Restriction Map of ACE2/YLR131C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

ACE2/YLR131C on chromosome XII from coordinates 406822 to 404510.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 BcgI DdeI | AclI SauI* | MaeII | CviJI | TspGWI | Bce83I* | | BinI* | | MnlI | | |SetI | | Hpy178III* | | |TaiI | | |NruI | | || MboI | | |FnuDII* | | || XhoII | | || BspCNI | | || | DpnI | | || |BseMII | | || | |BstKTI | | || || SmlI | | || | ||SecI* | | || || |MnlI | | || | ||DsaI* | | || || ||Hpy178III* \ \ \\ \ \\\ \ \ \\ \\ \\\ ATGGATAACGTTGTAGATCCGTGGTATATAAATCCCTCAGGCTTCGCGAAAGACACTCAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTATTGCAACATCTAGGCACCATATATTTAGGGAGTCCGAAGCGCTTTCTGTGAGTT / // // // / / / / / /// / / | || || || | DsaI* | | | ||BseMII | Hpy178III* | || || || | SecI* | | | || | SmlI | || || || XhoII | | | || MnlI | || || || MboI | | | |Hpy178III* | || || |DpnI | | | |BspCNI | || || BstKTI | | | FnuDII* | || |BinI* | | | NruI | || MaeII | | MnlI | || AclI | CviJI | |TaiI Bce83I* | |SetI SauI* | TspGWI DdeI BcgI M D N V V D P W Y I N P S G F A K D T Q W I T L * I R G I * I P Q A S R K T L K G * R C R S V V Y K S L R L R E R H S R ----:----|----:----|----:----|----:----|----:----|----:----| X S L T T S G H Y I F G E P K A F S V * X P Y R Q L D T T Y L D R L S R S L C E H I V N Y I R P I Y I G * A E R F V S L BseRI | FatI | BspHI | |CviAII | |Hpy178III* | || NlaIII | || |MslI TspEI \ \\ \\ \ GATGAGGAGTATGTTCAACATCATGATAATGTCAATCCTACCATACCCCCACCCGACAAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTCCTCATACAAGTTGTAGTACTATTACAGTTAGGATGGTATGGGGGTGGGCTGTTA / / /// | | ||MslI | | |BspHI | | |FatI | | Hpy178III* | | CviAII | NlaIII BseRI D E E Y V Q H H D N V N P T I P P P D N M R S M F N I M I M S I L P Y P H P T I * G V C S T S * * C Q S Y H T P T R Q L ----:----|----:----|----:----|----:----|----:----|----:----| S S S Y T * C * S L T L G V M G G G S L L H P T H E V D H Y H * D * W V G V R C I L L I N L M M I I D I R G Y G W G V I CviJI HaeIII TspDTI BccI | TaqI MnlI SetI \ \ \ \ \ TATATTTTGAATAATGAAAACGATGATGGCCTCGATAACTTGTTAGGTATGGACTACTAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATATAAAACTTATTACTTTTGCTACTACCGGAGCTATTGAACAATCCATACCTGATGATA / / / / / / / TspEI BccI | | TaqI MnlI SetI | HaeIII | CviJI TspDTI Y I L N N E N D D G L D N L L G M D Y Y I F * I M K T M M A S I T C * V W T T I Y F E * * K R * W P R * L V R Y G L L * ----:----|----:----|----:----|----:----|----:----|----:----| * I K F L S F S S P R S L K N P I S * * N Y K S Y H F R H H G R Y S T L Y P S S I N Q I I F V I I A E I V Q * T H V V I TaqI ClaI Bce83I* | MlyI | PleI | | SetI | | | HindII MboI | | | Hpy166II BglII | | | |HinfI XhoII | | | || SmlI | DpnI | | | || | Hpy178III* | |BstKTI | | | || | | MseI | ||Hpy178III* \ \ \ \\ \ \ \ \ \\\ AACATCGATGACCTGTTGACTCAAGAGTTAAGAGATCTGGATATTCCTTTAGTGCCTTCT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTAGCTACTGGACAACTGAGTTCTCAATTCTCTAGACCTATAAGGAAATCACGGAAGA / / / // / / / / // / / | | | || | | | | || | Hpy178III* | | | || | | | | || XhoII | | | || | | | | || BglII | | | || | | | | || MboI | | | || | | | | |DpnI | | | || | | | | BstKTI | | | || | | | MseI | | | || | | Hpy178III* | | | || | | SmlI | | | || | HinfI | | | || Hpy166II | | | || HindII | | | |PleI | | | MlyI | | SetI | ClaI | TaqI Bce83I* N I D D L L T Q E L R D L D I P L V P S T S M T C * L K S * E I W I F L * C L L H R * P V D S R V K R S G Y S F S A F S ----:----|----:----|----:----|----:----|----:----|----:----| L M S S R N V * S N L S R S I G K T G E Y C R H G T S E L T L L D P Y E K L A K V D I V Q Q S L L * S I Q I N R * H R R DdeI | Hin4II* NlaIV | | BccI | StyI | | BsiYI* Hpy188I | SecI* | | | MboII | BtgZI SspI TstI | | SetI \ \ \ \ \ \ \ \ \ \ \ CCTAAGACGGGCGATGGTTCTTCTGATAAAAAGAATATTGATAGAACTTGGAACCTTGGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GGATTCTGCCCGCTACCAAGAAGACTATTTTTCTTATAACTATCTTGAACCTTGGAACCA // / / / / // / / || | MboII | BtgZI |TstI NlaIV SecI* || BccI Hpy188I SspI SetI BsaXI |DdeI StyI Hin4II* BsiYI* P K T G D G S S D K K N I D R T W N L G L R R A M V L L I K R I L I E L G T L V * D G R W F F * * K E Y * * N L E P W * ----:----|----:----|----:----|----:----|----:----|----:----| G L V P S P E E S L F F I S L V Q F R P E * S P R H N K Q Y F S Y Q Y F K S G Q R L R A I T R R I F L I N I S S P V K T HphI | TstI | | TspDTI | | | BsmAI BsaXI | | | | SfeI* BsaXI MnlI MnlI SetI \ \ \ \ \ \ \ \ \ \ GATGAAAACAACAAAGTCTCCCACTATAGCAAAAAATCAATGTCCTCACACAAGAGAGGT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTTTGTTGTTTCAGAGGGTGATATCGTTTTTTAGTTACAGGAGTGTGTTCTCTCCA / / / / / / / HphI TspDTI | BsaXI MnlI | SetI TstI | SfeI* MnlI BsmAI D E N N K V S H Y S K K S M S S H K R G M K T T K S P T I A K N Q C P H T R E V * K Q Q S L P L * Q K I N V L T Q E R S ----:----|----:----|----:----|----:----|----:----|----:----| S S F L L T E W * L L F D I D E C L L P H H F C C L R G S Y C F I L T R V C S L I F V V F D G V I A F F * H G * V L S T CfrI | CviJI DdeI NmeAIII | HaeIII BsrI \ \ \ \ \ CTAAGTGGCACAGCGATATTTGGATTTCTCGGCCATAATAAGACATTGAGTATTTCCAGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GATTCACCGTGTCGCTATAAACCTAAAGAGCCGGTATTATTCTGTAACTCATAAAGGTCA / / / / / | NmeAIII | CfrI BsrI DdeI HaeIII CviJI L S G T A I F G F L G H N K T L S I S S * V A Q R Y L D F S A I I R H * V F P V K W H S D I W I S R P * * D I E Y F Q F ----:----|----:----|----:----|----:----|----:----|----:----| R L P V A I N P N R P W L