Restriction Map of NCW2/YLR194C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

NCW2/YLR194C on chromosome XII from coordinates 541573 to 540809.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.14465

EMBOSS_001 MaeI | CviJI | |AciI | |BisI | ||BlsI | |||TseI | |||TauI | |||NspBII* MseI | ||||BisI StuI SetI | |||||BlsI CviJI |TspEI | |||||| MlyI HaeIII TspDTI ||BbvI | |||||| PleI HinfI \ \ \\\ \ \\\\\\ \ \ ATGAAGGCCTGTTCCATATTATTTACCACCTTAATTACTCTAGCCGCTGCTCAAAAAGAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTCCGGACAAGGTATAATAAATGGTGGAATTAATGAGATCGGCGACGAGTTTTTCTG / / / / // //////// // HaeIII TspDTI SetI | |BbvI |||||||| |PleI CviJI | TspEI |||||||| MlyI StuI MseI |||||||TseI ||||||BisI |||||BlsI ||||NspBII* ||||AciI |||BisI ||BlsI |CviJI |TauI MaeI M K A C S I L F T T L I T L A A A Q K D * R P V P Y Y L P P * L L * P L L K K T E G L F H I I Y H L N Y S S R C S K R L ----:----|----:----|----:----|----:----|----:----|----:----| X F A Q E M N N V V K I V R A A A * F S X S P R N W I I * W R L * E L R Q E F L H L G T G Y * K G G * N S * G S S L F V AluI CviJI | SetI | | MboII | | | Bce83I* | | | | Eco57I CfrI | | | | Eco57MI NlaIV | BalI | | | | | AluI |BccI | CviJI | | | | | CviJI || DdeI | HaeIII Hpy188I | | | | | | SetI SmlI \\ \ \ \ \ \ \ \ \ \ \ \ \ TCTGGTTCCTTAGATGGCCAGAACTCTGAAGATAGCTCACAAAAGGAAAGCTCAAACTCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AGACCAAGGAATCTACCGGTCTTGAGACTTCTATCGAGTGTTTTCCTTTCGAGTTTGAGA / / / / / / / / / / / / / / | | | DdeI | CfrI | | | | | | | CviJI | | BccI HaeIII | | | | | | | AluI | NlaIV CviJI | | | | | | SetI HinfI BalI | | | | | Eco57MI | | | | | Eco57I | | | | Bce83I* | | | MboII | | CviJI | | AluI | SetI Hpy188I S G S L D G Q N S E D S S Q K E S S N S L V P * M A R T L K I A H K R K A Q T L W F L R W P E L * R * L T K G K L K L S ----:----|----:----|----:----|----:----|----:----|----:----| E P E K S P W F E S S L E C F S L E F E S Q N R L H G S S Q L Y S V F P F S L S R T G * I A L V R F I A * L L F A * V R Hpy178III* | MboI Hin6I SfeI* | | DpnI |GlaI |Tsp4CI* | | |BstKTI SetI CviJI ||HhaI ||SfaNI \ \ \\ \ \ \\\ \\\ CAAGAGATCACACCTACCACGACAAAGGAAGCCCAAGAAAGCGCATCAACTGTAGTTTCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTCTAGTGTGGATGGTGCTGTTTCCTTCGGGTTCTTTCGCGTAGTTGACATCAAAGA / // / / / /// / / / | || | SetI CviJI ||Hin6I | | SfaNI | || MboI |GlaI | SfeI* | |DpnI HhaI Tsp4CI* | BstKTI Hpy178III* SmlI Q E I T P T T T K E A Q E S A S T V V S K R S H L P R Q R K P K K A H Q L * F L R D H T Y H D K G S P R K R I N C S F Y ----:----|----:----|----:----|----:----|----:----|----:----| * S I V G V V V F S A W S L A D V T T E E L S * V * W S L P L G L F R M L Q L K L L D C R G R C L F G L F A C * S Y N R HindIII | AluI | CviJI | |DdeI | ||SetI MaeII | ||| TatI | SetI BetI* | ||| |Csp6I | TaiI CviJI |HpaII | ||| ||RsaI MaeI | | Hpy99I SetI |NlaIV \\ \ \\\ \\\ \ \ \ \ \ \\ ACCGGAAAAAGCTTAGTACAAACTAGCAACGTCGTCAGCAACACCTATGCTGTGGCTCCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCCTTTTTCGAATCATGTTTGATCGTTGCAGCAGTCGTTGTGGATACGACACCGAGGT // / / / / /// / // / / // || | | | | ||TatI | || MaeII SetI |NlaIV || | | | | |Csp6I | |Hpy99I CviJI || | | | | RsaI | TaiI || | | | DdeI | SetI || | | HindIII MaeI || | CviJI || | AluI || SetI |BetI* HpaII T G K S L V Q T S N V V S N T Y A V A P P E K A * Y K L A