Restriction Map of PUT1/YLR142W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

PUT1/YLR142W on chromosome XII from coordinates 425186 to 426616.


Hin6I AluI AluI FnuDII* CviJI CviJI |GlaI | SetI | SetI MaeIII ||HhaI MnlI \ \ \ \ \ \\\ \ ATGATAGCTTCCAAAAGCTCCTTATTAGTTACTAAATCGCGCATACCCTCTCTATGCTTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTATCGAAGGTTTTCGAGGAATAATCAATGATTTAGCGCGTATGGGAGAGATACGAAA / / / / / /// / | CviJI | CviJI MaeIII ||Hin6I MnlI | AluI | AluI |GlaI SetI SetI FnuDII* HhaI M I A S K S S L L V T K S R I P S L C F * * L P K A P Y * L L N R A Y P L Y A F D S F Q K L L I S Y * I A H T L S M L S ----:----|----:----|----:----|----:----|----:----|----:----| X I A E L L E K N T V L D R M G E R H K X S L K W F S R I L * * I A C V R E I S H Y S G F A G * * N S F R A Y G R * A K AsuI* TseI AvaII CviJI DraII |BisI PpuMI HinfI ||BlsI |BmgT120I MlyI | Hpy188I ||| BccI MnlI ||SetI PleI | | BbvI ||| |MmeI \ \\\ \ \ \ \ \\\ \\ CCTTTGATAAAGAGGTCCTATGTGTCAAAGACTCCGACACACTCTAACACGGCTGCTAAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAACTATTTCTCCAGGATACACAGTTTCTGAGGCTGTGTGAGATTGTGCCGACGATTA / / // // // / ///// / MnlI | |PpuMI |PleI |Hpy188I BbvI ||||| BccI | |DraII MlyI HinfI ||||MmeI | |AvaII |||TseI | |AsuI* ||BisI | BmgT120I |BlsI SetI CviJI P L I K R S Y V S K T P T H S N T A A N L * * R G P M C Q R L R H T L T R L L I F D K E V L C V K D S D T L * H G C * S ----:----|----:----|----:----|----:----|----:----|----:----| G K I F L D * T D F V G V C E L V A A L E K S L S T R H T L S E S V S * C P Q * R Q Y L P G I H * L S R C V R V R S S I HpaII |CfrI |XmaIII* || CviJI || HaeIII || |AciI || |BisI || |McrI* BceAI || ||BlsI HgiCI* Hpy188I || |||TauI Hin4I | NlaIV | BceAI || |||| MwoI | BccI | | SetI \ \ \\ \\\\ \ \ \ \ \ \ CTGATGGTTGAAACTCCGGCCGCCAATGCCAACGGCAATAGTGTGATGGCACCTCCTAAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GACTACCAACTTTGAGGCCGGCGGTTACGGTTGCCGTTATCACACTACCGTGGAGGATTG / / ///// / / / / | BceAI ||||MwoI Hin4I BccI | HgiCI* Hpy188I ||||AciI BceAI |||XmaIII* NlaIV |||CfrI SetI |||BisI ||BlsI |HaeIII |CviJI |TauI HpaII McrI* L M V E T P A A N A N G N S V M A P P N * W L K L R P P M P T A I V * W H L L T D G * N S G R Q C Q R Q * C D G T S * L ----:----|----:----|----:----|----:----|----:----|----:----| R I T S V G A A L A L P L L T I A G G L D S P Q F E P R W H W R C Y H S P V E * Q H N F S R G G I G V A I T H H C R R V MnlI TfiI | TspEI BsrI | | Hin4I HinfI | | | SfeI* Hin4II* TspDTI | BfiI \ \ \ \ \ \ \ \ TCAATCAATTTTCTACAGACACTTCCCAAGAAGGAACTATTCCAACTGGGATTCATCGGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTAGTTAAAAGATGTCTGTGAAGGGTTCTTCCTTGATAAGGTTGACCCTAAGTAGCCA / / / / / / / // | Hin4I TspEI SfeI* Hin4II* TspDTI