L V N L I E L D L H C L S I Q I E R G Y Y S M S Y K W * T A C R Y K S K E A M I L C Q T N G T FatI BinI* NcoI | MboI StyI | XhoII SecI* | | DpnI DsaI* | | |BstKTI |CviAII Hpy166II | | ||AciI || NlaIII TspEI \ \ \ \\\ \\ \ \ TTACAGCAATCCATTCTAAATATGTCTAAAGATCCGCAACCCATGGAACTCATAAATGAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTCGTTAGGTAAGATTTATACAGATTTCTAGGCGTTGGGTACCTTGAGTATTTACTT / / // / / / // Hpy166II | || | AciI | |DsaI* | || XhoII | |SecI* | || MboI | |StyI | |DpnI | |NcoI | BstKTI | |FatI BinI* | CviAII NlaIII L Q Q S I L N M S K D P Q P M E L I N E Y S N P F * I C L K I R N P W N S * M N T A I H S K Y V * R S A T H G T H K * I ----:----|----:----|----:----|----:----|----:----|----:----| K C C D M R F I D L S G C G M S S M F S N V A I W E L Y T * L D A V W P V * L H * L L G N * I H R F I R L G H F E Y I F BsiYI* TspDTI Tsp4CI* | BccI \ \ \ \ TTGGGTAATCATAATACGGTAAAAAATAACAATGATGACTTTGACCATATAAGGGAAAAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCATTAGTATTATGCCATTTTTTATTGTTACTACTGAAACTGGTATATTCCCTTTTA / / / / / TspEI TspDTI Tsp4CI* BsiYI* BccI L G N H N T V K N N N D D F D H I R E N W V I I I R * K I T M M T L T I * G K M G * S * Y G K K * Q * * L * P Y K G K * ----:----|----:----|----:----|----:----|----:----|----:----| N P L * L V T F F L L S S K S W I L S F I P Y D Y Y P L F Y C H H S Q G Y L P F Q T I M I R Y F I V I I V K V M Y P F I AluI CviJI | SetI | HphI | | MwoI MseI | | | CviJI MnlI | TspEI \ \ \ \ \ \ \ GATGGTGAAAATAGCTATTTGAGCCAAGTTTTGTTGAAACAGCAGGAGGAGTTAAGAATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCACTTTTATCGATAAACTCGGTTCAAAACAACTTTGTCGTCCTCCTCAATTCTTAA / // / / / / // | || MwoI CviJI MnlI MseI |TspEI | |HphI BseRI | CviJI | AluI SetI D G E N S Y L S Q V L L K Q Q E E L R I M V K I A I * A K F C * N S R R S * E L W * K * L F E P S F V E T A G G V K N C ----:----|----:----|----:----|----:----|----:----|----:----| S P S F L * K L W T K N F C C S S N L I H H H F Y S N S G L K T S V A P P T L F I T F I A I Q A L N Q Q F L L L L * S N BseRI | Hpy178III* Hpy166II Hin4I | | EcoP15I | BsaXI | BsmAI | | | AjuI | | TspEI | | AjuI BsaXI \ \ \ \ \ \ \ \ \ \ \ GCTCTTGAAAAACAAAAGGAAGTGAACGAAAAATTGGAGAAGCAGTTGAGAGACAATCAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGAACTTTTTGTTTTCCTTCACTTGCTTTTTAACCTCTTCGTCAACTCTCTGTTAGTT / // // // / / / | |EcoP15I |BsaXI |TspEI AjuI BsmAI BsaXI | AjuI Hpy166II Hin4I Hpy178III* A L E K Q K E V N E K L E K Q L R D N Q L L K N K R K * T K N W R S S * E T I K S * K T K G S E R K I G E A V E R Q S N ----:----|----:----|----:----|----:----|----:----|----:----| A R S F C F S T F S F N S F C N L S L * Q E Q F V F P L S R F I P S A T S L C D S K F F L L F H V F F Q L L L Q S V I L Ksp632I* | MboII | | SetI | | | Hin6I | | | |GlaI SapI | | | ||HhaI Hin4I Ksp632I* |MnlI | | |||MboII \ \ \\ \ \ \\\\ ATACAGCAAGAAAAGTTGCGTAAAGTATTAGAAGAGCAAGAAGAGGTGGCGCAGAAGTTG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TATGTCGTTCTTTTCAACGCATTTCATAATCTTCTCGTTCTTCTCCACCGCGTCTTCAAC / / / / // /// Hin4I | | | |SetI ||MboII | | | MboII ||Hin6I | | Ksp632I* |GlaI | MnlI HhaI Ksp632I* SapI I Q Q E K L R K V L E E Q E E V A Q K L Y S K K S C V K Y * K S K K R W R R S W T A R K V A * S I R R A R R G G A E V G ----:----|----:----|----:----|----:----|----:----|----:----| I C C S F N R L T N S S C S S T A C F N F V A L F T A Y L I L L A L L P P A S T Y L L F L Q T F Y * F L L F L H R L L Q TspEI | GsuI | Eco57MI | | BssKI | | EcoRII | | | ScrFI | | | BseBI | | | |SetI | | | ||MboI | | | ||XhoII | | | ||| DpnI CviJI | | | ||| |BstKTI | ApoI | | | ||| || BsrI | TspEI | | | ||| || | BinI* SetI \ \ \ \ \ \\\ \\ \ \ \ GTTTCTGGGGCTACAAATTCTAATTCCAAACCTGGATCTCCAGTAATACTAAAGACACCT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGACCCCGATGTTTAAGATTAAGGTTTGGACCTAGAGGTCATTATGATTTCTGTGGA / / / / / / // / / / CviJI | | | | | || | BinI* SetI | | | | | || XhoII | | | | | || MboI | | | | | || BsrI | | | | | |DpnI | | | | | EcoRII | | | | | BstKTI | | | | | BssKI | | | | BseBI | | | | ScrFI | | | SetI | | TspEI | Eco57MI | GsuI TspEI ApoI V S G A T N S N S K P G S P V I L K T P F L G L Q I L I P N L D L Q * Y * R H L F W G Y K F * F Q T W I S S N T K D T C ----:----|----:----|----:----|----:----|----:----|----:----| T E P A V F E L E L G P D G T I S F V G P K Q P * L N * N W V Q I E L L V L S V N R P S C I R I G F R S R W Y Y * L C R FatI |CviAII || AarI || BspMI TspDTI || CviRI* | MaeIII || NlaIII Tsp4CI* | Tsp45I CviRI* \\ \ \ \ \ \ GCCATGCAAAACGGTAGAATGAAAGATAATGCTATAATCGTCACAACGAACTCTGCAAAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTACGTTTTGCCATCTTACTTTCTATTACGATATTAGCAGTGTTGCTTGAGACGTTTA / // / / / / / | || | Tsp4CI* TspDTI Tsp45I CviRI* | || BspMI MaeIII | || AarI | |CviRI* | |FatI | CviAII NlaIII A M Q N G R M K D N A I I V T T N S A N P C K T V E * K I M L * S S Q R T L Q M H A K R * N E R * C Y N R H N E L C K W ----:----|----:----|----:----|----:----|----:----|----:----| A M C F P L I F S L A I I T V V F E A F Q W A F R Y F S L Y H * L R * L S S Q L G H L V T S H F I I S Y D D C R V R C I Hpy188I | MaeII | |MnlI | ||Hpy99I SecI* | |||MseI | Hpy188I EcoRV | |||SetI | | MmeI FokI |BseRI | |||TaiI | | |MnlI | FokI AciI || TspEI EciI | ||||MnlI | | |BseGI | | HphI \ \\ \ \ \ \\\\\ \ \ \\ \ \ \ GGCGGATATCAATTTCCTCCTCCGACGTTAATATCGCCTCGGATGTCAAATACTTCAATA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCCTATAGTTAAAGGAGGAGGCTGCAATTATAGCGGAGCCTACAGTTTATGAAGTTAT / // // / // // / // /// / | |EcoRV |EciI | || || MseI || ||MnlI FokI | BseRI TspEI | || |MnlI || |BseGI HphI AciI | || MaeII || MmeI | |MnlI |SecI* | TaiI Hpy188I | SetI Hpy188I Hpy99I G G Y Q F P P P T L I S P R M S N T S I A D I N F L L R R * Y R L G C Q I L Q * R I S I S S S D V N I A S D V K Y F N K ----:----|----:----|----:----|----:----|----:----|----:----| P P Y * N G G G V N I D G R I D F V E I H R I D I E E E S T L I A E S T L Y K L A S I L K R R R R * Y R R P H * I S * Y Hpy166II | BseGI | | PfoI | | BssKI | | EcoRII | | | ScrFI | | | BseBI | | | | BccI EcoRV CviJI \ \ \ \ \ \ \ AATGGTTCACCATCCAGGAAATACCATAGGCAACGATATCCAAATAAAAGCCCAGAAAGT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCAAGTGGTAGGTCCTTTATGGTATCCGTTGCTATAGGTTTATTTTCGGGTCTTTCA / // / // / / / FokI |BseGI | |BccI EcoRV CviJI AloI Hpy166II | EcoRII | BssKI | PfoI BseBI ScrFI N G S P S R K Y H R Q R Y P N K S P E S M V H H P G N T I G N D I Q I K A Q K V W F T I Q E I P * A T I S K * K P R K * ----:----|----:----|----:----|----:----|----:----|----:----| F P E G D L F Y W L C R Y G F L L G S L L H N V M W S I G Y A V I D L Y F G L F I T * W G P F V M P L S I W I F A W F T Tsp4CI* TfiI | MnlI HinfI | | AloI | TspDTI AloI SetI TsoI | | TspRI | |Hpy188I \ \ \ \ \ \ \ \\ AATGGATTGAACCTTTTTTCCTCTAACAGTGGTTATTTGAGAGATTCTGAACTGCTTTCA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCTAACTTGGAAAAAAGGAGATTGTCACCAATAAACTCTCTAAGACTTGACGAAAGT / / / /// /// SetI TsoI | ||MnlI ||Hpy188I | |AloI |HinfI | Tsp4CI* |TfiI TspRI TspDTI N G L N L F S S N S G Y L R D S E L L S M D * T F F P L T V V I * E I L N C F H W I E P F F L * Q W L F E R F * T A F I ----:----|----:----|----:----|----:----|----:----|----:----| L P N F R K E E L L P * K L S E S S S E Y H I S G K K R * C H N N S L N Q V A K I S Q V K K G R V T T I Q S I R F Q K * TspEI | PsiI | |TspEI | || MseI PsiI | || |AhaIII* CviJI | BceAI \ \\ \\ \ \ \ TTTTCTCCACAAAATTATAATTTAAACTTGGACGGCTTGACTTATAATGACCATAATAAC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAGAGGTGTTTTAATATTAAATTTGAACCTGCCGAACTGAATATTACTGGTATTATTG // /// / / / / |PsiI ||MseI CviJI PsiI BceAI TspRI TspEI |AhaIII* BsrI TspEI F S P Q N Y N L N L D G L T Y N D H N N F L H K I I I * T W T A * L I M T I I T F S T K L * F K L G R L D L * * P * * H ----:----|----:----|----:----|----:----|----:----|----:----| N E G C F * L K F K S P K V * L S W L L M K E V F N Y N L S P R S S K Y H G Y Y K R W L I I I * V Q V A Q S I I V M I V TatI |Csp6I ||RsaI BsrI BsrI TspRI ||ScaI |TspGWI HphI \ \ \\\ \\ \ ACCAGTGATAAAAACAATAATGATAAAAAAAATAGTACTGGTGATAACATATTCCGTCTG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTCACTATTTTTGTTATTACTATTTTTTTTATCATGACCACTATTGTATAAGGCAGAC /// // / ||| |TspGWI HphI ||| BsrI ||TatI |Csp6I ScaI RsaI