Restriction Map of EMG1/YLR186W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

EMG1/YLR186W on chromosome XII from coordinates 523632 to 524390.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.5752

SetI |MnlI || MboI TfiI || BclI HinfI || Hin4II* | BplI || | DpnI | BplI || | |BstKTI | Hpy178III* || | ||BplI Cfr10I | | Esp3I || | ||BplI |MwoI | | BsmAI || | |||Hpy188I |HpaII TaqI | | | MboII AcyI HgaI || | |||| HphI ||Bce83I* \ \ \ \ \ \ \ \\ \ \\\\ \ \\\ ATGGTCGAAGATTCCAGAGTTAGAGACGCCCTCAAAGGTGGTGATCAGAAGGCATTACCG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAGCTTCTAAGGTCTCAATCTCTGCGGGAGTTTCCACCACTAGTCTTCCGTAATGGC / / / / / / / / / / // / / / / / | | | | | BsmAI AcyI | | | || | | | | HpaII | | | | | Esp3I | | | || | | | Bce83I* | | | | MboII | | | || | | MwoI | | | Hpy178III* | | | || | HphI | | HinfI | | | || Hpy188I | | TfiI | | | || BclI | BplI | | | || MboI | BplI | | | |DpnI TaqI | | | BstKTI | | Hin4II* | | BplI | | BplI | HgaI | MnlI SetI M V E D S R V R D A L K G G D Q K A L P W S K I P E L E T P S K V V I R R H Y R G R R F Q S * R R P Q R W * S E G I T G ----:----|----:----|----:----|----:----|----:----|----:----| X T S S E L T L S A R L P P S * F A N G X P R L N W L * L R G * L H H D S P M V H D F I G S N S V G E F T T I L L C * R NlaIV CviJI |MnlI MnlI Hpy178III* DdeI HaeIII || SmlI |SetI | MnlI | AciI \ \\ \ \\ \ \ \ \ GCCTCTTTGGTTCCTCAAGCACCTCCTGTCTTGACATCAAAGGATAAGATTACTAAGCGG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAGAAACCAAGGAGTTCGTGGAGGACAGAACTGTAGTTTCCTATTCTAATGATTCGCC / / / / / // / / Cfr10I NlaIV | | MnlI |Hpy178III* | AciI HaeIII MnlI | SetI MnlI DdeI CviJI SmlI A S L V P Q A P P V L T S K D K I T K R P L W F L K H L L S * H Q R I R L L S G L F G S S S T S C L D I K G * D Y * A D ----:----|----:----|----:----|----:----|----:----|----:----| A E K T G * A G G T K V D F S L I V L R P R K P E E L V E Q R S M L P Y S * * A G R Q N R L C R R D Q C * L I L N S L P BseGI | BsmAI | | AvaI AsuI* | | XhoI |BmgT120I | | SmlI ||BssKI | | |TaqI ||CviJI BseGI | | |BmeT110I ||EcoRII | FokI | | ||Hpy178III* ||HaeIII | | BccI | | |||SfaNI ||| ScrFI | | FokI | | |||BtgZI MnlI EcoRV ||| BseBI \ \ \ \ \ \\\\ \ \ \\\ \ ATGATTGTGGTATTAGCGATGGCATCCCTCGAGACACACAAGATATCGTCCAACGGGCCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TACTAACACCATAATCGCTACCGTAGGGAGCTCTGTGTGTTCTATAGCAGGTTGCCCGGA / / / / / // // / // / BseGI | | BseGI | || |MnlI EcoRV || BseBI | FokI | || BtgZI || ScrFI BccI | || SfaNI |AsuI* FokI | |Hpy178III* BmgT120I | |SmlI HaeIII | |XhoI CviJI | |AvaI | BmeT110I | TaqI BsmAI M I V V L A M A S L E T H K I S S N G P * L W Y * R W H P S R H T R Y R P T G L D C G I S D G I P R D T Q D I V Q R A W ----:----|----:----|----:----|----:----|----:----|----:----| I I T T N A I A D R S V C L I D D L P G S S Q P I L S P M G R S V C S I T W R A H N H Y * R H C G E L C V L Y R G V P R DrdI BccI |MmeI |SetI || HphI MaeIII || MseI MaeIII || | BdaI Tsp45I || | BdaI Tsp45I || | BdaI Tsp4CI* || | BdaI BsmAI \ \\ \ \ \ \\ \ \ \ GGTGGTGACAAATATGTCCTTTTGAACTGTGACGACCATCAAGGTTTATTAAAAAAAATG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCACTGTTTATACAGGAAAACTTGACACTGCTGGTAGTTCCAAATAATTTTTTTTAC / / // / / / / / / / EcoRII | || | BdaI | Tsp45I | BccI BdaI BssKI | || | BdaI | MaeIII SetI BdaI | || HphI Tsp4CI* MseI | |MmeI | DrdI Tsp45I MaeIII G G D K Y V L L N C D D H Q G L L K K M V V T N M S F * T V T T I K V Y * K K W W * Q I C P F E L * R P S R F I K K N G ----:----|----:----|----:----|----:----|----:----|----:----| P P S L Y T R K F Q S S W * P K N F F I Q H H C I H G K S S H R G D L N I L F F T T V F I D K Q V T V V M L T * * F F H MaeII | SetI | TaiI SetI | | MaeI \ \ \ \ GGTAGAGACATTAGTGAAGCAAGACCTGATATTACCCACCAATGTCTTTTGACGTTGCTA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCATCTCTGTAATCACTTCGTTCTGGACTATAATGGGTGGTTACAGAAAACTGCAACGAT / / / / / BsmAI SetI | MaeII MaeI TaiI SetI G R D I S E A R P D I T H Q C L L T L L V E T L V K Q D L I L P T N V F * R C * * R H * * S K T * Y Y P P M S F D V A R ----:----|----:----|----:----|----:----|----:----|----:----| P L S M L S A L G S I V W W H R K V N S P Y L C * H L L V Q Y * G G I D K S T A T S V N T F C S R I N G V L T K Q R Q * TseI AluI CviJI |BisI |SfeI* ||BlsI ||SetI ApoI CviJI |||CviRI* TspEI TfiI |HpaII |||| PstI EcoRI HinfI BbvI ||BspMI |||| | SetI MnlI TaqI | MnlI \ \ \\\ \\\\ \ \ \ \ \ \ GATTCTCCAATCAACAAAGCCGGAAAGCTGCAGGTCTATATTCAAACAAGTCGAGGAATT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGAGGTTAGTTGTTTCGGCCTTTCGACGTCCAGATATAAGTTTGTTCAGCTCCTTAA / // / / ////// / / // HinfI || | | |||||SfeI* MnlI TaqI |EcoRI TfiI || | | ||||SetI |TspEI || | | |||CviRI* |ApoI || | | |||TseI MnlI || | | ||BisI || | | |BlsI || | | |PstI || | | CviJI || | | AluI || | BspMI || | SetI || HpaII |CviJI BbvI D S P I N K A G K L Q V Y I Q T S R G I I L Q S T K P E S C R S I F K Q V E E F F S N Q Q S R K A A G L Y S N K S R N S ----:----|----:----|----:----|----:----|----:----|----:----| S E G I L L A P F S C T * I * V L R P I L N E L * C L R F A A P R Y E F L D L F I R W D V F G S L Q L D I N L C T S S N MboI Hpy188I | DpnI | |TaqI | |BstKTI | || MseI Tsp4CI* | || SetI | TspRI | || |HpaI | | AccI | || |HindII | | |BssNAI SetI | || |Hpy166II | | |Hpy166II |MseI \ \\ \\ \ \ \\ \\ CTGATCGAGGTTAACCCCACTGTTCGTATACCAAGAACTTTCAAAAGATTTTCAGGTTTA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GACTAGCTCCAATTGGGGTGACAAGCATATGGTTCTTGAAAGTTTTCTAAAAGTCCAAAT / // // // / / // / / | || |TaqI || | Tsp4CI* |AccI SetI MseI | || |SetI || TspRI Hpy166II | || MboI |MseI BssNAI | |DpnI Hpy166II | BstKTI HindII Hpy188I HpaI L I E V N P T V R I P R T F K R F S G L * S R L T P L F V Y Q E L S K D F Q V * D R G * P H C S Y T K N F Q K I F R F N ----:----|----:----|----:----|----:----|----:----|----:----| R I S T L G V T R I G L V K L L N E P K E S R P * G W Q E Y V L F K * F I K L N Q D L N V G S N T Y W S S E F S K * T * MboI Hpy188I | DpnI HindIII | |BstKTI | AluI | || BarI MaeIII | CviJI | || |ApoI | MboII MaeIII | | SetI | || |TspEI Hpy188I | |MseI \ \ \ \ \ \\ \\ \ \ \\ ATGGTTCAGTTACTACATAAGCTTTCTATCAGATCGGTAAATTCTGAAGAAAAGTTACTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAAGTCAATGATGTATTCGAAAGATAGTCTAGCCATTTAAGACTTCTTTTCAATGAA / / / / / // / // // | | | | | || MboI |Hpy188I |MaeIII | | | | | |DpnI TspEI MboII | | | | | |BarI ApoI | | | | | BstKTI | | | | Hpy188I | | | HindIII | | CviJI | | AluI | SetI MaeIII M V Q L L H K L S I R S V N S E E K L L W F S Y Y I S F L S D R * I L K K S Y L G S V T T * A F Y Q I G K F * R K V T * ----:----|----:----|----:----|----:----|----:----|----:----| I