BsrI |BfiI MnlI HinfI TfiI S I N F L Q T L P K K E L F Q L G F I G Q S I F Y R H F P R R N Y S N W D S S V N Q F S T D T S Q E G T I P T G I H R Y ----:----|----:----|----:----|----:----|----:----|----:----| E I L K R C V S G L F S S N W S P N M P S L * N E V S V E W S P V I G V P I * R * D I K * L C K G L L F * E L Q S E D T MmeI | SetI | | MboII | | | BdaI Hpy178III* FokI | | | BdaI | MboI | BdaI | | | |XmnI | | DpnI | BdaI | | | ||AluI | | |BstKTI | | BseGI | | | ||CviJI | | || MseI | | | BfiI | | | ||| SetI | | || | FokI | | | |BseGI \ \ \ \\\ \ \ \ \\ \ \ \ \ \ \\ ATTGCGACCTTGAACAGCTTCTTCCTGAACACGATCATTAAGTTGTTCCCTTACATCCCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGCTGGAACTTGTCGAAGAAGGACTTGTGCTAGTAATTCAACAAGGGAATGTAGGGG / / / / /// / // / / / / // / | SetI | | ||CviJI | || | | | | |BseGI BseGI MmeI | | ||AluI | || | | | | FokI BfiI | | |XmnI | || | | | BdaI | | SetI | || | | | BdaI | BdaI | || | | FokI | BdaI | || | MseI MboII | || MboI | |DpnI | BstKTI Hpy178III* I A T L N S F F L N T I I K L F P Y I P L R P * T A S S * T R S L S C S L T S P C D L E Q L L P E H D H * V V P L H P H ----:----|----:----|----:----|----:----|----:----|----:----| I A V K F L K K R F V I M L N N G * M G Y Q S R S C S R G S C S * * T T G K C G N R G Q V A E E Q V R D N L Q E R V D G BsrI | BccI BsmAI | | MboII Esp3I MnlI | | | ApoI | Ksp632I* | MseI | | | TspEI | | Tsp4CI* | |AhaIII* | | | | MboII | | | AciI | ||HphI \ \ \ \ \ \ \ \ \ \ \\\ ATCCCAGTAATAAAATTCTTCGTCTCTTCTTTATACTGTGGCGGTGAGAACTTTAAAGAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGGTCATTATTTTAAGAAGCAGAGAAGAAATATGACACCGCCACTCTTGAAATTTCTC / / // / / / / / // / BsrI MboII |TspEI | | | AciI | || SetI BccI |ApoI | | Tsp4CI* | |MseI MboII | Ksp632I* | AhaIII* Esp3I | HphI BsmAI MnlI I P V I K F F V S S L Y C G G E N F K E S Q * * N S S S L L Y T V A V R T L K R P S N K I L R L F F I L W R * E L * R G ----:----|----:----|----:----|----:----|----:----|----:----| M G T I F N K T E E K Y Q P P S F K L S W G L L L I R R R K K I S H R H S S * L D W Y Y F E E D R R * V T A T L V K F L AciI |BisI ||BlsI ||BsmI |||TauI SetI |||| MaeII |AlfI |||| | SetI |AlfI |||| | TaiI ||SfaNI |||| | |SfeI* |||MboII |||| | |Ksp632I* ||||TaqI SetI |||| | || CviRI* ||||| FatI |AlfI |||| | || |MnlI ||||| TspDTI |AlfI |||| | || ||PstI ||||| |CviAII || TaqI |||| | || ||| BcgI ||||| || NlaIII MseI \\ \ \\\\ \ \\ \\\ \ \\\\\ \\ \ \ GTCATCGAATGCGGCAAACGTCTGCAGAAGAGAGGTATATCGAACATGATGCTTTCATTA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTAGCTTACGCCGTTTGCAGACGTCTTCTCTCCATATAGCTTGTACTACGAAAGTAAT / / /// / / / /// / / / / / / // / AlfI | ||| | | | ||| | | | | | | |FatI MseI AlfI | ||| | | | ||| | | | | | | CviAII | ||| | | | ||| | | | | | NlaIII | ||| | | | ||| | | | | TspDTI | ||| | | | ||| | | | | SfaNI | ||| | | | ||| | | | | TaqI | ||| | | | ||| | | | MboII | ||| | | | ||| | | AlfI | ||| | | | ||| | | AlfI | ||| | | | ||| | SetI | ||| | | | ||| BcgI | ||| | | | ||SfeI* | ||| | | | |Ksp632I* | ||| | | | CviRI* | ||| | | | MnlI | ||| | | PstI | ||| | MaeII | ||| TaiI | ||| SetI | ||BisI | ||AciI | |BlsI | BsmI | TauI TaqI V I E C G K R L Q K R G I S N M M L S L S S N A A N V C R R E V Y R T * C F H * H R M R Q T S A E E R Y I E H D A F I N ----:----|----:----|----:----|----:----|----:----|----:----| T M S H P L R R C F L P I D F M I S E N P * R I R C V D A S S L Y I S C S A K M D D F A A F T Q L L S T Y R V H H K * * BsrI | TatI | |Csp6I ApoI | ||RsaI TspEI | ||ScaI |Hin4II* | ||| BsrI || Hpy188I | ||| | AccI || | Csp6I | ||| | |Hpy166II || | |RsaI GsuI | ||| | || TspEI BcgI || | |SetI Eco57MI | ||| | || | DrdI \ \\ \ \\ \ \ \\\ \ \\ \ \ ACTATTGAAAATTCCGAAGGTACAAAGAGTTTGTCCAGTACTCCAGTAGACCAAATTGTC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGATAACTTTTAAGGCTTCCATGTTTCTCAAACAGGTCATGAGGTCATCTGGTTTAACAG / / // / // / / /// // / / BcgI | || | || Eco57MI BsrI ||TatI || | TspEI | || | || GsuI ||BsrI || DrdI | || | |Csp6I |Csp6I |AccI | || | RsaI ScaI Hpy166II | || SetI RsaI | |Hpy188I | TspEI | ApoI Hin4II* T I E N S E G T K S L S S T P V D Q I V L L K I P K V Q R V C P V L Q * T K L S Y * K F R R Y K E F V Q Y S S R P N C Q ----:----|----:----|----:----|----:----|----:----|----:----| V I S F E S P V F L K D L V G T S W I T L * Q F N R L Y L S N T W Y E L L G F Q S N F I G F T C L T Q G T S W Y V L N D CfrI | BalI | CviJI | HaeIII | | Cac8I | | | AluI | | | CviJI | | | PvuII FokI | | | NspBII* |AluI | | | | SetI |CviJI Hpy166II | | | | | TfiI || SetI | BseGI SspI | | | | | HinfI \\ \ \ \ \ \ \ \ \ \ \ AAGGAAACAATCAGCTCTGTCCACAACATCCTACTGCCCAATATTATTGGCCAGCTGGAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTTTGTTAGTCGAGACAGGTGTTGTAGGATGACGGGTTATAATAACCGGTCGACCTT / / / / / / / / / | | | | BseGI SspI | | NspBII* | | | Hpy166II | | PvuII | | FokI | | CviJI | CviJI | | AluI | AluI | Cac8I SetI | CfrI | SetI HaeIII CviJI BalI K E T I S S V H N I L L P N I I G Q L E R K Q S A L S T T S Y C P I L L A S W N G N N Q L C P Q H P T A Q Y Y W P A G I ----:----|----:----|----:----|----:----|----:----|----:----| L S V I L E T W L M R S G L I I P W S S * P F L * S Q G C C G V A W Y * Q G A P L F C D A R D V V D * Q G I N N A L Q F BssKI DdeI EcoRII | CviJI | ScrFI | | GsuI | BseBI MnlI | | Eco57MI BsrDI | | SetI | TaqI \ \ \ \ \ \ \ \ \ TCTAAGCCAATCAATGACATTGCTCCAGGTTATATCGCTCTAAAACCCTCTGCTTTGGTC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGATTCGGTTAGTTACTGTAACGAGGTCCAATATAGCGAGATTTTGGGAGACGAAACCAG / // / // / / | |Eco57MI BsrDI || EcoRII MnlI | |CviJI || BssKI | |GsuI |BseBI | DdeI |ScrFI HinfI SetI TfiI S K P I N D I A P G Y I A L K P S A L V L S Q S M T L L Q V I S L * N P L L W S * A N Q * H C S R L Y R S K T L C F G R ----:----|----:----|----:----|----:----|----:----|----:----| D L G I L S M A G P * I A R F G E A K T I * A L * H C Q E L N Y R E L V R Q K P R L W D I V N S W T I D S * F G R S Q D MnlI | BsiI* | Hpy178III* | | BsiYI* | | | SetI | | | MnlI | | | | TatI | | | | Bsp1407I FauI | | | | |Csp6I |BglI MboI | | | | ||RsaI |MwoI | DpnI | | | | ||| TspEI AciI || CviJI | |BstKTI \ \ \ \ \\\ \ \ \\ \ \ \\ GATAACCCTCACGAGGTTCTGTACAATTTCAGTAATCCCGCCTACAAGGCTCAAAGGGAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTGGGAGTGCTCCAAGACATGTTAAAGTCATTAGGGCGGATGTTCCGAGTTTCCCTA / / / /// / /// / / / / / / // | | | ||| MnlI ||| TspEI | | | CviJI | |DpnI | | | ||BsiI* ||Bsp1407I | | FauI | BstKTI | | | |SetI ||TatI | MwoI BplI | | | | |Csp6I | BglI BplI | | | | RsaI AciI | | | Hpy178III* | | BsiYI* | MnlI TaqI D N P H E V L Y N F S N P A Y K A Q R D I T L T R F C T I S V I P P T R L K G I * P S R G S V Q F Q * S R L Q G S K G S ----:----|----:----|----:----|----:----|----:----|----:----| S L G * S T R Y L K L L G A * L A * L S R Y G E R P E T C N * Y D R R C P E F P I V R V L N Q V I E T I G G V L S L P I BplI BplI | AluI | CviJI | PvuII | NspBII* | | MboI | | SetI | | BinI* | | | DpnI BdaI | | | |TaqI BdaI | | | |BstKTI | BplI | | | ||Hpy178III* DdeI | BplI \ \ \ \\\ \ \ \ CAGCTGATCGAGAACTGCTCTAAGATTACAAAAGAGATTTTTGAACTAAATCAATCTTTG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGACTAGCTCTTGACGAGATTCTAATGTTTTCTCTAAAAACTTGATTTAGTTAGAAAC / / // /// / // | | || ||Hpy178III* DdeI |BdaI | | || |TaqI |BdaI | | || MboI BplI | | |DpnI BplI | | BstKTI | | BinI* | NspBII* | PvuII | CviJI | AluI MboI SetI Q L I E N C S K I T K E I F E L N Q S L S * S R T A L R L Q K R F L N * I N L C A D R E L L * D Y K R D F * T K S I F V ----:----|----:----|----:----|----:----|----:----|----:----| * S I S F Q E L I V F S I K S S F * D K D A S R S S S * S * L L S K Q V L D I K L Q D L V A R L N C F L N K F * I L R Q AsuI* MseI DraII | BdaI |CviJI | BdaI |HaeIII | | Csp6I |BmgT120I BseMII | | |RsaI ||NlaIV BsiYI* |BspCNI DdeI HgaI \ \ \\ \\\ \ \\ \ \ TTAAAGAAGTACCCTGAAAGAAAGGCCCCATTTATGGTTTCCACTATTGACGCTGAGAAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTCTTCATGGGACTTTCTTTCCGGGGTAAATACCAAAGGTGATAACTGCGACTCTTC / // /// / // / BdaI |Csp6I ||| BsiYI* |BspCNI DdeI BdaI RsaI ||DraII BseMII MseI ||AsuI* |BmgT120I |NlaIV HaeIII CviJI L K K Y P E R K A P F M V S T I D A E K * R S T L K E R P H L W F P L L T L R S K E V P * K K G P I Y G F H Y * R * E V ----:----|----:----|----:----|----:----|----:----|----:----| N F F Y G S L F A G N I T E V I S A S F T L S T G Q F F P G M * P K W * Q R Q S * L L V R F S L G W K H N G S N V S L L ApoI Hpy166II TfiI TspEI CviRI* | TspEI HinfI | TspDTI \ \ \ \ \ \ TATGATTTGCAGGAGAATGGTGTTTACGAATTACAGAGAATCTTATTTCAAAAATTCAAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTAAACGTCCTCTTACCACAAATGCTTAATGTCTCTTAGAATAAAGTTTTTAAGTTA / / / / / / / HgaI CviRI* | TspEI HinfI | TspEI Hpy166II TfiI | ApoI TspDTI Y D L Q E N G V Y E L Q R I L F Q K F N M I C R R M V F T N Y R E S Y F K N S I * F A G E W C L R I T E N L I S K I Q S ----:----|----:----|----:----|----:----|----:----|----:----| Y S K C S F P T * S N C L I K N * F N L T H N A P S H H K R I V S F R I E F I * I I Q L L I T N V F * L S D * K L F E I Csp6I EcoRV |RsaI | FatI || MlyI | |CviAII || PleI | || NlaIII || DdeI | || | Csp6I || SauI* | || | |RsaI || |SetI HinfI \ \\ \ \\ \\ \\ \ CCCACTTCATCTAAACTGATATCATGTGTCGGTACTTGGCAGTTGTACCTAAGGGACTCT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTGAAGTAGATTTGACTATAGTACACAGCCATGAACCGTCAACATGGATTCCCTGAGA / / // // // // / / | | |FatI |Csp6I || || SauI* HinfI | | CviAII RsaI || || DdeI | NlaIII || |PleI EcoRV || MlyI |Csp6I RsaI SetI P T S S K L I S C V G T W Q L Y L R D S P L H L N * Y H V S V L G S C T * G T L H F I * T D I M C R Y L A V V P K G L W ----:----|----:----|----:----|----:----|----:----|----:----| G V E D L S I D H T P V Q C N Y R L S E D W K M * V S I M H R Y K A T T G L P S G S * R F Q Y * T D T S P L Q V * P V R AluI CviJI CviJI | SetI | HindIII | Cac8I | | AluI MaeIII | |AsuI* | | CviJI Tsp45I HphI | ||CviJI | | | SetI BstEII | CviRI* | ||HaeIII | | | | CviJI | BslFI | | TspEI | ||BmgT120I | | | | BceAI \ \ \ \ \ \ \\\ \ \ \ \ \ GGTGACCATATTTTGCACGAATTGAAGCTGGCCCAAGAAAACGGCTATAAGCTTGGGCTG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTGGTATAAAACGTGCTTAACTTCGACCGGGTTCTTTTGCCGATATTCGAACCCGAC / // / / / / / /// / / / / / / | || CviRI* | | | | ||AsuI* | | | | | BceAI | |HphI | | | | |BmgT120I | | | | CviJI | BslFI | | | | HaeIII | | | HindIII BstEII | | | | CviJI | | CviJI Tsp45I | | | Cac8I | | AluI MaeIII | | CviJI | SetI | | AluI CviJI | SetI TspEI G D H I L H E L K L A Q E N G Y K L G L V T I F C T N * S W P K K T A I S L G * * P Y F A R I E A G P R K R L * A W A E ----:----|----:----|----:----|----:----|----:----|----:----| P S W I K C S N F S A W S F P * L S P S Q H G Y K A R I S A P G L F R S Y A Q A T V M N Q V F Q L Q G L F V A I L K P Q MaeIII Tsp4CI* | TspEI BsrI TspDTI Hpy188I | | XcmI TsoI \ \ \ \ \ \ \ AAACTGGTTCGTGGTGCTTATATTCATTCTGAAAAAAACCGTAACCAAATTATCTTTGGC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGACCAAGCACCACGAATATAAGTAAGACTTTTTTTGGCATTGGTTTAATAGAAACCG / / / / / / / BsrI TspDTI Hpy188I | | | TsoI | | TspEI | | XcmI | MaeIII Tsp4CI* K L V R G A Y I H S E K N R N Q I I F G N W F V V L I F I L K K T V T K L S L A T G S W C L Y S F * K K P * P N Y L W R ----:----|----:----|----:----|----:----|----:----|----:----| F S T R P A * I * E S F F R L W I I K P S V P E H H K Y E N Q F F G Y G F * R Q F Q N T T S I N M R F F V T V L N D K A SduI BseSI | BaeI | | TspRI | | | TspEI | | | | Bce83I* | | | | |MboI | | | | || DpnI | | | | || |PvuI | | | | || |McrI* | | | | || |BstKTI SmlI BaeI MseI \ \ \ \ \\ \\ \ \ \ GATAAAACGGGCACTGACGAAAATTACGATCGTATCATCACTCAAGTTGTCAATGATTTA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTTTGCCCGTGACTGCTTTTAATGCTAGCATAGTAGTGAGTTCAACAGTTACTAAAT // // // / / / / |BaeI || || MboI | SmlI MseI BseSI || |DpnI BaeI TspRI || BstKTI SduI || McrI* || PvuI |TspEI Bce83I* D K T G T D E N Y D R I I T Q V V N D L I K R A L T K I T I V S S L K L S M I * * N G H * R K L R S Y H H S S C Q * F N ----:----|----:----|----:----|----:----|----:----|----:----| S L V P V S S F * S R I M V * T T L S K R Y F P C Q R F N R D Y * * E L Q * H N I F R A S V F I V I T D D S L N D I I * TfiI MaeIII TspEI MnlI HinfI Tsp45I | MnlI \ \ \ \ \ ATCATCAATGGCGAGGATTCTTATTTTGGTCACTTGGTTGTCGCCTCTCATAATTACCAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTAGTTACCGCTCCTAAGAATAAAACCAGTGAACCAACAGCGGAGAGTATTAATGGTT / / / / / MnlI HinfI Tsp45I | TspEI TfiI MaeIII MnlI I I N G E D S Y F G H L V V A S H N Y Q S S M A R I L I L V T W L S P L I I T N H Q W R G F L F W S L G C R L S * L P I ----:----|----:----|----:----|----:----|----:----|----:----| I M L P S S E * K P * K T T A E * L * W L * * H R P N K N Q D S P Q R R E Y N G D D I A L I R I K T V Q N D G R M I V L MaeIII | TspEI AjuI TaqI \ \ \ \ TCCCAAATGCTCGTTACTAATTTGCTAAAATCTACCCAAGACAACTCTTATGCCAAATCG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AGGGTTTACGAGCAATGATTAAACGATTTTAGATGGGTTCTGTTGAGAATACGGTTTAGC / / / / | TspEI AjuI TaqI MaeIII S Q M L V T N L L K S T Q D N S Y A K S P K C S L L I C * N L P K T T L M P N R P N A R Y * F A K I Y P R Q L L C Q I E ----:----|----:----|----:----|----:----|----:----|----:----| D W I S T V L K S F D V W S L E * A L D I G F A R * * N A L I * G L C S K H W I G L H E N S I Q * F R G L V V R I G F R MaeI | AjuI SetI TspEI | | SetI MaeIII SetI TspEI \ \ \ \ \ \ \ AACATTGTGTTGGGGCAATTACTAGGTATGGCAGATAATGTTACCTATGACCTAATTACC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTAACACAACCCCGTTAATGATCCATACCGTCTATTACAATGGATACTGGATTAATGG // // / / / / || |MaeI | | SetI TspEI || SetI | MaeIII |TspEI SetI AjuI N I V L G Q L L G M A D N V T Y D L I T T L C W G N Y * V W Q I M L P M T * L P H C V G A I T R Y G R * C Y L * P N Y Q ----:----|----:----|----:----|----:----|----:----|----:----| F M T N P C N S P I A S L T V * S R I V S C Q T P A I V L Y P L Y H * R H G L * V N H Q P L * * T H C I I N G I V * N G FatI NcoI StyI SecI* DsaI* |CviAII || NlaIII || |AsuI* || |DraII || |Bsp120I || ||AsuI* || ||NlaIV FatI || ||BmgT120I NcoI || |||CviJI StyI || |||NlaIV SecI* || |||HaeIII DsaI* || |||BmgT120I |CviAII || |||| ApaI || NlaIII || |||| SduI || |Hin6I || |||| BseSI || ||GlaI || |||| HgiJII* || |||HhaI || |||| | BsiYI* || ||||HaeII || |||| | | FalI || ||||| BslFI || |||| | | FalI \\ \\\\\ \ \\ \\\\ \ \ \ AACCATGGCGCTAAAAACATAATCAAGTATGTCCCATGGGGCCCACCATTGGAAACTAAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGTACCGCGATTTTTGTATTAGTTCATACAGGGTACCCCGGGTGGTAACCTTTGATTT / ///// / / /////// / | ||||Hin6I BslFI | ||||||| BsiYI* | |||GlaI | ||||||| FalI | ||HhaI | ||||||| FalI | |DsaI* | ||||||Bsp120I | |SecI* | ||||||AsuI* | |HaeII | |||||BmgT120I | |StyI | |||||DraII | |NcoI | |||||AsuI* | |FatI | ||||BmgT120I | CviAII | ||||HaeIII NlaIII | ||||NlaIV | ||||CviJI | |||NlaIV | ||HgiJII* | ||BseSI | ||SduI | ||ApaI | |DsaI* | |SecI* | |StyI | |NcoI | |FatI | CviAII NlaIII N H G A K N I I K Y V P W G P P L E T K T M A L K T * S S M S H G A H H W K L K P W R * K H N Q V C P M G P T I G N * R ----:----|----:----|----:----|----:----|----:----|----:----| L W P A L F M I L Y T G H P G G N S V L W G H R * F C L * T H G M P G V M P F * V M A S F V Y D L I D W P A W W Q F S F BseGI | MboI | BglII CviJI CviRI* | XhoII | CfrI |FalI | | DpnI | Cac8I |FalI | | |FokI | | BalI || SfaNI | | |BstKTI | | CviJI || | MboII | | || Hpy188I | | HaeIII \\ \ \ \ \ \\ \ \ \ \ GATTATCTTTTGAGAAGATTGCAAGAAAACGGGGATGCTGTGAGATCTGATAATGGCTGG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTAATAGAAAACTCTTCTAACGTTCTTTTGCCCCTACGACACTCTAGACTATTACCGACC / / / / / // / / / / / | | | SfaNI BseGI || | FokI | | HaeIII | | MboII || Hpy188I | | CviJI | CviRI* || XhoII | | BalI FalI || BglII | Cac8I FalI || MboI CviJI |DpnI BstKTI D Y L L R R L Q E N G D A V R S D N G W I I F * E D C K K T G M L * D L I M A G L S F E K I A R K R G C C E I * * W L A ----:----|----:----|----:----|----:----|----:----|----:----| S * R K L L N C S F P S A T L D S L P Q L N D K S F I A L F R P H Q S I Q Y H S I I K Q S S Q L F V P I S H S R I I A P TaqI StuI MseI CviJI | TfiI CviJI VspI HaeIII | HinfI HaeIII \ \ \ \ \ CCATTAATCAAGGCCATAGCAAAGTCGATTCCAAAAAGAGTAGGCCTATGA 1390 1400 1410 1420 1430 ----:----|----:----|----:----|----:----|----:----|- GGTAATTAGTTCCGGTATCGTTTCAGCTAAGGTTTTTCTCATCCGGATACT / / / / / / | VspI HaeIII | HinfI HaeIII | MseI CviJI | TfiI CviJI CfrI TaqI StuI P L I K A I A K S I P K R V G L * H * S R P * Q S R F Q K E * A Y X I N Q G H S K V D S K K