Restriction Map of PDC5/YLR134W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

PDC5/YLR134W on chromosome XII from coordinates 410723 to 412414.


HindII Hpy166II | MaeIII DdeI | Tsp4CI* SauI* SetI BdaI | | MboII Hpy188I |SetI | SspI BdaI CviJI | | BbvII* \ \\ \ \ \ \ \ \ \ ATGTCTGAAATAACCTTAGGTAAATATTTATTTGAAAGATTGAGCCAAGTCAACTGTAAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGACTTTATTGGAATCCATTTATAAATAAACTTTCTAACTCGGTTCAGTTGACATTG / / // / / / / / / / | SetI |SauI* | BdaI CviJI | | | MaeIII Hpy188I |DdeI | BdaI | | MboII SetI SspI | Tsp4CI* Hpy166II HindII M S E I T L G K Y L F E R L S Q V N C N C L K * P * V N I Y L K D * A K S T V T V * N N L R * I F I * K I E P S Q L * H ----:----|----:----|----:----|----:----|----:----|----:----| X D S I V K P L Y K N S L N L W T L Q L X T Q F L R L Y I N I Q F I S G L * S Y H R F Y G * T F I * K F S Q A L D V T V BssKI EcoRII | ScrFI | BseBI HindIII Tsp4CI* | | MaeIII | AluI |BdaI | | Tsp45I | CviJI |BdaI | | | SetI MseI HphI BsmAI | | SetI \\ \ \ \ \ \ \ \ \ \ \ ACCGTCTTCGGTTTGCCAGGTGACTTTAACTTGTCTCTTTTGGATAAGCTTTATGAAGTC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCAGAAGCCAAACGGTCCACTGAAATTGAACAGAGAAAACCTATTCGAAATACTTCAG // // / / / / / / / / |Tsp4CI* || | | | HphI | | | HindIII |BdaI || | | MseI | | CviJI |BdaI || | Tsp45I | | AluI BbvII* || | MaeIII | SetI || EcoRII BsmAI || BssKI |BseBI |ScrFI SetI T V F G L P G D F N L S L L D K L Y E V P S S V C Q V T L T C L F W I S F M K S R L R F A R * L * L V S F G * A L * S Q ----:----|----:----|----:----|----:----|----:----|----:----| V T K P K G P S K L K D R K S L S * S T C R R R N A L H S * S T E K P Y A K H L G D E T Q W T V K V Q R K Q I L K I F D CviJI | MaeIII | | MwoI | | EcoP15I | | | BbvI | | | | TspEI | | | | | BbvI | | | | | | TseI | | | | | | |BisI | | | | | | ||BlsI | | | | | | ||| MwoI | | | | | | ||| |TsoI | | | | | | ||| || BccI | | | | | | ||| || TseI | | | | | | ||| || MwoI BccI | | | | | | ||| || |BisI |SetI | | | | | | ||| || ||BaeI || TspDTI | | | | | | ||| || ||BlsI MaeIII \\ \ \ \ \ \ \ \ \\\ \\ \\\ \ AAAGGTATGAGATGGGCTGGTAACGCTAACGAATTGAACGCTGCCTATGCTGCTGATGGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCCATACTCTACCCGACCATTGCGATTGCTTAACTTGCGACGGATACGACGACTACCA / / / / / / / //// // /// | TspDTI | MwoI | | | |||| || ||TseI | BccI CviJI | | | |||| || |BisI SetI | | | |||| || BlsI | | | |||| || BccI | | | |||| |MwoI | | | |||| |BaeI | | | |||| TsoI | | | |||MwoI | | | |||TseI | | | ||BisI | | | |BlsI | | | BbvI | | TspEI | BbvI EcoP15I MaeIII K G M R W A G N A N E L N A A Y A A D G K V * D G L V T L T N * T L P M L L M V R Y E M G W * R * R I E R C L C C * W L ----:----|----:----|----:----|----:----|----:----|----:----| L P I L H A P L A L S N F A A * A A S P * L Y S I P Q Y R * R I S R Q R H Q Q H F T H S P S T V S V F Q V S G I S S I T Hin4II* BaeI SetI | TspEI \ \ \ \ TACGCTCGTATCAAGGGTATGTCCTGTATTATTACCACCTTCGGTGTTGGTGAATTGTCT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCGAGCATAGTTCCCATACAGGACATAATAATGGTGGAAGCCACAACCACTTAACAGA / / / / / / / MaeIII BaeI SetI Hin4II* | | HphI | PsrI TspEI