T S S A T P M L W L Q R K K L S T N * Q R R Q Q H L C C G S K ----:----|----:----|----:----|----:----|----:----|----:----| V P F L K T C V L L T T L L V * A T A G * R F F S L V F * C R R * C C R H Q P E G S F A * Y L S A V D D A V G I S H S W Tsp4CI* Tsp4CI* |OliI |TaqII |MslI |Csp6I || SfaNI Hpy99I ||RsaI Csp6I || MaeIII | CviRI* FokI ||| SetI |RsaI || Tsp45I | | BseGI TspGWI ||| | BsiYI* \\ \\ \ \ \ \ \ \\\ \ \ AGTACCACCGTAGTGACGACGGATGCACAAGGCAAAACCACGACACAGTACCTATGGTGG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TCATGGTGGCATCACTGCTGCCTACGTGTTCCGTTTTGGTGCTGTGTCATGGATACCACC // / / // / / / / // / || | MslI |Tsp45I CviRI* | FokI | || BsiYI* || | OliI |MaeIII BseGI TspGWI | |Csp6I || Tsp4CI* Hpy99I | RsaI |Csp6I SfaNI | SetI RsaI Tsp4CI* TaqII S T T V V T T D A Q G K T T T Q Y L W W V P P * * R R M H K A K P R H S T Y G G Y H R S D D G C T R Q N H D T V P M V G ----:----|----:----|----:----|----:----|----:----|----:----| L V V T T V V S A C P L V V V C Y R H H L Y W R L S S P H V L C F W S V T G I T T G G Y H R R I C L A F G R C L V * P P FalI FalI |TseI |CviRI* ||BisI |||BlsI ||||MnlI ||||CviJI ||||| Esp3I CfrI ||||| BsmAI | BceAI ||||| BetI* | CviJI FalI ||||| |HpaII | HaeIII FalI ||||| || BbvI \ \ \ \\\\\ \\ \ GTGGCCGAAAGCAACTCTGCCGTAAGCACAACTTCAACTGCCTCTGTGCAGCCCACCGGA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CACCGGCTTTCGTTGAGACGGCATTCGTGTTGAAGTTGACGGAGACACGTCGGGTGGCCT / / / / //// // | | FalI FalI |||CviJI |BetI* | | FalI FalI |||TseI |BsmAI | BceAI ||MnlI |Esp3I | CfrI ||BisI HpaII HaeIII |BlsI CviJI CviRI* V A E S N S A V S T T S T A S V Q P T G W P K A T L P * A Q L Q L P L C S P P E G R K Q L C R K H N F N C L C A A H R R ----:----|----:----|----:----|----:----|----:----|----:----| T A S L L E A T L V V E V A E T C G V P P P R F C S Q R L C L K L Q R Q A A W R H G F A V R G Y A C S * S G R H L G G S AcyI MaeII |ZraI || SetI || TaiI || BsgI || AatII || | HphI || | | AciI || | | | TfiI BseRI SfaNI || | | | HinfI | AciI | MnlI || | | | |FokI | | BseGI | | MnlI \\ \ \ \ \\ \ \ \ \ \ \ GAGACGTCAAGCGGAATCACCAACTCCGCATCCTCCTCAACGACATCAACATCAACGGAC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTGCAGTTCGCCTTAGTGGTTGAGGCGTAGGAGGAGTTGCTGTAGTTGTAGTTGCCTG //// / / / / / / / / / |||| HphI | | | | | AciI | MnlI |||MaeII | | | | BseGI SfaNI |||AcyI | | | BseRI MnlI ||BsgI | | FokI ||ZraI | HinfI |BbvI | TfiI AatII AciI TaiI SetI E T S S G I T N S A S S S T T S T S T D R R Q A E S P T P H P P Q R H Q H Q R T D V K R N H Q L R I L L N D I N I N G R ----:----|----:----|----:----|----:----|----:----|----:----| S V D L P I V L E A D E E V V D V D V S L S T L R F * W S R M R R L S M L M L P L R * A S D G V G C G G * R C * C * R V AsuI* |BmgT120I ||CviJI ||HaeIII |||BsrI |||| MaeIII |||| | TspGWI ApoI |||| | |SfeI* TspEI BsmAI TsoI |||| | || MaeIII EcoRI | SetI HphI | Tsp4CI* \\\\ \ \\ \ \ \ \ \ \ \ GGGCCAGTTACTATAGTAACTACCACGAATTCGTTAGGTGAGACTTACACATCTACTGTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CCCGGTCAATGATATCATTGATGGTGCTTAAGCAATCCACTCTGAATGTGTAGATGACAA /// / / / / / / / / / / ||| | | | MaeIII | | BsmAI | | Tsp4CI* ||| | | SfeI* | SetI | TsoI ||| | MaeIII EcoRI HphI ||| TspGWI TspEI ||AsuI* ApoI |BmgT120I |HaeIII |CviJI BsrI G P V T I V T T T N S L G E T Y T S T V G Q L L * * L P R I R * V R L T H L L F A S Y Y S N Y H E F V R * D