S R P M X ----:----|----:----|----:----|----:----|----:----|- G N I L A M A F D I G F L T P R H A M L * P W L L T S E L F L L G I W * D L G Y C L R N W F S Y A * S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 4 BspACI,SsiI AhaIII* 1 DraI AjuI 1 AlfI 2 AluI 8 AluBI ApaI 1 ApoI 3 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 2 MlsI,MluNI,MscI,Msp20I BbvI 1 BseXI,BstV1I,Lsp1109I BccI 3 Bce83I* 1 BpuEI BceAI 3 BcgI 1 BdaI 4 BfiI 2 BmrI,BmuI BglI 1 BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 5 BplI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 1 BseSI 2 BaeGI,BstSLI BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp120I 1 PspOMI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BsrDI 1 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 5 Cac8I 3 BstC8I CfrI 3 AcoI,EaeI Csp6I 6 CviQI,RsaNI CviAII 4 CviJI 22 CviKI-1 CviRI* 4 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 5 MalI DraII 3 EcoO109I DrdI 1 AasI,DseDI DsaI* 2 BtgI,BstDSI Eco57MI 2 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI FalI 2 FatI 4 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GlaI 2 GsuI 2 BpmI HaeII 1 BstH2I HaeIII 8 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 2 HpyAV Hin6I 2 HinP1I,HspAI HindIII 1 HinfI 7 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 5 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 6 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 McrI* 2 BsiEI,BstMCI,Bsh1285I MlyI 2 SchI MmeI 2 MnlI 10 MseI 6 Tru1I,Tru9I MwoI 2 HpyF10VI,BstMWI NcoI 2 Bsp19I NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspBII* 2 MspA1I PleI 2 PpsI PpuMI 1 Psp5II,PspPPI PstI 1 PvuI 1 MvrI,Ple19I,BpvUI PvuII 2 RsaI 6 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 21 SfaNI 2 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 6 TatI 2 TauI 2 TfiI 5 PfeI TseI 1 ApeKI TsoI 1 Tsp45I 2 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 14 TasI,Tsp509I,Sse9I TspRI 1 TscAI VspI 1 PshBI,AseI XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AflIII AgeI AloI AlwNI ApaLI AscI Asp718I AsuII AvaI AvrII BamHI BarI BbvCI BbvII* BciVI BclI BetI* BmeT110I BmtI Bpu10I BsaAI BsaBI BsaXI BsePI BseRI BseYI BsgI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I ClaI CspCI DinI DraIII Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoP15I EcoRI EcoT22I EgeI EheI EspI* FseI FspAI GsaI HgiAI* HindII HpaI Hpy99I KasI KpnI MauBI MfeI MluI Mph1103I MroNI MslI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PsiI PspXI PsrI RsrII SacI SacII SalI SanDI SapI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TaqII TspGWI TspMI TstI Tth111I XbaI XhoI XmaCI XmaI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769