Restriction Map of RPL37A/YLR185W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RPL37A/YLR185W on chromosome XII from coordinates 522663 to 523288.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.21933

SecI* Tsp4CI* DsaI* | Hpy166II McrI* | | SetI |Tsp4CI* \ \ \ \\ ATGGGTAGTATGTAGTAGGACATTGAGAATAAAACTGTGAACCTGTTATTGACGACCGTG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCATCATACATCATCCTGTAACTCTTATTTTGACACTTGGACAATAACTGCTGGCAC / // / / / | |SetI | | DsaI* | Hpy166II | | SecI* Tsp4CI* | Tsp4CI* McrI* M G S M * * D I E N K T V N L L L T T V W V V C S R T L R I K L * T C Y * R P W G * Y V V G H * E * N C E P V I D D R G ----:----|----:----|----:----|----:----|----:----|----:----| X P L I Y Y S M S F L V T F R N N V V T X P Y Y T T P C Q S Y F Q S G T I S S R H T T H L L V N L I F S H V Q * Q R G H MboII |Hpy188I || FatI || |CviAII || |Eco57I || |Eco57MI || ||Cac8I || ||| SphI || ||| NspI Ksp632I* || ||| CviRI* ApoI | Hpy188I || ||| NlaIII TspEI DdeI \ \ \\ \\\ \ \ \ GAGAAATGTTATGATTATCTGAAGAGAAATATCGGAACGCATGCACACCAAATTTATACT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTTACAATACTAATAGACTTCTCTTTATAGCCTTGCGTACGTGTGGTTTAAATATGA / // // /// / Ksp632I* || || ||CviRI* TspEI Hpy188I || || ||FatI ApoI || || |CviAII || || Cac8I || |NlaIII || |NspI || |SphI || Eco57MI || Eco57I |Hpy188I MboII E K C Y D Y L K R N I G T H A H Q I Y T R N V M I I * R E I S E R M H T K F I L E M L * L S E E K Y R N A C T P N L Y L ----:----|----:----|----:----|----:----|----:----|----:----| S F H * S * R F L F I P V C A C W I * V P S I N H N D S S F Y R F A H V G F K Y L F T I I I Q L S I D S R M C V L N I S BcgI AccI |BbvII* BsrI || MboII BsrI |BssNAI || |TspDTI |BsmAI |Hpy166II || ||Hpy166II \\ \\ \\ \\\ TAGCAAGACTGGACGATACGAGACTGGTATACTTGTATGAAGACAGAATAGTGAACGAAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATCGTTCTGACCTGCTATGCTCTGACCATATGAACATACTTCTGTCTTATCACTTGCTTT / / / / // / / / DdeI BsrI BsmAI | |AccI BcgI | Hpy166II | Hpy166II TspDTI | BssNAI BbvII* BsrI MboII * Q D W T I R D W Y T C M K T E * * T K S K T G R Y E T G I L V * R Q N S E R K A R L D D T R L V Y L Y E D R I V N E R ----:----|----:----|----:----|----:----|----:----|----:----| * C S Q V I R S Q Y V Q I F V S Y H V F K A L S S S V L S T Y K Y S S L I T F S L L V P R Y S V P I S T H L C F L S R F FatI |CviAII || NspI || Hin6I || NlaIII || |GlaI || |MslI || |MstI* || |FspAI || ||FatI || ||HhaI || |||CviAII || |||| NlaIII MboII || |||| | ApoI | BseMII || |||| | TspEI | |BspCNI DdeI || |||| | |BcgI Tsp4CI* SspI | || MnlI SauI* \\ \\\\ \ \\ \ \ \ \\ \ \ GACATGCGCATGACAACAAATTTACCGTATAGAAGAAATATTCTGCTTGTATGCCTGAGG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTACGCGTACTGTTGTTTAAATGGCATATCTTCTTTATAAGACGAACATACGGACTCC / //// // / / / / /// / / | |||| |FatI BcgI | Tsp4CI* | ||| MnlI SauI* | |||| CviAII TspEI | ||BspCNI DdeI | |||NlaIII ApoI | |BseMII | |||Hin6I | MboII | ||FspAI SspI | ||MstI* | ||MslI | ||GlaI | |FatI | |HhaI | CviAII NlaIII NspI D M R M T T N L P Y R R N I L L V C L R T C A * Q Q I Y R I E E I F C L Y A * G H A H D N K F T V * K K Y S A C M P E G ----:----|----:----|----:----|----:----|----:----|----:----| S M R M V V F K G Y L L F I R S T H R L L C A C S L L N V T Y F F Y E A Q I G S V H A H C C I * R I S S I N Q K Y A Q P MboI MaeIII | DpnI | MaeIII | |BstKTI | Tsp45I | ||TspEI | Tsp4CI* TaqI | ||| BinI* | | Hpy178III* MaeIII \ \ \\\ \ \ \ \ \ GAACTCGAAAGGATCAATTTCAATGGCGTTGTAACAGTCACGAAAAAAGTGTAACTATAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGAGCTTTCCTAGTTAAAGTTACCGCAACATTGTCAGTGCTTTTTTCACATTGATATT / // / // / / / TaqI || | |BinI* | Hpy178III* MaeIII || | TspEI | Tsp45I || MboI | MaeIII |DpnI Tsp4CI* BstKTI MaeIII E L E R I N F N G V V T V T K K V * L * N S K G S I S M A L * Q S R K K C N Y K T R K D Q F Q W R C N S H E K S V T I R ----:----|----:----|----:----|----:----|----:----|----:----| S S S L I L K L P T T V T V F F T Y S Y P V R F S * N * H R Q L L * S F L T V I F E F P D I E I A N Y C D R F F H L * L TspEI TspEI | TatI | CviRI* MnlI | |Csp6I | | TsoI MseI | ||RsaI MseI | | TspEI |AhaIII* \ \\\ \ \ \ \ \\ GATAAAGCAAATTGTACTAACAAACTTAACCAAATTGCACAACAATTTGATTTTCTTTTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTTCGTTTAACATGATTGTTTGAATTGGTTTAACGTGTTGTTAAACTAAAAGAAAAA / /// / // / / / / | ||TatI MseI || TsoI TspEI | AhaIII* | |Csp6I |CviRI* MnlI | RsaI TspEI TspEI D K A N C T N K L N Q I A Q Q F D F L F I K Q I V L T N L T K L H N N L I F F L * S K L Y * Q T * P N C T T I * F S F * ----:----|----:----|----:----|----:----|----:----|----:----| S L A F Q V L L S L W I A C C N S K R K L Y L L N Y * C V * G F Q V V I Q N E K I F C I T S V F K V L N C L L K I K K K BsiYI* | TstI | |Hin4II* | ||BslFI | |||Hpy166II | |||| MaeII | |||| |MaeIII TspDTI | |||| |Tsp45I DraIII | Csp6I | |||| || SetI | MaeIII | |RsaI | |||| || TaiI | | TstI \ \\ \ \\\\ \\ \ \ \ \ AAATAGAGGGTACTCCTTCATTCGGTAAACGTCACAACAAGTCCCACACTTTGTGTAACA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTATCTCCCATGAGGAAGTAAGCCATTTGCAGTGTTGTTCAGGGTGTGAAACACATTGT / / // // / // // / / / / | | |Csp6I |TstI | || || Tsp45I | TstI MaeIII | | RsaI | | || || MaeIII DraIII | TspDTI | | || |MaeII MseI | | || BslFI | | |TaiI | | |SetI | | Hpy166II | Hin4II* BsiYI* K * R V L L H S V N V T T S P T L C V T N R G Y S F I R * T S Q Q V P H F V * Q I E G T P S F G K R H N K S H T L C N R ----:----|----:----|----:----|----:----|----:----|----:----| L Y L T S R * E T F T V V L G V S Q T V * I S P V G E N P L R * L L D W V K H L F L P Y E K M R Y V D C C T G C K T Y C SetI TseI BbvII* AluI FatI |TsoI CviJI |CviAII || MboII PvuII Hpy99I || NlaIII || | BbvI MnlI NspBII* \ \\ \ \\ \ \ \ \ GATGTGGTCGTCGTTCTTTCCATGTTCAAAAGAAGACCTGTTCCTCCTGTGGTTATCCAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTACACCAGCAGCAAGAAAGGTACAAGTTTTCTTCTGGACAAGGAGGACACCAATAGGTC / / // / / / // / / Hpy99I | |FatI | TsoI BbvII* |MnlI | NspBII* | CviAII SetI MboII BbvI | PvuII NlaIII | CviJI | AluI SetI D V V V V L S M F K R R P V P P V V I Q M W S S F F P C S K E D L F L L W L S S C G R R S F H V Q K K T C S S C G Y P A ----:----|----:----|----:----|----:----|----:----|----:----| S T T T T R E M N L L L G T G G T T I W L H P R R E K W T * F F V Q E E Q P * G I H D D N K G H E F S S R N R R H N D L BsrI HgiCI* | NlaIV | | StyI MboI | | SecI* BbvII* BisI BglII | | |BfiI | MboII |BlsI XhoII | | || BarI | | Csp6I |SetI | DpnI | | || |CviJI | | |RsaI || DdeI | |BstKTI | | || ||DdeI | | |BsrI \\ \ \ \\ \ \ \\ \\\ \ \ \\ CTGCTAAGACCAGATCTTACAACTGGGGTGCCAAGGCTAAGAGAAGACACACTACTGGTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GACGATTCTGGTCTAGAATGTTGACCCCACGGTTCCGATTCTCTTCTGTGTGATGACCAT /// / // / / /// // / / / // ||| DdeI || XhoII | ||| || DdeI | | |Csp6I ||TseI || BglII | ||| |CviJI | | RsaI |BisI || MboI | ||| SecI* | BsrI BlsI |DpnI | ||| StyI BbvII* BstKTI | ||HgiCI* MboII | ||BfiI | |BarI | NlaIV BsrI L L R P D L T T G V P R L R E D T L L V C * D Q I L Q L G C Q G * E K T H Y W Y A K T R S Y N W G A K A K R R H T T G T ----:----|----:----|----:----|----:----|----:----|----:----| S S L G S R V V