L H I Y C L ----:----|----:----|----:----|----:----|----:----|----:----| P G T V I T V V V F E N P S V * V D V T R A L * * L L * W S N T L H S K C M * Q P W N S Y Y S G R I R * T L S V C R S N CviJI | Tsp4CI* | | DdeI | | BbvCI | | Bpu10I | | | CviJI | | | | MnlI | | | | | BspCNI | | | | | |TspDTI CviJI MboII BinI* | | | | | |BseMII | BarI | BceAI | Hpy178III* \ \ \ \ \ \\ \ \ \ \ \ \ TGGTGGCTACCGTCCTCAGCCACAACTGACAACACGGCTTCATCAAGTAAATCATCTTCG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ACCACCGATGGCAGGAGTCGGTGTTGACTGTTGTGCCGAAGTAGTTCATTTAGTAGAAGC / / // / // / / / / / | Tsp4CI* || | |BseMII | CviJI MboII | BinI* CviJI || | |TspDTI BarI BceAI || | BspCNI || MnlI |CviJI Bpu10I BbvCI DdeI W W L P S S A T T D N T A S S S K S S S G G Y R P Q P Q L T T R L H Q V N H L R V A T V L S H N * Q H G F I K * I I F G ----:----|----:----|----:----|----:----|----:----|----:----| Q H S G D E A V V S L V A E D L L D D E K T A V T R L W L Q C C P K M L Y I M K P P * R G * G C S V V R S * * T F * R R MboI BamHI XhoII | DpnI | NlaIV | |BstKTI | || BsaBI | || | BinI* | || | | BarI | || | | | MnlI | || | | | BetI* | || | | | |HpaII | || | | | || TfiI StyI | || | | | || HinfI SecI* SetI \ \\ \ \ \ \\ \ \ \ GGATCCTCATCAAAACCGGAATCAAGCACCAAGGTAGTAAGCACTATCAAATCAACTTAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAGGAGTAGTTTTGGCCTTAGTTCGTGGTTCCATCATTCGTGATAGTTTAGTTGAATA /// // / / // / / / ||| || | | || HinfI | SecI* ||| || | | || TfiI | StyI ||| || | | |BetI* SetI ||| || | | HpaII ||| || | MnlI ||| || BinI* ||| |BsaBI ||| |BarI ||| XhoII ||| BamHI ||| MboI ||NlaIV ||DpnI |BstKTI Hpy178III* G S S S K P E S S T K V V S T I K S T Y D P H Q N R N Q A P R * * A L S N Q L I I L I K T G I K H Q G S K H Y Q I N L Y ----:----|----:----|----:----|----:----|----:----|----:----| P D E D F G S D L V L T T L V I L D V * P I R M L V P I L C W P L L C * * I L K S G * * F R F * A G L Y Y A S D F * S I AccI |SfeI* |Hpy166II SetI || Tsp4CI* MaeII | SfeI* || | HindII | SetI | | BsmAI || | Hpy166II | TaiI | | | Tsp4CI* TspRI || | | HgaI \ \ \ \ \ \ \ \\ \ \ \ ACCACTACGTCAGGTTCTACAGTAGAGACACTGACCACTACATACAAGTCTACAGTCAAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTGATGCAGTCCAAGATGTCATCTCTGTGACTGGTGATGTATGTTCAGATGTCAGTTG / / / // / / // // / / | | SetI || | TspRI || || | Tsp4CI* | MaeII || BsmAI || || Hpy166II TaiI |SfeI* || || HindII SetI Tsp4CI* || |SfeI* || Tsp4CI* |AccI Hpy166II T T T S G S T V E T L T T T Y K S T V N P L R Q V L Q * R H * P L H T S L Q S T H Y V R F Y S R D T D H Y I Q V Y S Q R ----:----|----:----|----:----|----:----|----:----|----:----| V V V D P E V T S V S V V V Y L D V T L Y W * T L N * L L S V S W * M C T * L * G S R * T R C Y L C Q G S C V L R C D V KasI HgiCI* |AcyI |NarI |Hin6I ||GlaI ||DinI ||NlaIV |||HhaI ||||HaeII ||||| MroNI ||||| Cfr10I Tsp4CI* ||||| |HpaII | TspGWI ||||| ||NaeI | | SetI TspEI ||||| ||Cac8I \ \ \ \ \\\\\ \\\ GGTAAGGTAGCGTCCGTAATGTCCAATTCTACCAATGGCGCCTTTGCCGGCACTCACATA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTCCATCGCAGGCATTACAGGTTAAGATGGTTACCGCGGAAACGGCCGTGAGTGTAT / / / ///// /// / | SetI TspEI ||||HgiCI* ||Cfr10I SetI | HgaI ||||KasI ||MroNI TspGWI |||Hin6I |HpaII |||NarI Cac8I |||AcyI NaeI ||NlaIV ||DinI ||GlaI |HhaI HaeII G K V A S V M S N S T N G A F A G T H I V R * R P * C P I L P M A P L P A L T * * G S V R N V Q F