Y A R I K G M S C I I T T F G V G E L S T L V S R V C P V L L P P S V L V N C L R S Y Q G Y V L Y Y Y H L R C W * I V C ----:----|----:----|----:----|----:----|----:----|----:----| * A R I L P I D Q I I V V K P T P S N D N R E Y * P Y T R Y * * W R R H Q H I T V S T D L T H G T N N G G E T N T F Q R FatI AflIII BspLU11I* |CviAII CviRI* ||PsrI | MaeII ||| NspI | |FokI HphI Cfr10I ||| NlaIII | || SetI | PsrI |HpaII ||| |MslI | || TaiI \ \ \\ \\\ \\ \ \\ \ GCTTTGAATGGTATTGCCGGTTCTTACGCTGAACATGTCGGTGTTTTGCACGTTGTTGGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAACTTACCATAACGGCCAAGAATGCGACTTGTACAGCCACAAAACGTGCAACAACCA // / / /// // / / / |Cfr10I | | ||MslI || | FokI Bce83I* HpaII | | |BspLU11I* || MaeII | | |AflIII |TaiI | | |FatI |SetI | | CviAII CviRI* | NlaIII | NspI PsrI A L N G I A G S Y A E H V G V L H V V G L * M V L P V L T L N M S V F C T L L V F E W Y C R F L R * T C R C F A R C W C ----:----|----:----|----:----|----:----|----:----|----:----| A K F P I A P E * A S C T P T K C T T P Q K S H Y Q R N K R Q V H R H K A R Q Q S Q I T N G T R V S F M D T N Q V N N T BccI | BccI | |SmlI | ||Ksp632I* StyI | ||| AluI SecI* | ||| CviJI |SfaNI | ||| |DdeI ||SetI | ||| |EspI* ||| MaeIII Bce83I* | ||| ||SetI ||| | MaeIII | BseGI | ||| ||| MfeI ||| | Tsp45I | |MboII | ||| ||| TspEI CviRI* ||| | Tsp4CI* \ \\ \ \\\ \\\ \ \ \\\ \ \ GTTCCATCCATCTCTTCTCAAGCTAAGCAATTGTTGTTGCATCATACCTTGGGTAACGGT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGGTAGGTAGAGAAGAGTTCGATTCGTTAACAACAACGTAGTATGGAACCCATTGCCA / / / / /// / / / / // / | MboII | | ||| EspI* TspEI | SetI || Tsp4CI* BseGI | | ||| DdeI MfeI CviRI* || MaeIII | | ||CviJI |SfaNI | | ||AluI SecI* | | |Ksp632I* StyI | | |SmlI | | SetI | BccI BccI V P S I S S Q A K Q L L L H H T L G N G F H P S L L K L S N C C C I I P W V T V S I H L F S S * A I V V A S Y L G * R * ----:----|----:----|----:----|----:----|----:----|----:----| T G D M E E * A L C N N N C * V K P L P H E M W R K E L * A I T T A D Y R P Y R N W G D R R L S L L Q Q Q M M G Q T V T MslI |FatI ||TspRI ||CviAII ||| MboI ||| BclI ||| |NlaIII ||| ||DpnI Tsp4CI* ||| |||BstKTI |HphI Hpy188I ||| |||| GsuI || TspRI | BtsI ||| |||| Eco57MI \\ \ \ \ \\\ \\\\ \ GACTTCACTGTTTTCCACAGAATGTCTGCCAACATTTCTGAAACCACTGCCATGATCACT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAGTGACAAAAGGTGTCTTACAGACGGTTGTAAAGACTTTGGTGACGGTACTAGTGA / // / / // /// / | |HphI | TspRI || ||| Eco57MI | Tsp4CI* | BtsI || ||| BclI Tsp45I Hpy188I || ||| MboI MaeIII || ||| GsuI TspRI || ||DpnI || |BstKTI || |TspRI || |FatI || CviAII |NlaIII MslI D F T V F H R M S A N I S E T T A M I T T S L F S T E C L P T F L K P L P * S L L H C F P Q N V C Q H F * N H C H D H * ----:----|----:----|----:----|----:----|----:----|----:----| S K V T K W L I D A L M E S V V A M I V H S * Q K G C F T Q W C K Q F W Q W S * V E S N E V S H R G V N R F G S G H D S BaeI |AluI |CviJI |PvuII |NspBII* || SetI SetI TspRI || | TspEI Hpy188I | BaeI \ \\ \ \ \ \ \ GATATTGCTAACGCTCCAGCTGAAATTGACAGATGTATCAGAACCACCTACACTACCCAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAACGATTGCGAGGTCGACTTTAACTGTCTACATAGTCTTGGTGGATGTGATGGGTT / / / / / // | | NspBII* TspEI | |BaeI | | PvuII | SetI | | CviJI Hpy188I | | AluI | SetI BaeI D I A N A P A E I D R C I R T T Y T T Q I L L T L Q L K L T D V S E P P T L P K Y C * R S S * N * Q M Y Q N H L H Y P K ----:----|----:----|----:----|----:----|----:----|----:----| S I A L A G A S I S L H I L V V * V V W Q Y Q * R E L Q F Q C I Y * F W R C * G I N S V S W S F N V S T D S G G V S G L Cac8I | AluI | CviJI | | SetI | | | BslFI | | | | HindII | | | | Hpy166II | | | | | DrdI | | | | | |MaeII | | | | | || SetI | | | | | || TaiI BsrI | | | | | || |BseYI | AccI | | | | | || || GsaI | |Hpy166II | | | | | || || CviJI BstXI \ \\ \ \ \ \ \ \\ \\ \ \ AGACCAGTCTACTTGGGTTTGCCAGCTAACTTGGTTGACTTGAACGTCCCAGCCAAGTTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGGTCAGATGAACCCAAACGGTCGATTGAACCAACTGAACTTGCAGGGTCGGTTCAAT / // / / // / / / / / / BsrI |AccI | CviJI || | | | | | BstXI Hpy166II | AluI || | | | | BseYI Cac8I || | | | | CviJI SetI || | | | GsaI || | | MaeII || | TaiI || | SetI || DrdI |Hpy166II |HindII BslFI R P V Y L G L P A N L V D L N V P A K L D Q S T W V C Q L T W L T * T S Q P S Y T S L L G F A S * L G * L E R P S Q V I ----:----|----:----|----:----|----:----|----:----|----:----| L G T * K P K G A L K T S K F T G A L N F V L R S P N A L * S P Q S S R G L W T S W D V Q T Q W S V Q N V Q V D W G L * Hpy99I | AluI | HgaI | CviJI | | SetI | | | AluI MfeI | | | CviJI TspEI CviJI | | | | SetI \ \ \ \ \ \ \ TTGGAAACTCCAATTGACTTGTCTTTGAAGCCAAACGACGCTGAAGCTGAAGCTGAAGTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTTTGAGGTTAACTGAACAGAAACTTCGGTTTGCTGCGACTTCGACTTCGACTTCAA / / / / / /// / TspEI | Hpy99I | | ||CviJI Eco57MI MfeI CviJI | | ||AluI Eco57I | | |HgaI | | SetI | CviJI | AluI SetI L E T P I D L S L K P N D A E A E A E V W K L Q L T C L * S Q T T L K L K L K L G N S N * L V F E A K R R * S * S * S C ----:----|----:----|----:----|----:----|----:----|----:----| N S V G I S K D K F G F S A S A S A S T I P F E L Q S T K S A L R R Q L Q L Q L Q F S W N V Q R Q L W V V S F S F S F N Eco57I Eco57MI | Eco57I | Eco57MI | |Tsp4CI* | || Eco57I | || Eco57MI | || | TspEI | || | | SfaNI | || | | | MboI | || | | | BclI DdeI | || | | | | DpnI |BseGI BsrI | || | | | | |BstKTI ||BfiI FokI SfaNI CviJI \ \\ \ \ \ \ \\ \\\ \ \ \ GTTAGAACTGTTGTTGAATTGATCAAGGATGCTAAGAACCCAGTTATCTTGGCTGATGCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CAATCTTGACAACAACTTAACTAGTTCCTACGATTCTTGGGTCAATAGAACCGACTACGA / / / /// / / / / / / / / / | | Eco57MI ||| BclI | | | BsrI FokI | | Hin4I | | Eco57I ||| MboI | | DdeI | | Hin4I | Tsp4CI* ||SfaNI | BfiI | CviJI Eco57MI ||DpnI BseGI SfaNI Eco57I |BstKTI TspEI V R T V V E L I K D A K N P V I L A D A L E L L L N * S R M L R T Q L S W L M L * N C C * I D Q G C * E P S Y L G * C L ----:----|----:----|----:----|----:----|----:----|----:----| T L V T T S N I L S A L F G T I K A S A Q * F Q Q Q I S * P H * S G L * R P Q H N S S N N F Q D L I S L V W N D Q S I S Hin4I Hin4I | XbaI | |MaeI | |Hpy178III* | || FatI DdeI | || |CviAII | Hin4I HinfI | || || NlaIII | Hin4I MlyI | BfiI | || || Eam1105I