R P N M T E G N N A G A S T K T D I H D Q I * P R V M I Q V Q W AarI TspEI MboII FatI | MseI BspMI TaqI |CviAII | VspI | SetI AsuII || NlaIII | |TspEI MboII \ \ \ \\ \ \ \\ \ AACACCTTATCTTCGAAAGTTGCCATGACCACTAAAGAATTAATTGGTTTTATCATCTTC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTGGAATAGAAGCTTTCAACGGTACTGGTGATTTCTTAATTAACCAAAATAGTAGAAG / / / / / // // / / | | BspMI AsuII | |FatI || | MboII | | AarI TaqI | CviAII || TspEI | SetI NlaIII |VspI MboII |MseI TspEI N T L S S K V A M T T K E L I G F I I F T P Y L R K L P * P L K N * L V L S S S H L I F E S C H D H * R I N W F Y H L P ----:----|----:----|----:----|----:----|----:----|----:----| F V K D E F T A M V V L S N I P K I M K L C R I K S L Q W S W * L I L Q N * * R V G * R R F N G H G S F F * N T K D D E MaeII BsmI FatI |BtrI CviRI* |CviAII MseI || SetI | MaeIII ||TspDTI |TspEI || TaiI | | MseI ||| NlaIII || TspDTI \\ \ \ \ \ \\\ \ \\ \ CACGTCCTTACTGCATTCTGTTACTTAATGAAACCCTACCACATGAACTACATTTTAATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCAGGAATGACGTAAGACAATGAATTACTTTGGGATGGTGTACTTGATGTAAAATTAA / // / / / / / // // / | |MaeII | CviRI* | MseI | |FatI || TspEI | BtrI BsmI MaeIII | CviAII |MseI TaiI TspDTI TspDTI SetI NlaIII H V L T A F C Y L M K P Y H M N Y I L I T S L L H S V T * * N P T T * T T F * F R P Y C I L L L N E T L P H E L H F N L ----:----|----:----|----:----|----:----|----:----|----:----| W T R V A N Q * K I F G * W M F * M K I G R G * Q M R N S L S V R G C S S C K L V D K S C E T V * H F G V V H V V N * N MmeI HphI |AluI MboI |CviJI | DpnI || SetI | |BstKTI || | MwoI \ \\ \\ \ \ TGGTCGTGTGTTGCTACATTTTTCTCTATGTTGGGTATGGTGATCTATTTAGCTAAACAG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ACCAGCACACAACGATGTAAAAAGAGATACAACCCATACCACTAGATAAATCGATTTGTC // / // / / || | || | MwoI || | || CviJI || | || AluI || | |HphI || | |SetI || | MmeI || MboI |DpnI BstKTI W S C V A T F F S M L G M V I Y L A K Q G R V L L H F S L C W V W * S I * L N R V V C C Y I F L Y V G Y G D L F S * T G ----:----|----:----|----:----|----:----|----:----|----:----| Q D H T A V N K E I N P I T I * K A L C K T T H Q * M K R * T P Y P S R N L * V P R T N S C K E R H Q T H H D I * S F L TspRI | CviJI | |BsrI Hpy166II MnlI | |NlaIV CviJI Tsp4CI* TspEI | SetI | BtsI | |TspRI HindIII \ \ \ \ \ \ \ \ \\ \ GCTCACGGTGTTGGAGAATTGTTTACCTCCACTAAATCCACTGCCACTGGCTCCACCAAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGTGCCACAACCTCTTAACAAATGGAGGTGATTTAGGTGACGGTGACCGAGGTGGTTT / / / // // / /// / | Tsp4CI* | |SetI |TspRI TspRI ||NlaIV BsiYI* CviJI | Hpy166II |BtsI |CviJI PflMI TspEI MnlI BsrI SetI A H G V G E L F T S T K S T A T G S T K L T V L E N C L P P L N P L P L A P P K S R C W R I V Y L H * I H C H W L H Q S ----:----|----:----|----:----|----:----|----:----|----:----| A * P T P S N N V E V L D V A V P E V L P E R H Q L I T * R W * I W Q W Q S W W S V T N S F Q K G G S F G S G S A G G F MboI | DpnI | |BstKTI AluI | || Csp6I BssKI CviJI | || |RsaI EcoRII |PflMI | || || TspGWI | ScrFI |BsiYI* | || || | GsuI | BseBI ||SetI | || || | Eco57MI | | SetI ||| CviJI | || || | | BsrI NlaIV | | NlaIV \\\ \ \ \\ \\ \ \ \ \ \ \ \ GCTTGGGCTTGGGTTTATATGATCTCGTACTGGTTCGGTTCCGTTTCTCCAGGTTCCACC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CGAACCCGAACCCAAATATACTAGAGCATGACCAAGCCAAGGCAAAGAGGTCCAAGGTGG / / / // / /// / / // // | | CviJI || | ||| BsrI NlaIV || |NlaIV | HindIII || | ||Eco57MI || EcoRII CviJI || | ||GsuI || BssKI AluI || | |Csp6I |BseBI || | TspGWI |ScrFI || | RsaI SetI || MboI |DpnI BstKTI A W A W V Y M I S Y W F G S V S P G S T L G L G F I * S R T G S V P F L Q V P P L G L G L Y D L V L V R F R F S R F H Q ----:----|----:----|----:----|----:----|----:----|----:----| A Q A Q T * I I E Y Q N P E T E G P E V L K P K P K Y S R T S T R N R K E L N W S P S P N I H D R V P E T G N R W T G G MwoI |AsuI* ||BmgT120I |||CviJI |||Cfr10I |||HaeIII AvaI ||||HpaII XhoI MfeI ||||| Acc65I SmlI TspEI ||||| HgiCI* |TaqI | BsiYI* ||||| |Csp6I |BmeT110I | | MnlI ||||| ||RsaI ||Hpy178III* | | |CviJI ||||| ||NlaIV PpiI ||| NlaIV | | ||PpiI ||||| ||| KpnI \ \\\ \ \ \ \\\ \\\\\ \\\ \ AACCAAAGTGATTACTCGAGATTTGGTTCCTCCAATTGGGCTATCTGGGCCGGTACCATC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGTTTCACTAATGAGCTCTAAACCAAGGAGGTTAACCCGATAGACCCGGCCATGGTAG / // / / /// / / // ///// PpiI || | | ||| | MwoI || ||||HgiCI* || | | ||| CviJI || ||||Acc65I || | | ||MnlI || |||Csp6I || | | |TspEI || ||NlaIV || | | |MfeI || ||RsaI || | | PpiI || |Cfr10I || | BsiYI* || HpaII || NlaIV || KpnI |Hpy178III* |AsuI* |SmlI BmgT120I |XhoI HaeIII |AvaI CviJI BmeT110I TaqI N Q S D Y S R F G S S N W A I W A G T I T K V I T R D L V P P I G L S G P V P S P K * L L E I W F L Q L G Y L G R Y H L ----:----|----:----|----:----|----:----|----:----|----:----| L W L S * E L N P E E L Q A I Q A P V M W G F H N S S I Q N R W N P * R P R Y W V L T I V R S K T G G I P S D P G T G D BccI CviRI* PflMI | MseI BfiI BsiYI* HgiCI* | |TspEI MseI BsrI | MmeI | NlaIV \ \\ \ \ \ \ \ \ TGTGCATTGTTAATTCCAACCACTTTAATCCCAGTTTTTGGTGTTATTGGTGCCTCCACC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| ACACGTAACAATTAAGGTTGGTGAAATTAGGGTCAAAAACCACAATAACCACGGAGGTGG // / / / / / / / / / / |BccI | TspEI | | BsrI | MmeI | | SetI CviRI* MseI | MseI BsiYI* | HgiCI* BfiI PflMI NlaIV C A L L I P T T L I P V F G V I G A S T V H C * F Q P L * S Q F L V L L V P P P C I V N S N H F N P S F W C Y W C L H L ----:----|----:----|----:----|----:----|----:----|----:----| Q A N N I G V V K I G T K P T I P A E V R H M T L E L W K L G L K Q H * Q H R W T C Q * N W G S * D W N K T N N T G G G Tsp4CI* SetI | Hpy166II MaeIII | |SfaNI Tsp45I | || SspI BseGI FokI HindII | MnlI | || | HphI |MboII EcoRV Hpy166II \ \ \ \\ \ \ \\ \ \ TGTGACAAACTATACGGTGAACAATATTGGATGCCTATGGATATCTTCAACCATTGGTTG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ACACTGTTTGATATGCCACTTGTTATAACCTACGGATACCTATAGAAGTTGGTAACCAAC / / / / // / / / / / / | Tsp45I | | || HphI | MboII | FokI Hpy166II | MaeIII | | |SspI BseGI EcoRV HindII MnlI | | SfaNI | Hpy166II Tsp4CI* C D K L Y G E Q Y W M P M D I F N H W L V T N Y T V