P T G L S L S S V S S T A A L V L D * L Q P A L A L L L C V V P Q * S W I K C S P H W P * S F V C * Q Y AflIII | MaeII | | SetI | | TaiI | | | Hpy178III* | | | | TfiI | | | | HinfI | | | | | Hpy178III* | | | | | | MboII BsrI | | | | | | | XmnI Cfr10I | BarI | | | | | | | Tsp4CI* |HpaII \ \ \ \ \ \ \ \ \ \ \\ CTGGTAGAATGAGATACTTGAAACACGTTTCAAGAAGATTCAAGAACGGTTTCCAAACCG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GACCATCTTACTCTATGAACTTTGTGCAAAGTTCTTCTAAGTTCTTGCCAAAGGTTTGGC // / / / / / / // / |BsrI | | | | | | |XmnI HpaII BarI | | | | | | Tsp4CI* | | | | | MboII | | | | Hpy178III* | | | HinfI | | | TfiI | | Hpy178III* | AflIII | MaeII TaiI SetI L V E * D T * N T F Q E D S R T V S K P W * N E I L E T R F K K I Q E R F P N R G R M R Y L K H V S R R F K N G F Q T G ----:----|----:----|----:----|----:----|----:----|----:----| S T S H S V Q F V N * S S E L V T E L G V P L I L Y K F C T E L L N L F P K W V Q Y F S I S S V R K L F I * S R N G F R DdeI | MwoI CviJI | | CviJI MseI \ \ \ \ \ GCTCTGCTTCTAAGGCTTCTGCTTAA 610 620 ----:----|----:----|----:- CGAGACGAAGATTCCGAAGACGAATT / / / / / Cfr10I | | CviJI MseI CviJI | DdeI MwoI A L L L R L L L X L C F * G F C L X S A S K A S A * ----:----|----:----|----:- A R S R L S R S L P E A E L A E A * S Q K * P K Q K # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AflIII 1 AhaIII* 1 DraI AluI 1 AluBI ApoI 2 AcsI,XapI BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BcgI 1 BfiI 1 BmrI,BmuI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BseMII 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BspCNI 1 BsrI 5 BseNI,Bse1I,BsrSI BssNAI 1 Bst1107I,BstZ17I BstKTI 2 Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 3 CviQI,RsaNI CviAII 4 CviJI 4 CviKI-1 CviRI* 2 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 2 MalI DraIII 1 AdeI DsaI* 1 BtgI,BstDSI Eco57I 1 AcuI Eco57MI 1 FatI 4 FspAI 1 GlaI 1 HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HinfI 1 HpaII 1 HapII,BsiSI,MspI Hpy166II 4 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 2 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeII 2 HpyCH4IV MaeIII 5 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 McrI* 1 BsiEI,BstMCI,Bsh1285I MnlI 3 MseI 3 Tru1I,Tru9I MslI 1 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 1 HpyF10VI,BstMWI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 2 BstNSI,XceI PvuII 1 RsaI 3 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI SecI* 2 BseDI,BssECI,BsaJI SetI 5 SphI 1 PaeI,BbuI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 1 TatI 1 TfiI 1 PfeI TseI 1 ApeKI TsoI 2 Tsp45I 2 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 6 TasI,Tsp509I,Sse9I TstI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AciI AclI AcyI AflII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BbvCI BccI Bce83I* BceAI BciVI BclI BdaI BetI* BglI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BsePI BseRI BseSI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI Bst2UI BstAPI BstEII BstF5I BstNI BstOI BstSCI BstXI BtgZI BtrI BtsCI BtsI CauII* Cfr9I CfrI ClaI CspCI DinI DraII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI FnuDII* FokI FseI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiJII* Hin4I HindII HindIII HpaI HphI KasI KpnI MaeI MauBI MfeI MluI MlyI MmeI Mph1103I MroNI MvaI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI ScaI SchI ScrFI SduI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TaqII TauI TspGWI TspMI TspRI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769