T S D K N N N D K K N S T G D N I F R L P V I K T I M I K K I V L V I T Y S V C Q * * K Q * * * K K * Y W * * H I P S V ----:----|----:----|----:----|----:----|----:----|----:----| V L S L F L L S L F F L V P S L M N R R C W H Y F C Y H Y F F Y Y Q H Y C I G D G T I F V I I I F F I T S T I V Y E T Q BssKI SecI* |AvaI |BssKI |SecI* |Cfr9I ||HpaII ||ScrFI ||CauII* ||BmeT110I |||SmaI |||ScrFI |||CauII* |||| BsiYI* TaqI |||| | CviJI StyI AsuII |||| | |DdeI SecI* \ \\\\ \ \\ \ TTCGAAAAGACTTCCCCGGGTGGGCTAAGTATCTCTCCAAGGATAAATGGAAATAGTTTG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTTTTCTGAAGGGGCCCACCCGATTCATAGAGAGGTTCCTATTTACCTTTATCAAAC / //// / / / AsuII |||| | DdeI SecI* TaqI |||| CviJI StyI |||BssKI ||Cfr9I ||BssKI ||SecI* ||AvaI |BmeT110I |CauII* |SecI* |HpaII |ScrFI BsiYI* CauII* ScrFI SmaI F E K T S P G G L S I S P R I N G N S L S K R L P R V G * V S L Q G * M E I V * R K D F P G W A K Y L S K D K W K * F E ----:----|----:----|----:----|----:----|----:----|----:----| N S F V E G P P S L I E G L I F P F L K T R F S K G P H A L Y R E L S L H F Y N E F L S G R T P * T D R W P Y I S I T Q BbvI | MboI TseI | | DpnI FokI Hin4II* | | |TaqI |BisI MboI |Hpy99I | | |ClaI ||BlsI | DpnI || MnlI | | |BseGI ||| Cac8I | |BstKTI || EcoP15I | | |BstKTI ||| | MaeII \ \\ \\ \ \ \ \\ \\\ \ \ AGATCGCCCTTCCTCGTCGGCACAGATAAAAGCAGGGATGATCGATATGCTGCTGGCACG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAGCGGGAAGGAGCAGCCGTGTCTATTTTCGTCCCTACTAGCTATACGACGACCGTGC // / / / / / // // ///// / / || MboI | | | EcoP15I || |ClaI ||||| | MaeII |DpnI | | MnlI || |TaqI ||||| TaiI BstKTI | Hin4II* || MboI ||||| SetI Hpy99I |DpnI ||||Cac8I BstKTI |||FokI BseGI ||TseI BbvI |BisI BlsI R S P F L V G T D K S R D D R Y A A G T D R P S S S A Q I K A G M I D M L L A R I A L P R R H R * K Q G * S I C C W H V ----:----|----:----|----:----|----:----|----:----|----:----| L D G K R T P V S L L L S S R Y A A P V S I A R G R R C L Y F C P H D I H Q Q C S R G E E D A C I F A P I I S I S S A R SetI HphI TaiI | Tsp4CI* SecI* |Hpy166II | | MaeIII TfiI DsaI* || MaeI | | Tsp45I SetI TspGWI HinfI | Tsp4CI* \\ \ \ \ \ \ \ \ \ \ TTCACGCCTAGAACACAGTTGTCACCTATCCACAAGAAAAGGGAATCCGTAGTTTCCACG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTGCGGATCTTGTGTCAACAGTGGATAGGTGTTCTTTTCCCTTAGGCATCAAAGGTGC / / / / / / / / // | | | | | Tsp45I TspGWI HinfI |DsaI* | | | | | MaeIII TfiI |SecI* | | | | SetI Tsp4CI* | | | Tsp4CI* | | HphI | MaeI Hpy166II F T P R T Q L S P I H K K R E S V V S T S R L E H S C H L S T R K G N P * F P R H A * N T V V T Y P Q E K G I R S F H G ----:----|----:----|----:----|----:----|----:----|----:----| N V G L V C N D G I W L F L S D T T E V T * A * F V T T V * G C S F P I R L K W E R R S C L Q * R D V