CviJI | | BccI PleI | TspEI \ \\ \\ \ \ \ \ \ \ \ \ TGTGCTTCTAGACATGATGTCAAGGCTGAAACTAAGAAGTTGATGGACTTGACTCAATTC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| ACACGAAGATCTGTACTACAGTTCCGACTTTGATTCTTCAACTACCTGAACTGAGTTAAG /// // / / / / // / / ||| |FatI | Hin4I | BccI |PleI | TspEI ||| Eam1105I | Hin4I DdeI MlyI | BsrI ||| CviAII CviJI HinfI ||NlaIII BfiI |XbaI Hpy178III* MaeI C A S R H D V K A E T K K L M D L T Q F V L L D M M S R L K L R S * W T * L N S C F * T * C Q G * N * E V D G L D S I P ----:----|----:----|----:----|----:----|----:----|----:----| Q A E L C S T L A S V L F N I S K V * N K H K * V H H * P Q F * S T S P S S E I T S R S M I D L S F S L L Q H V Q S L E BsrI | HphI | | Hpy166II | | | MaeII | | | |MaeIII | | | |Tsp45I BsiYI* | | | || SetI | BaeI | | | || TaiI MslI BaeI | |Tsp4CI* \ \ \ \\ \ \ \ \ \\ CCAGTTTACGTCACCCCAATGGGTAAGGGTGCTATTGACGAACAACACCCAAGATACGGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCAAATGCAGTGGGGTTACCCATTCCCACGATAACTGCTTGTTGTGGGTTCTATGCCA / // / / / / / / / | || | | MslI BaeI | | TaqII | || | Tsp45I | Tsp4CI* | || | MaeIII BsiYI* | || MaeII BaeI | |TaiI | |SetI | Hpy166II HphI P V Y V T P M G K G A I D E Q H P R Y G Q F T S P Q W V R V L L T N N T Q D T V S L R H P N G * G C Y * R T T P K I R W ----:----|----:----|----:----|----:----|----:----|----:----| G T * T V G I P L P A I S S C C G L Y P G L K R * G L P Y P H * Q R V V G L I R W N V D G W H T L T S N V F L V W S V T TaqII | Hpy166II | | MaeII | | | SetI | | | TaiI | | | | Acc65I | | | | HgiCI* | | | | |Csp6I | | | | ||RsaI | | | | ||NlaIV | | | | ||| KpnI | | | | ||| |BaeI | | | | ||| ||SetI | | | | ||| ||| XbaI | | | | ||| ||| |MaeI | | | | ||| ||| |Hpy178III* | | | | ||| ||| || EcoP15I CviJI | | | | ||| ||| || | BaeI |SfeI* | | | | ||| ||| || | | Hin4II* || TfiI | | | | ||| ||| || | | | MseI || HinfI \ \ \ \ \\\ \\\ \\ \ \ \ \ \\ \ GGTGTTTACGTTGGTACCTTGTCTAGACCAGAAGTTAAGAAGGCTGTAGAATCTGCTGAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAAATGCAACCATGGAACAGATCTGGTCTTCAATTCTTCCGACATCTTAGACGACTA // / / /// /// / / / / / || | | ||HgiCI* ||| | MseI | | HinfI || | | ||Acc65I ||| Hin4II* | | TfiI || | | |Csp6I ||EcoP15I | SfeI* || | | NlaIV |XbaI CviJI || | | RsaI Hpy178III* || | | SetI BaeI || | BaeI MaeI || | KpnI || MaeII |TaiI |SetI Hpy166II G V Y V G T L S R P E V K K A V E S A D V F T L V P C L D Q K L R R L * N L L I C L R W Y L V * T R S * E G C R I C * F ----:----|----:----|----:----|----:----|----:----|----:----| P T * T P V K D L G S T L F A T S D A S H H K R Q Y R T * V L L * S P Q L I Q Q T N V N T G Q R S W F N L L S Y F R S I AgeI BetI* Cfr10I Hpy188I |HpaII \ \\ TTGATATTGTCTATCGGTGCTTTGTTGTCTGATTTCAATACCGGTTCTTTCTCTTACTCC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AACTATAACAGATAGCCACGAAACAACAGACTAAAGTTATGGCCAAGAAAGAGAATGAGG / // Hpy188I |Cfr10I |BetI* |AgeI HpaII L I L S I G A L L S D F N T G S F S Y S * Y C L S V L C C L I S I P V L S L T P D I V Y R C F V V * F Q Y R F F L L L L ----:----|----:----|----:----|----:----|----:----|----:----| K I N D I P A K N D S K L V P E K E * E N S I T * R H K T T Q