T * N S C L S E I L D T F E S S F N S L P E T V V Y A K * * I P L N Q L F T V H N L * * M L K R D S R Y I R F F L * K MboI | DpnI | |BstKTI Eco57I | || BceAI Eco57MI | || | SetI MaeIII | MseI TspEI | || | | SetI Tsp45I | | BarI | HphI | || | | | DdeI | SetI \ \ \ \ \ \ \\ \ \ \ \ \ \ AAAGTCATTAAGAACCCAATTACCGATCACCTACCTACTAAGTGCCGTAAGGTGACATTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCAGTAATTCTTGGGTTAATGGCTAGTGGATGGATGATTCACGGCATTCCACTGTAAT / / / / / / // / // / / // | | BarI MseI | | || | |SetI DdeI SetI |TstI | Eco57MI | | || | BceAI Tsp45I | Eco57I | | || MboI MaeIII MseI | | || SetI | | |DpnI | | BstKTI | TspEI HphI K V I K N P I T D H L P T K C R K V T L K S L R T Q L P I T Y L L S A V R * H Y S H * E P N Y R S P T Y * V P * G D I I ----:----|----:----|----:----|----:----|----:----|----:----| L T M L F G I V S * R G V L H R L T V N * L * * S G L * R D G V * * T G Y P S M F D N L V W N G I V * R S L A T L H C * AciI | FnuDII* | | Hpy178III* TstI BsrI | | | TstI |HphI | HgaI | | | | TaqI MaeI \\ \ \ \ \ \ \ \ \ TCCTTTGACGCACCAGTTATCCGCGTTCAAGATTACATCGAAAAACTAGACGATGATGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAAACTGCGTGGTCAATAGGCGCAAGTTCTAATGTAGCTTTTTGATCTGCTACTACTT / / / / // / / HphI BsrI | | || TaqI MaeI | | |Hpy178III* | | TstI | FnuDII* | AciI HgaI S F D A P V I R V Q D Y I E K L D D D E P L T H Q L S A F K I T S K N * T M M K L * R T S Y P R S R L H R K T R R * * K ----:----|----:----|----:----|----:----|----:----|----:----| D K S A G T I R T * S * M S F S S S S S I R Q R V L * G R E L N C R F V L R H H G K V C W N D A N L I V D F F * V I I F HgiCI* | NlaIV | | FatI | | NcoI | | StyI | | SecI* | | DsaI* | | |CviAII | | ||MnlI BseGI TspDTI | | ||| NlaIII SetI AciI | MaeII \ \ \ \\\ \ \ \ \ \ AGTATATGTGTCTTTGTTGGTGCCATGGCAAGAGGTAAAGATAACTTTGCGGATGAATAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TCATATACACAGAAACAACCACGGTACCGTTCTCCATTTCTATTGAAACGCCTACTTATG / / // // / / / // TspDTI | || || SetI | | |Hpy99I | || |DsaI* | | TaiI | || |SecI* | | SetI | || |StyI | BseGI | || |NcoI AciI | || |FatI | || CviAII | |MnlI | HgiCI* | NlaIII NlaIV S I C V F V G A M A R G K D N F A D E Y V Y V S L L V P W Q E V K I T L R M N T Y M C L C W C H G K R * R * L C G * I R ----:----|----:----|----:----|----:----|----:----|----:----| L I H T K T P A M A L P L S L K A S S Y F Y I H R Q Q H W P L L Y L Y S Q P H I T Y T D K N T G H C S T F I V K R I F V SalI SgrDI DdeI |TaqI | MwoI |AccI | | FatI |SetI | | CviRI* |TaiI | | |CviAII ||HindII | | ||MnlI ||Hpy166II | | ||| NspI |||FokI | | ||| NlaIII |||Hpy99I | | ||| | BspCNI |||| Hpy99I | | ||| | |BseMII |||| |TspDTI | | ||| | || ApoI |||| || DrdI CviJI TspEI | | ||| | || TspEI \\\\ \\ \ \ \ \ \ \\\ \ \\ \ GTCGACGAAAAAGTCGGCTTGTCCAATTACCCATTGTCTGCCTCAGTTGCATGTTCTAAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCTGCTTTTTCAGCCGAACAGGTTAATGGGTAACAGACGGAGTCAACGTACAAGATTT ////// / / / / / // /// |||||| FokI CviJI TspEI | | || ||BseMII |||||| DrdI | | || |BspCNI |||||TspDTI | | || |FatI ||||SgrDI | | || CviAII ||||SalI | | |MnlI |||AccI | | CviRI* |||TaqI | | NlaIII ||Hpy166II | | NspI ||HindII | DdeI |Hpy99I MwoI MaeII V D E K V G L S N Y P L S A S V A C S K S T K K S A C P I T H C L P Q L H V L N R R K S R L V Q L P I V C L S C M F * I ----:----|----:----|----:----|----:----|----:----|----:----| T S S F T P K D L * G N D A E T A H E L R R R F L R S T W N G M T Q R L Q M N * D V F F D A Q G I V W Q R G * N C T R F FatI NcoI StyI SecI* DsaI* |CviAII || SfaNI || |NlaIII || ||Hin6I || |||GlaI || ||||HhaI || |||||HaeII MboII Eco57I || |||||| MwoI | SspI Eco57MI \\ \\\\\\ \ \ \ \ TTTTGCCATGGCGCTGAAGATGCTTGGAATATTTTATAG 730 740 750 ----:----|----:----|----:----|----:---- AAAACGGTACCGCGACTTCTACGAACCTTATAAAATATC / / ///// / / / / | | ||||| MwoI | | Eco57MI | | ||||Hin6I | | Eco57I | | ||||SfaNI | SspI | | |||GlaI MboII | | ||HhaI | | |DsaI* | | |SecI* | | |HaeII | | |StyI | | |NcoI | | |FatI | | CviAII | NlaIII TspEI ApoI F C H G A E D A W N I L * F A M A L K M L G I F Y X L P W R * R C L E Y F I X ----:----|----:----|----:----|----:---- N Q W P A S S A Q F I K Y I K G H R Q L H K S Y K I K A M A S F I S P I N * L # Enzymes that cut Frequency Isoschizomers AccI 2 FblI,XmiI AciI 3 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AluI 2 AluBI ApoI 3 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BccI 2 Bce83I* 1 BpuEI BceAI 1 BclI 1 FbaI,Ksp22I BdaI 2 BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmeT110I 1 BmgT120I 1 BplI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 1 BsmAI 3 Alw26I,BstMAI BspCNI 1 BspMI 1 BfuAI,Acc36I,BveI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 4 BtgZI 1 Cfr10I 1 BsrFI,BssAI,Bse118I CviAII 3 CviJI 6 CviKI-1 CviRI* 2 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 4 MalI DrdI 2 AasI,DseDI DsaI* 2 BtgI,BstDSI Eco57I 2 AcuI Eco57MI 2 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI FatI 3 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 1 HaeII 1 BstH2I HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HindII 2 HincII HindIII 1 HinfI 2 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 4 Hpy99I 2 MaeI 2 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 5 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MmeI 1 MnlI 9 MseI 5 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NcoI 2 Bsp19I NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PstI 1 SalI 1 ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 15 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SgrDI 1 SmlI 2 SmoI SspI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 6 TfiI 2 PfeI TseI 1 ApeKI Tsp45I 3 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 5 TasI,Tsp509I,Sse9I TspRI 1 TscAI TstI 1 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaII AvrII BaeI BalI BamHI BbvCI BbvII* BcgI BciVI BetI* BfiI BglI BglII BinI* BmtI Bpu10I BsaAI BsaBI BsaXI BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BstAPI BstEII BstXI BtrI BtsI Cac8I CauII* Cfr9I CfrI ClaI Csp6I CspCI CviQI DinI DraII DraIII Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoT22I EgeI EheI EspI* FalI FaqI FauI FseI FspAI GsaI GsuI HgiAI* HgiJII* Hin4I KasI KpnI Ksp632I* MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MslI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsaI RsaNI RsrII SacI SacII SanDI SapI SauI* ScaI SchI SduI SexAI SfiI SfoI SgfI SgrAI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TatI TauI TsoI TspGWI TspMI Tth111I VspI XbaI XcmI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769