Restriction Map of RMP1/YLR145W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RMP1/YLR145W on chromosome XII from coordinates 432168 to 432773.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.29574

Hin4I BcgI | MseI MboI | | GsuI BseGI | DpnI | | Eco57MI | Hin4I | |BstKTI | | | BcgI BccI | | FokI | || Hpy178III* | | |SspI |Hpy178III* \ \ \ \ \ \\ \ \ \ \\ \\ ATGGATGAGATGGATAATGTGATACGATCTCTGGAGCAAGAATATCGGTTAATATTGCTC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTACTCTACCTATTACACTATGCTAGAGACCTCGTTCTTATAGCCAATTATAACGAG / / / / // / / / // / / | BseGI | | || | | Hin4I || | BcgI | Hin4I | | || | Hpy178III* || SspI BccI | | || MboI |MseI | | |DpnI Eco57MI | | BstKTI GsuI | BcgI FokI M D E M D N V I R S L E Q E Y R L I L L W M R W I M * Y D L W S K N I G * Y C S G * D G * C D T I S G A R I S V N I A L ----:----|----:----|----:----|----:----|----:----|----:----| X S S I S L T I R D R S C S Y R N I N S X P H S P Y H S V I E P A L I D T L I A H I L H I I H Y S R Q L L F I P * Y Q E AciI BsrBI |BisI ||BlsI |||PsrI |||NheI |||TauI |||CviJI ||||MaeI |||||Cac8I |||||| AluI MboI |||||| BmtI | DpnI |||||| CviJI | |BstKTI |||||| | SetI | || BinI* \\\\\\ \ \ \ \\ \ TTGAACCATAGGAACAAAAATCAACATAGAGCGGCTAGCTGGTATGGATCGTTCAATGAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTGGTATCCTTGTTTTTAGTTGTATCTCGCCGATCGACCATACCTAGCAAGTTACTC / / //// /// // / / Hpy178III* | |||| ||CviJI || MboI BinI* | |||| ||NheI |DpnI | |||| ||AluI BstKTI | |||| |MaeI | |||| Cac8I | |||| SetI | |||CviJI | |||BmtI | ||BisI | ||AciI | |BlsI | BsrBI | TauI PsrI L N H R N K N Q H R A A S W Y G S F N E * T I G T K I N I E R L A G M D R S M R E P * E Q K S T * S G * L V W I V Q * D ----:----|----:----|----:----|----:----|----:----|----:----| K F W L F L F * C L A A L Q Y P D N L S R S G Y S C F D V Y L P * S T H I T * H Q V M P V F I L M S R S A P I S R E I L AluI CviJI |AvaI |XhoI |SmlI ||TaqI ||SetI PsrI TspDTI ||BmeT110I CviJI | TspEI Hpy166II |||Hpy178III* |MboII \ \ \ \\\\ \\ ATGAAAAGAAATTGTGGACAAATAATAACGCTTTTTAGCTCGAGAAGATTACAAGCCAAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTTTCTTTAACACCTGTTTATTATTGCGAAAAATCGAGCTCTTCTAATGTTCGGTTT / // / / / // / PsrI || Hpy166II | | |Hpy178III* MboII |TspDTI | | |SmlI CviJI TspEI | | |XhoI | | |AvaI | | BmeT110I | | TaqI | CviJI | AluI SetI M K R N C G Q I I T L F S S R R L Q A K * K E I V D K * * R F L A R E D Y K P N E K K L W T N N N A F * L E K I T S Q T ----:----|----:----|----:----|----:----|----:----|----:----| I F L F Q P C I I V S K L E L L N C A L S S F F N H V F L L A K * S S F I V L W H F S I T S L Y Y R K K A R S S * L G F CviRI* SduI MseI | CviJI HgiAI* \ \ \ \ CGCCTTAAAGATGTTGAATGGGTCAAGTTGCACAGGCTATTACAGAGAGCACTTTTTAGA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GCGGAATTTCTACAACTTACCCAGTTCAACGTGTCCGATAATGTCTCTCGTGAAAAATCT / / / / MseI | CviJI HgiAI* CviRI* SduI R L K D V E W V K L H R L L Q R A L F R A L K M L N G S S C T G Y Y R E H F L D P * R C * M G Q V A Q A I T E S T F * T ----:----|----:----|----:----|----:----|----:----|----:----| R R L S T S H T L N C L S N C L A S K L V G * L H Q I P * T A C A I V S L V K * A K F I N F P D L Q V P * * L