N * Y R N K R K S Q Y Q R D T S Q Q R I E I G T R E R V G Hpy178III* | MboI ApoI | | DpnI TspEI | | |BstKTI EcoRI Hpy188I | | || Hpy188I \ \ \ \ \\ \ TACAAGACCAAAAATATCGTTGAATTCCACTCTGACCACATCAAGATCAGAAACGCCACC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTCTGGTTTTTATAGCAACTTAAGGTGAGACTGGTGTAGTTCTAGTCTTTGCGGTGG / / /// / / EcoRI Hpy188I ||| Hpy188I SetI TspEI ||| MboI ApoI ||DpnI |BstKTI Hpy178III* Y K T K N I V E F H S D H I K I R N A T T R P K I S L N S T L T T S R S E T P P Q D Q K Y R * I P L * P H Q D Q K R H L ----:----|----:----|----:----|----:----|----:----|----:----| * L V L F I T S N W E S W M L I L F A V R C S W F Y R Q I G S Q G C * S * F R W V L G F I D N F E V R V V D L D S V G G SetI | BssKI | SecI* | EcoRII | | ScrFI CviRI* | | BseBI ApoI |TspDTI BseGI | | | SetI TspEI || SfaNI | Hpy178III* | | | Hin4II* |MmeI || |TspEI | | FokI \ \ \ \ \\ \\ \\ \ \ \ TTCCCAGGTGTTCAAATGAAATTTGCCTTGCAAAAATTGTTGGATGCTATTCCAGAAGTC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGGTCCACAAGTTTACTTTAAACGGAACGTTTTTAACAACCTACGATAAGGTCTTCAG //// / / // // / / / |||Hin4II* MmeI TspEI |CviRI* |TspEI BseGI | FokI |||EcoRII ApoI TspDTI SfaNI Hpy178III* |||BssKI ||SecI* |BseBI |ScrFI SetI F P G V Q M K F A L Q K L L D A I P E V S Q V F K * N L P C K N C W M L F Q K S P R C S N E I C L A K I V G C Y S R S R ----:----|----:----|----:----|----:----|----:----|----:----| K G P T * I F N A K C F N N S A I G S T R G L H E F S I Q R A F I T P H * E L L E W T N L H F K G Q L F Q Q I S N W F D BseYI |MwoI || AluI || GsaI || CviJI GsuI || |MaeI TspEI AccI BslFI SetI || ||SetI Eco57MI |Hpy166II \ \ \\ \\\ \ \\ GTCAAGGACTACAAACCTGTTGCTGTCCCAGCTAGAGTTCCAATTACCAAGTCTACTCCA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTCCTGATGTTTGGACAACGACAGGGTCGATCTCAAGGTTAATGGTTCAGATGAGGT / / / / / / / / // / BslFI | | | | MaeI | TspEI |AccI SetI SetI | | | BseYI Eco57MI Hpy166II | | | CviJI GsuI | | | AluI | | SetI | GsaI MwoI V K D Y K P V A V P A R V P I T K S T P S R T T N L L L S Q L E F Q L P S L L Q Q G L Q T C C C P S * S S N Y Q V Y S S ----:----|----:----|----:----|----:----|----:----|----:----| T L S * L G T A T G A L T G I V L D V G R * P S C V Q Q Q G L * L E L * W T * E D L V V F R N S D W S S N W N G L R S W TspDTI | BseGI AluI | | NlaIV SmlI CviJI | | | FokI Hpy178III* | SetI MslI | | | | MaeIII |Hin4II* \ \ \ \ \ \ \ \ \\ GCTAACACTCCAATGAAGCAAGAATGGATGTGGAACCATTTGGGTAACTTCTTGAGAGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTGTGAGGTTACTTCGTTCTTACCTACACCTTGGTAAACCCATTGAAGAACTCTCTT / / / / / / / / / / / CviJI MslI | | NlaIV FokI | | | | SetI AluI | BseGI | | | SmlI TspDTI | | Hpy178III* | Hin4II* MaeIII A N T P M K Q E W M W N H L G N F L R E L T L Q * S K N G C G T I W V T S * E K * H S N E A R M D V E P F G * L L E R R ----:----|----:----|----:----|----:----|----:----|----:----| A L V G I F C S H I H F W K P L K K L S L * C E L S A L I S T S G N P Y S R S L S V S W H L L F P H P V M Q T V E Q S F EciI |AgeI |BetI* |Cfr10I ||HpaII Bce83I* ||| Csp6I MseI SetI |HphI ||| |RsaI AciI |Hin4II* \ \\ \\\ \\ \ \\ GGTGATATTGTTATTGCTGAAACCGGTACTTCCGCCTTCGGTATTAACCAAACTACTTTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTATAACAATAACGACTTTGGCCATGAAGGCGGAAGCCATAATTGGTTTGATGAAAG / / / //// / / / / | HphI EciI |||Csp6I AciI | MseI TsoI Bce83I* ||RsaI Hin4II* |Cfr10I |BetI* |AgeI HpaII G D I V I A E T G T S A F G I N Q T T F V I L L L L K P V L P P S V L T K L L S * Y C Y C * N R Y F R L R Y * P N Y F P ----:----|----:----|----:----|----:----|----:----|----:----| P S I T I A S V P V E A K P I L W V V K L H Y Q * Q Q F R Y K R R R Y * G F * K T I N N N S F G T S G G E T N V L S S E AccI Tsp4CI* |BssNAI | TaqII |Hpy166II | |Hin6I TsoI ||CspCI NlaIV CspCI | ||GlaI \ \\\ \ \ \ \\\ CCAACAGATGTATACGCTATCGTCCAAGTCTTGTGGGGTTCCATTGGTTTCACAGTCGGC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTGTCTACATATGCGATAGCAGGTTCAGAACACCCCAAGGTAACCAAAGTGTCAGCCG /// / / / / /// ||AccI NlaIV CspCI | | ||GlaI |Hpy166II | | |HhaI |BssNAI | | HaeII CspCI | TaqII Tsp4CI* P T D V Y A I V Q V L W G S I G F T V G Q Q M Y T L S S K S C G V P L V S Q S A N R C I R Y R P S L V G F H W F H S R R ----:----|----:----|----:----|----:----|----:----|----:----| G V S T Y A I T W T K H P E M P K V T P G L L H I R * R G L R T P N W Q N * L R W C I Y V S D D L D Q P T G N T E C D A MwoI |CfrI || CviJI || HaeIII || |AciI || |BisI || ||BlsI || |||TauI || |||NspBII* || |||| BinI* || |||| | MboI || |||| | | DpnI || |||| | | |BstKTI || |||| | | ||MboII || |||| | | ||Ksp632I* || |||| | | ||| Eco57I || |||| | | ||| Eco57MI HhaI || |||| | | ||| | TspDTI |HaeII || |||| | | ||| | | MboII \\ \\ \\\\ \ \ \\\ \ \ \ GCTCTATTGGGTGCTACTATGGCCGCTGAAGAACTTGATCCAAAGAAGAGAGTTATTTTA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGATAACCCACGATGATACCGGCGACTTCTTGAACTAGGTTTCTTCTCTCAATAAAAT / / //// / //// / / / / Hin6I MwoI |||| | |||| | | TspDTI MboII |||| | |||| | Eco57MI |||| | |||| | Eco57I |||| | |||| Ksp632I* |||| | |||MboI |||| | ||MboII |||| | |DpnI |||| | BstKTI |||| BinI* |||NspBII* |||AciI ||CfrI ||BisI |BlsI HaeIII CviJI TauI A L L G A T M A A E E L D P K K R V I L L Y W V L L W P L K N L I Q R R E L F Y S I G C Y Y G R * R T * S K E E S Y F I ----:----|----:----|----:----|----:----|----:----|----:----| A R N P A V I A A S S S S G F F L T I K R E I P H * * P R Q L V Q D L S S L * K S * Q T S S H G S F F K I W L L S N N * MaeIII Tsp45I | Tsp4CI* FatI | | HphI |CviAII | | | MfeI Tsp4CI* || BccI | | | TspEI | Hpy178III* || |NlaIII \ \ \ \ \ \ \\ \\ TTCATTGGTGACGGTTCTCTACAATTGACTGTTCAAGAAATCTCTACCATGATTAGATGG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAACCACTGCCAAGAGATGTTAACTGACAAGTTCTTTAGAGATGGTACTAATCTACC / / / / / / // | HphI | | Hpy178III* | |FatI Tsp4CI* | Tsp4CI* | |BccI Tsp45I TspEI | CviAII MaeIII MfeI NlaIII F I G D G S L Q L T V Q E I S T M I R W S L V T V L Y N * L F K K S L P * L D G H W * R F S T I D C S R N L Y H D * M G ----:----|----:----|----:----|----:----|----:----|----:----| N M P S P E R C N V T * S I E V M I L H I * Q H R N E V I S Q E L F R * W S * I E N T V T R * L Q S N L F D R G H N S P Hin4I Hin4I | TspEI MaeIII | | TfiI CviJI Hpy178III* Tsp4CI* | | HinfI \ \ \ \ \ \ GGTTTGAAGCCATACATTTTTGTCTTGAATAACAACGGTTACACCATTGAAAAATTGATT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAACTTCGGTATGTAAAAACAGAACTTATTGTTGCCAATGTGGTAACTTTTTAACTAA / / / // / / CviJI | | |Hin4I | HinfI | | |Hin4I | TfiI | | MaeIII TspEI | Tsp4CI* Hpy178III* G L K P Y I F V L N N N G Y T I E K L I V * S H T F L S * I T T V T P L K N * F F E A I H F C L E * Q R L H H * K I D S ----:----|----:----|----:----|----:----|----:----|----:----| P K F G Y M K T K F L L P * V M S F N I P N S A M C K Q R S Y C R N C W Q F I S T Q L W V N K D Q I V V T V G N F F Q N AsuI* AvaII Tsp4CI* |BmgT120I || FatI SetI || |CviAII | TspDTI || || NlaIII | |AsuI* || || | MnlI | |AvaII CviJI || || | | Hin4I ApoI | ||NlaIV HaeIII || || | | Hin4I TspEI | ||BmgT120I | BslFI \\ \\ \ \ \ \ \ \\\ \ \ CACGGTCCTCATGCCGAATATAATGAAATTCAAGGTTGGGACCACTTGGCCTTATTGCCA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCCAGGAGTACGGCTTATATTACTTTAAGTTCCAACCCTGGTGAACCGGAATAACGGT / // / // // / / / /// / / | || | || |MnlI | | | ||AvaII HaeIII BslFI | || | || Hin4I | | | ||AsuI* CviJI | || | || Hin4I | | | |BmgT120I | || | |FatI | | | NlaIV | || | CviAII | | TspDTI | || NlaIII | SetI | |AvaII TspEI | |AsuI* ApoI | BmgT120I Tsp4CI* H G P H A E Y N E I Q G W D H L A L L P T V L M P N I M K F K V G T T W P Y C Q R S S C R I * * N S R L G P L G L I A N ----:----|----:----|----:----|----:----|----:----|----:----| * P G * A S Y L S I * P Q S W K A K N G E R D E H R I Y H F E L N P G S P R I A V T R M G F I I F N L T P V V Q G * Q W BsrI TspRI | Bce83I* | | MlyI PflMI | | PleI BsiYI* MaeI | | |HphI \ \ \ \ \\ ACTTTTGGTGCTAGAAACTACGAAACCCACAGAGTTGCTACCACTGGTGAATGGGAAAAG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAAACCACGATCTTTGATGCTTTGGGTGTCTCAACGATGGTGACCACTTACCCTTTTC / / / / / // BsiYI* MaeI TspRI | Bce83I* |PleI PflMI BsrI HphI MlyI T F G A R N Y E T H R V A T T G E W E K L L V L E T T K P T E L L P L V N G K S F W C * K L R N P Q S C Y H W * M G K V ----:----|----:----|----:----|----:----|----:----|----:----| V K P A L F * S V W L T A V V P S H S F L K Q H * F S R F G C L Q * W Q H I P F S K T S S V V F G V S N S G S T F P F L HindII Hpy166II |HinfI || SmlI || | Hpy178III* DdeI SfaNI \\ \ \ \ \ TTGACTCAAGACAAGGACTTCCAAGACAACTCTAAGATTAGAATGATTGAAGTTATGTTG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGAGTTCTGTTCCTGAAGGTTCTGTTGAGATTCTAATCTTACTAACTTCAATACAAC / / / / / | | Hpy178III* DdeI BsrI | | SmlI | HinfI Hpy166II HindII L T Q D K D F Q D N S K I R M I E V M L * L K T R T S K T T L R L E * L K L C C D S R Q G L P R Q L * D * N D * S Y V A ----:----|----:----|----:----|----:----|----:----|----:----| N V * S L S K W S L E L I L I I S T I N T S E L C P S G L C S * S * F S Q L * T Q S L V L V E L V V R L N S H N F N H Q AluI CviJI | SetI AciI | |MfeI BisI BsrI | |TspEI |BlsI | CspCI TsoI MseI | |CspCI ||TauI MwoI \ \ \ \ \ \\ \\\ \ CCAGTCTTTGATGCTCCACAAAACTTGGTTAAACAAGCTCAATTGACTGCCGCTACTAAC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCAGAAACTACGAGGTGTTTTGAACCAATTTGTTCGAGTTAACTGACGGCGATGATTG // / / / // / //// / |SfaNI TsoI | | |CspCI | |||| MwoI CspCI | | CviJI | |||AciI | | AluI | ||BisI | SetI | |BlsI MseI | TauI TspEI MfeI P V F D A P Q N L V K Q A Q L T A A T N Q S L M L H K T W L N K L N * L P L L T S L * C S T K L G * T S S I D C R Y * R ----:----|----:----|----:----|----:----|----:----|----:----| G T K S A G C F K T L C A * N V A A V L A L R Q H E V F S P * V L E I S Q R * * W D K I S W L V Q N F L S L Q S G S S V GCTAAACAATAA 1690 ----:----|-- CGATTTGTTATT A K Q * L N N X * T I X ----:----|-- A L C Y R * V I S F L L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 3 FblI,XmiI AciI 3 BspACI,SsiI AflIII 1 AgeI 2 AsiGI,BshTI,CspAI,PinAI AluI 9 AluBI ApoI 3 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 4 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 6 Bce83I* 3 BpuEI BclI 2 FbaI,Ksp22I BdaI 2 BetI* 2 BsaWI BfiI 2 BmrI,BmuI BinI* 1 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmgT120I 2 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseYI 2 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BspLU11I* 1 PscI,PciI BsrI 5 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 4 BstXI 1 BtsI 1 Cac8I 1 BstC8I Cfr10I 3 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 2 CviQI,RsaNI CspCI 2 CviAII 5 CviJI 19 CviKI-1 CviRI* 3 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 4 MalI DrdI 1 AasI,DseDI Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 1 Eco57I 4 AcuI Eco57MI 6 EcoP15I 2 EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 5 FokI 4 GlaI 1 GsaI 2 GsuI 2 BpmI HaeII 1 BstH2I HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 5 HpyAV Hin6I 1 HinP1I,HspAI HindII 3 HincII HindIII 1 HinfI 4 HpaII 3 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 6 Hpy99I 1 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 10 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MfeI 4 MunI MlyI 2 SchI MmeI 1 MnlI 1 MseI 4 Tru1I,Tru9I MslI 4 RseI,SmiMI MwoI 6 HpyF10VI,BstMWI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 2 PpsI PsrI 1 PvuII 1 RsaI 2 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 2 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 26 SfaNI 5 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 3 SmoI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqII 2 TauI 2 TfiI 2 PfeI TseI 2 ApeKI TsoI 3 Tsp45I 4 NmuCI Tsp4CI* 11 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 15 TasI,Tsp509I,Sse9I TspRI 4 TscAI XbaI 2 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AcyI AflII AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvaI AvrII BalI BamHI BarI BbvCI BceAI BcgI BciVI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseMII BsePI BseRI BseSI BsgI BsiI* BsmI Bsp120I Bsp1407I BspCNI BspHI BspMI BspMII* BspOI BsrBI BsrDI BstAPI BstEII BtgZI BtrI CauII* Cfr9I ClaI DinI DraII DraIII DsaI* Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I FalI FauI FnuDII* FseI FspAI HgiAI* HgiJII* HpaI KasI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PstI PvuI RsrII SacI SacII SalI SanDI SapI ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqI TatI TspGWI TspMI TstI Tth111I VspI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769