N N I G C L W I S S T I G * * Q T I R * T I L D A Y G Y L Q P L V D ----:----|----:----|----:----|----:----|----:----|----:----| Q S L S Y P S C Y Q I G I S I K L W Q N R H C V I R H V I N S A * P Y R * G N T T V F * V T F L I P H R H I D E V M P Q SfeI* | CviRI* | | PstI | | | SetI | | | | BsiI* | | | | |SduI | | | | |HgiAI* | | | | || Cfr10I AarI | | | | || |HpaII BspMI | | | | || ||MboII TspDTI \ \ \ \ \ \\ \\\ \ ACAACTAACTATTCTGCAGGTGCTCGTGCCGGTGCGTTCTTCTGTGGTCTTTCATTTGTC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGATTGATAAGACGTCCACGAGCACGGCCACGCAAGAAGACACCAGAAAGTAAACAG / / /// / / / // / | | ||| HgiAI* | | |Cfr10I TspDTI | | ||| SduI | | HpaII | | ||SfeI* | MboII | | |SetI BsiI* | | CviRI* | PstI BspMI AarI T T N Y S A G A R A G A F F C G L S F V Q L T I L Q V L V P V R S S V V F H L S N * L F C R C S C R C V L L W S F I C P ----:----|----:----|----:----|----:----|----:----|----:----| V V L * E A P A R A P A N K Q P R E N T S L * S N Q L H E H R H T R R H D K M Q C S V I R C T S T G T R E E T T K * K D BccI CfrI | Tsp4CI* | CviJI | |BsiYI* TspRI | Cfr10I | || BsaXI BstXI | HaeIII BsaXI | || | BsrI | MmeI | |HpaII \ \ \\ \ \ \ \ \ \\ CTATCTCAAATGTCCTACACCATCTCCAACTGTGGGTTTGCCAGTGGTATGGATTTGGCC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GATAGAGTTTACAGGATGTGGTAGAGGTTGACACCCAAACGGTCACCATACCTAAACCGG / // / / / / / / BsaXI || | | | MmeI | CfrI || | | BstXI HaeIII || | TspRI CviJI || | BsrI || BsaXI |Tsp4CI* BsiYI* BccI L S Q M S Y T I S N C G F A S G M D L A Y L K C P T P S P T V G L P V V W I W P I S N V L H H L Q L W V C Q W Y G F G R ----:----|----:----|----:----|----:----|----:----|----:----| R D * I D * V M E L Q P N A L P I S K A G I E F T R C W R W S H T Q W H Y P N P * R L H G V G D G V T P K G T T H I Q G SalI |TaqI |AccI ||HindII ||Hpy166II ||| MnlI ||| | Hpy178III* ||| | | HgiCI* ||| | | | NlaIV ||| | | | | SduI ||| | | | | BseSI ||| | | | | | MwoI ||| | | | | | | AciI ||| | | | | | | BisI ||| | | | | | | |BlsI ||| | | | | | | ||FatI ||| | | | | | | ||TauI ||| | | | | | | |||CviAII ||| | | | | | | |||| NspI ||| | | | | | | |||| NlaIII ||| | | | | | | |||| | BssKI ||| | | | | | | |||| | EcoRII ||| | | | | | | |||| | |SecI* ||| | | | | | | |||| | ||ScrFI ||| | | | | | | |||| | ||BseBI ||| | | | | | | |||| | ||BsmAI \\\ \ \ \ \ \ \ \\\\ \ \\\ GGTTTATTACCCAAGTATGTCGACATCAAGAGGGGTGCCCTTTTTGCCGCATGTGTCTCC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAATAATGGGTTCATACAGCTGTAGTTCTCCCCACGGGAAAAACGGCGTACACAGAGG // /// / // / / //// // |Cfr10I ||SalI | || | MwoI |||| |FatI HpaII |AccI | || HgiCI* |||| CviAII |TaqI | |NlaIV |||NlaIII |MnlI | BseSI |||AciI | | SduI |||NspI | Hpy178III* ||BisI Hpy166II |BlsI HindII TauI G L L P K Y V D I K R G A L F A A C V S V Y Y P S M S T S R G V P F L P H V S P F I T Q V C R H Q E G C P F C R M C L L ----:----|----:----|----:----|----:----|----:----|----:----| P K N G L Y T S M L L P A R K A A H T E R N I V W T H R C * S P H G K Q R M H R T * * G L I D V D L P T G K K G C T D G FatI NcoI StyI