S C K K S TspEI | PsrI | |Hin6I | ||GlaI | |||HhaI | |||BseYI | |||| GsaI | |||| | TspEI Tsp4CI* | |||| | | MaeIII | MseI | |||| | | | AclI | |BccI Csp6I | |||| | | | MaeII | || PsrI |RsaI BsrI | |||| | | | |BslFI \ \\ \ \\ \ \ \\\\ \ \ \ \\ CAGTTAAAGAGATGGTACTGGCAGTTCAATGGCGTAATTGCGCTGGGACAATTTGTAACG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAATTTCTCTACCATGACCGTCAAGTTACCGCATTAACGCGACCCTGTTAAACATTGC // / // / / //// / / / // || MseI || BsrI PsrI |||| BseYI | | |MaeII || BccI |Csp6I |||Hin6I | | |AclI |PsrI RsaI |||GsaI | | MaeIII Tsp4CI* ||GlaI | TaiI |HhaI | SetI TspEI TspEI Q L K R W Y W Q F N G V I A L G Q F V T S * R D G T G S S M A * L R W D N L * R V K E M V L A V Q W R N C A G T I C N V ----:----|----:----|----:----|----:----|----:----|----:----| C N F L H Y Q C N L P T I A S P C N T V V T L S I T S A T * H R L Q A P V I Q L L * L S P V P L E I A Y N R Q S L K Y R TatI Bsp1407I |Csp6I ||RsaI |||Hpy166II |||| SpeI SduI |||| |MaeI BseSI SetI |||| || MaeIII Cac8I | Tsp4CI* TaiI |||| || | BsrDI | MnlI | | TspRI \ \\\\ \\ \ \ \ \ \ \ \ TTGGGTTGTACACTAGTAACATTGCTGGCAAATGTGAGGGCACTGTATATGAGATTATGG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCAACATGTGATCATTGTAACGACCGTTTACACTCCCGTGACATATACTCTAATACC / /// /// / / / / / BslFI ||| ||| | | MnlI | Tsp4CI* ||| ||| | Cac8I BseSI ||| ||| MaeIII TspRI ||| ||BsrDI SduI ||| |SpeI ||| MaeI ||Bsp1407I ||TatI |Hpy166II |Csp6I RsaI L G C T L V T L L A N V R A L Y M R L W W V V H * * H C W Q M * G H C I * D Y G G L Y T S N I A G K C E G T V Y E I M G ----:----|----:----|----:----|----:----|----:----|----:----| N P Q V S T V N S A F T L A S Y I L N H T P N Y V L L M A P L H S P V T Y S I I Q T T C * Y C Q Q C I H P C Q I H S * P MseI VspI PsiI BseMII SfaNI MseI |BspCNI DdeI |TspDTI BseGI FokI \\ \ \\ \ \ GAGATTAATGAAACTGAGTTTATAAGATGTGGATGCTTAATAAAGAACTTACCGAGAACA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTAATTACTTTGACTCAAATATTCTACACCTACGAATTATTTCTTGAATGGCTCTTGT // / / // / / / / || VspI | || SfaNI | MseI FokI || MseI | |PsiI BseGI |BspCNI | TspDTI BseMII DdeI E I N E T E F I R C G C L I K N L P R T R L M K L S L * D V D A * * R T Y R E Q D * * N * V Y K M W M L N K E L T E N K ----:----|----:----|----:----|----:----|----:----|----:----| S I L S V S N I L H P H K I F F K G L V P S * H F Q T * L I H I S L L S S V S F L N I F S L K Y S T S A * Y L V * R S C Hpy166II MboII | TaqI |TspEI \ \ \\ AAAGCAAAATCGGTTGTGAACGATGTCGAAGAACTTGGAGAAATTATAGATGAAGATATT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCGTTTTAGCCAACACTTGCTACAGCTTCTTGAACCTCTTTAATATCTACTTCTATAA / / / / Hpy166II TaqI MboII TspEI K A K S V V N D V E E L G E I I D E D I K Q N R L * T M S K N L E K L * M K I L S K I G C E R C R R T W R N Y R * R Y W ----:----|----:----|----:----|----:----|----:----|----:----| F A F D T T F S T S S S P S I I S S S I L L L I P Q S R H R L V Q L F * L H L Y F C F R N H V I D F F K S F N Y I F I N MboII |TspDTI || AclI || MaeII || | SetI MaeII CviJI || | TaiI SpeI | SetI | Hpy188I || | | Hpy178III* |MaeI | TaiI | | MnlI \\ \ \ \ \\ \ \ \ \ \ GGCAACAACGTTCAAGAAAACGAACTAGTGATAACGTCTATACCAAAGCCTCTGACAGAG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTTGTTGCAAGTTCTTTTGCTTGATCACTATTGCAGATATGGTTTCGGAGACTGTCTC / / / / // / / / / / | | | Hpy178III* |SpeI | MaeII | | MnlI | | MaeII MaeI TaiI | Hpy188I | | AclI SetI CviJI | TaiI | SetI TspDTI MboII G N N V Q E N E L V I T S I P K P L T E A T T F K K T N * * * R L Y Q S L * Q R Q Q R S R K R T S D N V Y T K A S D R E ----:----|----:----|----:----|----:----|----:----|----:----| P L L T * S F S S T I V D I G F G R V S Q C C R E L F R V L S L T * V L A E S L A V V N L F V F * H Y R R Y W L R Q C L MboII |BccI Tsp4CI* MboII |CviJI \ \ \\ AACTGTAAGAAGAAAAAGAAAAGGAAAAAGAAGAACAAATCAGCCATTGATGGCATATTC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTGACATTCTTCTTTTTCTTTTCCTTTTTCTTCTTGTTTAGTCGGTAACTACCGTATAAG / / / // / Tsp4CI* MboII | |BccI Hpy188I | CviJI MboII N C K K K K K R K K K N K S A I D G I F T V R R K R K G K R R T N Q P L M A Y S L * E E K E K E K E E Q I S H * W H I R ----:----|----:----|----:----|----:----|----:----|----:----| F Q L F F F F L F F F F L D A M S P M N S S Y S S F S F S F S S C I L W Q H C I V T L L F L F P F L L V F * G N I A Y E Hpy188I \ GGATAA ----:- CCTATT G * D X I X ----:- P Y R I S L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AclI 2 Psp1406I AluI 2 AluBI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I BccI 3 BcgI 1 BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmeT110I 1 BmtI 1 BspOI BseGI 2 BstF5I,BtsCI BseMII 1 BseSI 1 BaeGI,BstSLI BseYI 1 BslFI 1 BsmFI,FaqI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BsrBI 1 AccBSI,MbiI BsrDI 1 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BstKTI 2 Cac8I 2 BstC8I Csp6I 2 CviQI,RsaNI CviJI 7 CviKI-1 CviRI* 1 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 2 MalI Eco57MI 1 FokI 2 GlaI 1 GsaI 1 GsuI 1 BpmI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 1 Hin6I 1 HinP1I,HspAI Hpy166II 3 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 2 MaeI 3 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 2 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MnlI 2 MseI 5 Tru1I,Tru9I NheI 1 AsuNHI PsiI 1 AanI PsrI 2 RsaI 2 AfaI SduI 2 MhlI,Bsp1286I SetI 5 SfaNI 1 LweI SmlI 1 SmoI SpeI 2 BcuI,AhlI SspI 1 TaiI 3 TaqI 2 TatI 1 TauI 1 Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 4 TasI,Tsp509I,Sse9I TspRI 1 TscAI VspI 1 PshBI,AseI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuI* AsuII AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* Bce83I* BceAI BciVI BclI BdaI BetI* BfiI BglI BglII BmgT120I BplI Bpu10I BsaAI BsaBI BsaXI BseBI BsePI BseRI BsgI BsiI* BsiYI* BsmAI BsmI Bsp120I BspHI BspLU11I* BspMI BspMII* BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CspCI CviAII DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FatI FauI FnuDII* FseI FspAI HaeII HaeIII HgaI HgiCI* HgiJII* Hin4II* HindII HindIII HinfI HpaI HpaII HphI Hpy99I KasI KpnI Ksp632I* MauBI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NlaIII NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SecI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I StyI SwaI TaqII TfiI TseI TsoI Tsp45I TspGWI TspMI TstI Tth111I XbaI XcmI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769