Y Q W R L C R H S H S ----:----|----:----|----:----|----:----|----:----|----:----| P L T A D T I D L E V L P A K A P V * M R Y P L T R L T W N * W H R R Q R C E C T L Y R G Y H G I R G I A G K G A S V Y AluI CviJI | FauI MwoI | SetI HgiCI* | | MwoI | NlaIV | | BceAI BsmI | | SduI | | | AciI CviRI* | | BseSI \ \ \ \ \ \ \ \ GCTTATGGTGCGGGTGCATTCGCCGTTGGTGCCCTTTTGTTATAG 730 740 750 760 ----:----|----:----|----:----|----:----|----: CGAATACCACGCCCACGTAAGCGGCAACCACGGGAAAACAATATC / // / / / / / // / | || | | | CviRI* | || HgiCI* | || | | BsmI | |NlaIV | || | AciI | BseSI | || BceAI | SduI | |FauI MwoI | MwoI CviJI AluI A Y G A G A F A V G A L L L * L M V R V H S P L V P F C Y X L W C G C I R R W C P F V I X ----:----|----:----|----:----|----:----|----: A * P A P A N A T P A R K N Y L K H H P H M R R Q H G K T I S I T R T C E G N T G K Q * L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 1 FblI,XmiI AciI 4 BspACI,SsiI AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AluI 4 AluBI ApoI 1 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BarI 1 BbvCI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BccI 1 Bce83I* 1 BpuEI BceAI 3 BetI* 3 BsaWI BinI* 2 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 1 Bpu10I 1 BsaBI 1 Bse8I,BseJI BseGI 2 BstF5I,BtsCI BseMII 1 BseRI 1 BseSI 1 BaeGI,BstSLI BsgI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 3 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BsrI 1 BseNI,Bse1I,BsrSI BstKTI 2 Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviJI 15 CviKI-1 CviRI* 3 HpyCH4V DdeI 3 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 2 MalI Eco57I 1 AcuI Eco57MI 1 EcoRI 1 Esp3I 1 BsmBI FalI 2 FauI 1 SmuI FokI 2 GlaI 2 HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin6I 2 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 3 HpaII 4 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 1 Hpy99I 2 KasI 1 MaeI 2 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 3 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 MlyI 1 SchI MnlI 5 MroNI 1 NgoMIV MseI 1 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NaeI 1 PdiI NarI 1 Mly113I NlaIV 5 BspLI,BmiI,PspN4I NspBII* 1 MspA1I OliI 1 AleI PleI 1 PpsI RsaI 3 AfaI SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 15 SfaNI 3 LweI SfeI* 4 BstSFI,SfcI,BfmI SmlI 1 SmoI StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqII 1 TatI 1 TauI 1 TfiI 2 PfeI TseI 2 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 3 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 1 TscAI XhoII 1 BstYI,MflI,PsuI,BstX2I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AclI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BbvII* BcgI BciVI BclI BdaI BfiI BglI BglII BmeT110I BmtI BplI BsaAI BsaXI BseBI BsePI BseYI BsiI* BslFI BsmFI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr9I ClaI CspCI CviAII DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRII EcoRV EcoT22I EspI* FaqI FatI FnuDII* FseI FspAI GsaI GsuI HgiAI* HgiJII* Hin4I Hin4II* HpaI KpnI Ksp632I* MauBI McrI* MfeI MluI MmeI Mph1103I MstI* MvaI NcoI NdeI NheI NlaIII NmeAIII NotI NruI NsiI NspI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI ScrFI SexAI SfiI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StyD4I SwaI TaqI TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769