Hpy178III* SecI* | Tsp4CI* DsaI* | | FatI |CviAII | | BspHI || NlaIII | | |CviAII || | MboII | | |Hpy178III* CviJI || | | MboII Ksp632I* | | || NlaIII \ \\ \ \ \ \ \ \ \\ \ TGGGCTTGTTTGCCATGGAACTTCTACAACTCTTCTTCTACTTTCTTGACTGTCATGAGT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCGAACAAACGGTACCTTGAAGATGTTGAGAAGAAGATGAAAGAACTGACAGTACTCA / // / // / / / / / / // | |BsmAI | || | MboII | | | | |BspHI | |CviJI | || MboII | | | | |FatI | EcoRII | |DsaI* | | | | Hpy178III* | BssKI | |SecI* | | | | CviAII | SecI* | |StyI | | | NlaIII BseBI | |NcoI | | Tsp4CI* ScrFI | |FatI | Hpy178III* | CviAII Ksp632I* NlaIII W A C L P W N F Y N S S S T F L T V M S G L V C H G T S T T L L L L S * L S * V G L F A M E L L Q L F F Y F L D C H E F ----:----|----:----|----:----|----:----|----:----|----:----| Q A Q K G H F K * L E E E V K K V T M L R P K N A M S S R C S K K * K R S Q * S P S T Q W P V E V V R R R S E Q S D H T MlyI PleI FatI | FatI BspHI | BspHI |CviAII Hpy178III* | |CviAII |Hpy178III* | MboI | |Hpy178III* || NlaIII | BclI BdaI | || HinfI || |BdaI | | DpnI BdaI | || NlaIII || |BdaI | | |BstKTI \ \ \\ \ \\ \\ \ \ \\ TCTTTCGGTGTTGTCATGACTCCTATCATTTCTGTCATGATTTGCGATAACTTCTTGATC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAAGCCACAACAGTACTGAGGATAGTAAAGACAGTACTAAACGCTATTGAAGAACTAG / /// // / / // /// / BdaI ||| || HinfI | |BspHI ||| Hpy188I BdaI ||| |BspHI | |FatI ||| BclI ||| |FatI | Hpy178III* ||| MboI ||| Hpy178III* | CviAII ||DpnI ||| CviAII | BdaI |BstKTI ||NlaIII | BdaI Hpy178III* |PleI NlaIII MlyI S F G V V M T P I I S V M I C D N F L I L S V L S * L L S F L S * F A I T S * S F R C C H D S Y H F C H D L R * L L D Q ----:----|----:----|----:----|----:----|----:----|----:----| E K P T T M V G I M E T M I Q S L K K I N K R H Q * S E * * K Q * S K R Y S R S R E T N D H S R D N R D H N A I V E Q D Bce83I* HphI Hpy188I | BccI SmlI | DdeI \ \ \ \ \ \ AGAAAAAGACAATACTCCATCACTAATGCCTTTATTCTCAAGGGTGAATACTATTTCACT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTTTCTGTTATGAGGTAGTGATTACGGAAATAAGAGTTCCCACTTATGATAAAGTGA / / / / | BccI SmlI HphI Bce83I* R K R Q Y S I T N A F I L K G E Y Y F T E K D N T P S L M P L F S R V N T I S L K K T I L H H * C L Y S Q G * I L F H * ----:----|----:----|----:----|----:----|----:----|----:----| L F L C Y E M V L A K I R L P S Y * K V * F F V I S W * * H R * E * P H I S N * S F S L V G D S I G K N E L T F V I E S MseI |HpaI |HindII |Hpy166II || BsrI BssKI || | AluI SecI* || | CviJI | HpaII || | | SetI | ScrFI || | | | MwoI | CauII* || | | | | BssKI | Eam1105I || | | | | EcoRII | | AccI || | | | | |SecI* | | |Hpy166II || | | | | ||ScrFI | | || BssKI || | | | | ||BseBI | | || SexAI || | | | | ||| GsuI | | || EcoRII || | | | | ||| Eco57MI | | || | ScrFI || | | | | ||| | Hin4I | | || | BseBI || | | | | ||| | Hin4I | | || | |SetI \\ \ \ \ \ \\\ \ \ \ \ \\ \ \\ AAGGGTGTTAACTGGAGAGCTATTGTTGCCTGGGTTTGTGGTATGACCCCCGGTCTACCT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCCACAATTGACCTCTCGATAACAACGGACCCAAACACCATACTGGGGGCCAGATGGA / // / / / / / / / /// // / DdeI || | | | MwoI | EcoRII | ||| || BseBI || | | CviJI | BssKI | ||| || ScrFI || | | AluI | SecI* | ||| |AccI || | SetI Eco57MI | ||| |SetI || BsrI BseBI | ||| Hpy166II |MseI ScrFI | ||BssKI Hpy166II Hin4I | |SecI* HindII Hin4I | |HpaII HpaI GsuI | CauII* | ScrFI Eam1105I K G V N W R A I V A W V C G M T P G L P R V L T G E L L L P G F V V * P P V Y L G C * L E S Y C C L G L W Y D P R S T W ----:----|----:----|----:----|----:----|----:----|----:----| L P T L Q L A I T A Q T Q P I V G P R G * P H * S S L * Q Q R P K H Y S G R D V L T N V P S S N N G P N T T H G G T * R BstXI Hin4I | BsrI TspEI Hin4I | TspRI |BsaXI \ \ \ \\ GGTATTGCTTGGGAAGTCAATAATGACTATTTCCACAACACTGGTATTGTCAATTTCTTT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAACGAACCCTTCAGTTATTACTGATAAAGGTGTTGTGACCATAACAGTTAAAGAAA // / / / / |Hin4I BstXI BsrI BsaXI TspEI |Hin4I TspRI EcoRII SexAI BssKI G I A W E V N N D Y F H N T G I V N F F V L L G K S I M T I S T T L V L S I S F Y C L G S Q * * L F P Q H W Y C Q F L L ----:----|----:----|----:----|----:----|----:----|----:----| P I A Q S T L L S * K W L V P I T L K K Q Y Q K P L * Y H S N G C C Q Y Q * N R T N S P F D I I V I E V V S T N D I E K MlyI PleI | MaeIII Hin4II* | Tsp45I |BsaXI | Tsp4CI* || MboI | | MboII || | DpnI BsaXI BseRI | | |HinfI HphI || | |BstKTI Hin4I | MboII \ \ \\ \ \\ \ \\ \ \ \ TACGGTGACTCCTTCTTCTCGTTTTTGATCTCCTTTTTCGTCTATTGGGGACTATGCCTC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCCACTGAGGAAGAAGAGCAAAAACTAGAGGAAAAAGCAGATAACCCCTGATACGGAG /// / // / // // / / / / / ||| | || | || || MboI | BsaXI BseRI MboII ||| | || | || |DpnI Hin4I ||| | || | || BstKTI ||| | || | |Hin4II* ||| | || | BsaXI ||| | || HphI ||| | |HinfI ||| | Tsp45I ||| | MaeIII ||| MboII ||Tsp4CI* |PleI MlyI Y G D S F F S F L I S F F V Y W G L C L T V T P S S R F * S P F S S I G D Y A S R * L L L L V F D L L F R L L G T M P P ----:----|----:----|----:----|----:----|----:----|----:----| * P S E K K E N K I E K K T * Q P S H R K R H S R R R T K S R R K R R N P V I G V T V G E E R K Q D G K E D I P S * A E BslFI | MnlI | Ksp632I* | | MnlI Tsp4CI* | | |BsaXI | FatI | | || Hin4I | |CviAII HgiCI* | | || |TspEI | || NlaIII | NlaIV \ \ \\ \\ \ \\ \ \ \ CTCTTCCCATTCAAAATTACTGTCAAACATGATGACAAAGATTATTATGGTGCCTTTACT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GAGAAGGGTAAGTTTTAATGACAGTTTGTACTACTGTTTCTAATAATACCACGGAAATGA / /// / / / // / / | ||| | | | |FatI | HgiCI* | ||| | | | CviAII NlaIV | ||| | | NlaIII | ||| | Tsp4CI* | ||| TspEI | ||Ksp632I* | |MnlI | Hin4I | BsaXI BslFI MnlI L F P F K I T V K H D D K D Y Y G A F T S S H S K L L S N M M T K I I M V P L L L P I Q N Y C Q T * * Q R L L W C L Y * ----:----|----:----|----:----|----:----|----:----|----:----| R K G N L I V T L C S S L S * * P A K V G R G M * F * Q * V H H C L N N H H R * E E W E F N S D F M I V F I I I T G K S FatI Tsp4CI* |CviAII | ApoI Hin4II* || NlaIII | TspEI | MboII || | NlaIV | |TspRI Hpy188I AciI \ \ \\ \ \ \ \\ \ \ GACGAAGAAGCAAGAAAGAAGGGCATGGTTCCATACAGTGAAATTTCTGAAGAAGAAATC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTTCTTCGTTCTTTCTTCCCGTACCAAGGTATGTCACTTTAAAGACTTCTTCTTTAG / / / // / / / / / / | MboII | || | | Tsp4CI* | Hpy188I MboII Hin4II* | || | TspRI TspEI | || NlaIV ApoI | |FatI | CviAII NlaIII D E E A R K K G M V P Y S E I S E E E I T K K Q E R R A W F H T V K F L K K K S R R S K K E G H G S I Q * N F * R R N P ----:----|----:----|----:----|----:----|----:----|----:----| S S S A L F F P M T G Y L S I E S S S I Q R L L L F S P C P E M C H F K Q L L F V F F C S L L A H N W V T F N R F F F D Cfr10I |HpaII MboII ||CfrI |Hin6I ||| CviJI |FnuDII* ||| HaeIII ||GlaI ||| | BsiI* |||HhaI ||| | | TatI |||MboII ||| | | |Csp6I |||| Eco57I ||| | | ||RsaI CviJI |||| Eco57MI MaeIII ||| | | ||| Hin4II* |NlaIV |||| | Hin4II* | SetI ||| | | ||| | SetI || Hpy188I \\\\ \ \ \ \ \\\ \ \ \\\ \ \ \\ \ CGCGCTTACACATTAGGCGAAGGTTACACTACCGGCCACGAGTACAGACCTGAAGGCTCC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GCGCGAATGTGTAATCCGCTTCCAATGTGATGGCCGGTGCTCATGTCTGGACTTCCGAGG /// / / / / // / / /// / // / ||| | Hin4II* SetI MaeIII || | | ||| SetI || Hpy188I ||| Eco57MI || | | ||Hin4II* || Hpy99I ||| Eco57I || | | ||TatI |NlaIV ||Hin6I || | | |Csp6I CviJI |MboII || | | RsaI |GlaI || | BsiI* FnuDII* || CfrI AciI |Cfr10I HhaI |HaeIII |CviJI HpaII R A Y T L G E G Y T T G H E Y R P E G S A L T H * A K V T L P A T S T D L K A P R L H I R R R L H Y R P R V Q T * R L R ----:----|----:----|----:----|----:----|----:----|----:----| R A * V N P S P * V V P W S Y L G S P E G R K C M L R L N C * R G R T C V Q L S A S V C * A F T V S G A V L V S R F A G Hpy99I MaeI |BseMII | AluI ||BspCNI | CviJI ||| Eco57I | | SetI ||| Eco57MI | | | Hpy188I ||| | DdeI TspDTI | | | | BdaI ||| | |SetI | MmeI | | | | BdaI TspDTI XmnI \\\ \ \\ \ \ \ \ \ \ \ \ \ GACGATGAAATACCTGAGTTGGTCAAAACTAGCTCTGAAAACACCAATGAGTTTGAAATA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTACTTTATGGACTCAACCAGTTTTGATCGAGACTTTTGTGGTTACTCAAACTTTAT // / / // / /// / / / / || | SetI || MmeI ||| | BdaI TspDTI XmnI || Eco57MI |TspDTI ||| | BdaI || Eco57I DdeI ||| Hpy188I |BspCNI ||CviJI BseMII ||AluI |MaeI SetI D D E I P E L V K T S S E N T N E F E I T M K Y L S W S K L A L K T P M S L K * R * N T * V G Q N * L * K H Q * V * N S ----:----|----:----|----:----|----:----|----:----|----:----| S S S I G S N T L V L E S F V L S N S I R R H F V Q T P * F * S Q F C W H T Q F V I F Y R L Q D F S A R F V G I L K F Y TspRI | TseI | AluI TspDTI | CviJI | AciI | |BisI | |BbvI | ||BlsI BdaI | || BsrI | ||SetI BdaI | || |MnlI | ||| DdeI \ \ \\ \\ \ \\\ \ GTTCATCATAAGAATAATGAAAAGCAATCCTCCACCGCCAGTGAAAAAGCTGCTTAG 1750 1760 1770 1780 1790 ----:----|----:----|----:----|----:----|----:----|----:-- CAAGTAGTATTCTTATTACTTTTCGTTAGGAGGTGGCGGTCACTTTTTCGACGAATC / / /// / / //// / BdaI | ||| BbvI | |||| DdeI BdaI | ||MnlI | |||TseI | |AciI | ||BisI | TspRI | |BlsI | BsrI | CviJI TspDTI | AluI SetI V H H K N N E K Q S S T A S E K A A * F I I R I M K S N P P P P V K K L L X S S * E * * K A I L H R Q * K S C L X ----:----|----:----|----:----|----:----|----:----|----:-- T * * L F L S F C D E V A L S F A A * L E D Y S Y H F A I R W R W H F L Q K N M M L I I F L L G G G G T F F S S L # Enzymes that cut Frequency Isoschizomers AarI 2 Acc65I 1 Asp718I AccI 2 FblI,XmiI AciI 3 BspACI,SsiI AluI 5 AluBI ApoI 3 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 1 BseXI,BstV1I,Lsp1109I BccI 3 Bce83I* 1 BpuEI BclI 1 FbaI,Ksp22I BdaI 6 BfiI 1 BmrI,BmuI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmeT110I 1 BmgT120I 3 BsaXI 3 BseBI 6 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 1 BseRI 1 BseSI 1 BaeGI,BstSLI BsgI 1 BsiI* 3 BssSI,Bst2BI,BauI BsiYI* 6 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BspHI 3 CciI,PagI,RcaI BspMI 2 BfuAI,Acc36I,BveI BsrI 8 BseNI,Bse1I,BsrSI BssKI 8 BstSCI,StyD4I BstKTI 5 BstXI 2 BtrI 1 BmgBI,AjiI BtsI 1 CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr10I 4 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI Csp6I 5 CviQI,RsaNI CviAII 12 CviJI 17 CviKI-1 CviRI* 7 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 5 MalI DraIII 1 AdeI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 5 EcoRII 6 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FatI 12 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 1 GsuI 3 BpmI HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 4 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 7 Hin4II* 6 HpyAV Hin6I 1 HinP1I,HspAI HindII 5 HincII HindIII 1 HinfI 4 HpaI 1 KspAI HpaII 6 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 5 Hpy99I 2 KpnI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 6 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 13 MfeI 1 MunI MlyI 2 SchI MmeI 6 MnlI 9 MseI 8 Tru1I,Tru9I MwoI 5 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 12 Hin1II,Hsp92II,FaeI NlaIV 11 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PflMI 3 BasI,AccB7I,Van91I PleI 2 PpsI PpiI 1 PsrI 1 PstI 1 RsaI 5 AfaI SalI 1 ScrFI 8 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 20 SexAI 1 MabI SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 3 TaqII 1 TatI 1 TauI 1 TfiI 2 PfeI TseI 1 ApeKI TsoI 2 Tsp45I 2 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 12 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 7 TscAI VspI 1 PshBI,AseI XcmI 1 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI AvrII BaeI BalI BamHI BarI BbvCI BbvII* BceAI BcgI BciVI BetI* BglI BglII BinI* BmtI BplI Bpu10I BsaAI BsaBI BsePI BseYI Bsp120I Bsp1407I BspLU11I* BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI Cac8I Cfr9I ClaI CspCI DinI DraII EciI Ecl136II Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoT22I EgeI EheI Esp3I EspI* FalI FauI FseI FspAI GsaI HaeII HgaI HgiJII* KasI MauBI McrI* MluI Mph1103I MroNI MslI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PfoI PmaCI PmeI PpuMI PshAI PsiI PspOMI PspXI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* ScaI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI TstI Tth111I XbaI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769