L F P F G Y N G R TspRI |FokI ||BseGI ||| MslI ||| |FatI Hpy178III* SfeI* ||| ||CviAII |TaqI | CviRI* ||| |||BccI || BsmAI | | PstI ||| |||| NspI || Eco31I | | | FokI BseGI ||| |||| NlaIII \\ \ \ \ \ \ \ \\\ \\\\ \ GTCTCGACAATATCACAACTGCAGGATGACACTGAACCCATCCACATGCGAAATACCCAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAGCTGTTATAGTGTTGACGTCCTACTGTGACTTGGGTAGGTGTACGCTTTATGGGTC // / / / / /// / / // // || Eco31I | | | ||FokI | | || |FatI || BsmAI | | | |BseGI | | || CviAII |TaqI | | | TspRI | | || BccI Hpy178III* | | SfeI* | | |NlaIII | CviRI* | | |NspI PstI | | MslI | FokI BseGI V S T I S Q L Q D D T E P I H M R N T Q S R Q Y H N C R M T L N P S T C E I P R L D N I T T A G * H * T H P H A K Y P E ----:----|----:----|----:----|----:----|----:----|----:----| T E V I D C S C S S V S G M W M R F V W P R S L I V V A P H C Q V W G C A F Y G D R C Y * L Q L I V S F G D V H S I G L BssKI EcoRII TatI |BsiYI* |Csp6I ||MnlI CviRI* |Hpy166II ||ScrFI MseI |HgaI ||RsaI SetI ||BseBI \ \\ \\\ \ \\\ AACCCAACATTAAGAAATGCAAACGCTTTAGCGTCATCAAGTGTACTACCTCCTATTCCT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGGTTGTAATTCTTTACGTTTGCGAAATCGCAGTAGTTCACATGATGGAGGATAAGGA / / / ///// / / / MseI | HgaI ||||SetI | | BseBI CviRI* |||TatI | | ScrFI ||Csp6I | MnlI |RsaI BsiYI* Hpy166II N P T L R N A N A L A S S S V L P P I P T Q H * E M Q T L * R H Q V Y Y L L F L P N I K K C K R F S V I K C T T S Y S W ----:----|----:----|----:----|----:----|----:----|----:----| F G V N L F A F A K A D D L T S G G I G S G L M L F H L R K L T M L H V V E * E V W C * S I C V S * R * * T Y * R R N R AjuI |FatI TspEI |AflIII | MseI |BspLU11I* | | ApoI ||CviAII | | TspEI ||| NspI NlaIV AjuI | | EcoRI ||| NlaIII \ \ \ \ \ \\\ \ GGTTCCAGCAATAACACTCCAATTAAGAATTCTTTGCCACAAAAACATGTATTTCAACAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAGGTCGTTATTGTGAGGTTAATTCTTAAGAAACGGTGTTTTTGTACATAAAGTTGTA // / // / / / // || AjuI |MseI EcoRI AjuI | |BspLU11I* |NlaIV TspEI TspEI | |AflIII EcoRII ApoI | |FatI BssKI | CviAII NlaIII NspI G S S N N T P I K N S L P Q K H V F Q H V P A I T L Q L R I L C H K N M Y F N I F Q Q * H S N * E F F A T K T C I S T Y ----:----|----:----|----:----|----:----|----:----|----:----| P E L L L V G I L F E K G C F C T N * C Q N W C Y C E L * S N K A V F V H I E V T G A I V S W N L I R Q W L F M Y K L M BsiYI* | MaeIII | | MaeI | | |SetI | | || AluI | | || CviJI AluI | | || |TspGWI CviRI* CviJI | | || ||SetI | BetI* | SetI | | || |||AciI | |HpaII \ \ \ \ \\ \\\\ \ \\ ACTCCCGTCAAAGCTCCACCAAAGAACGGAAGTAACCTAGCTCCGCTTCTAAATGCACCG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGGGCAGTTTCGAGGTGGTTTCTTGCCTTCATTGGATCGAGGCGAAGATTTACGTGGC / / / / / /// / / / | CviJI BsiYI* | | ||| AciI | HpaII | AluI | | ||CviJI CviRI* SetI | | ||AluI | | |TspGWI | | |MaeI | | SetI | MaeIII SetI T P V K A P P K N G S N L A P L L N A P L P S K L H Q R T E V T * L R F * M H R S R Q S S T K E R K * P S S A S K C T G ----:----|----:----|----:----|----:----|----:----|----:----| V G T L A G G F F P L L R A G S R F A G Y E R * L E V L S R F Y G L E A E L H V S G D F S W W L V S T V * S R K * I C R TaqII |MaeIII |Tsp45I |Tsp4CI* MboI || AlwNI | DpnI TspEI || | Tsp4CI* MseI | |BstKTI | MseI || | | TspRI \ \ \\ \ \ \\ \ \ \ GATTTAACAGATCATCAGTTAGAAATTAAGACACCCATACGAAATAACAGTCACTGTGAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAATTGTCTAGTAGTCAATCTTTAATTCTGTGGGTATGCTTTATTGTCAGTGACACTT / / // / // / /// / | | || MboI |MseI | ||| Tsp4CI* | | |DpnI TspEI | ||| Tsp45I | | BstKTI | ||| MaeIII | MseI | ||AlwNI BetI* | |TspRI | Tsp4CI* TaqII D L T D H Q L E I K T P I R N N S H C E I * Q I I S * K L R H P Y E I T V T V K F N R S S V R N * D T H T K * Q S L * S ----:----|----:----|----:----|----:----|----:----|----:----| S K V S * * N S I L V G M R F L L * Q S P N L L D D T L F * S V W V F Y C D S H I * C I M L * F N L C G Y S I V T V T F SetI MaeIII Tsp45I | FatI AluI | |CviAII CviJI | || NlaIII | SetI Csp6I | || | FalI | | AciI |RsaI | || | FalI CviJI CviRI* \ \ \ \\ \ \\ \ \ \ \ GTGGAAAGCTATCCGCAAGTACCACCTGTCACACATGATATTCACAAAAGCCCCACTTTG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTTTCGATAGGCGTTCATGGTGGACAGTGTGTACTATAAGTGTTTTCGGGGTGAAAC / / / // / /// // / / | CviJI AciI || SetI ||| |FatI CviJI CviRI* | AluI |Csp6I ||| CviAII SetI RsaI ||FalI ||FalI |NlaIII Tsp45I MaeIII V E S Y P Q V P P V T H D I H K S P T L W K A I R K Y H L S H M I F T K A P L C G K L S A S T T C H T * Y S Q K P H F A ----:----|----:----|----:----|----:----|----:----|----:----| T S L * G C T G G T V C S I * L L G V K L P F S D A L V V Q * V H Y E C F G W K H F A I R L Y W R D C M I N V F A G S Q Csp6I |RsaI ||MaeII ||| SetI StyI ||| TaiI AvrII ||| |FalI SecI* ||| |FalI |MaeI ||| || BsmAI ||SetI ||| || Esp3I ||| TspDTI \\\ \\ \ \\\ \ CATAGTACGTCTCCTTTACCAGATGAAATAATACCTAGGACTACGCCAATGAAAATAACC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| GTATCATGCAGAGGAAATGGTCTACTTTATTATGGATCCTGATGCGGTTACTTTTATTGG // / / / /// / || MaeII Esp3I | ||SecI* BsaXI |Csp6I BsmAI | ||AvrII FalI | ||StyI FalI | |MaeI RsaI | TspDTI TaiI SetI SetI H S T S P L P D E I I P R T T P M K I T I V R L L Y Q M K * Y L G L R Q * K * P * Y V S F T R * N N T * D Y A N E N N Q ----:----|----:----|----:----|----:----|----:----|----:----| C L V D G K G S S I I G L V V G I F I V A Y Y T E K V L H F L V * S * A L S F L M T R R R * W I F Y Y R P S R W H F Y G BssKI |HpaII ||ScrFI ||CauII* ||| Acc65I ||| HgiCI* ||| |Csp6I ||| ||RsaI ||| ||NlaIV ||| ||| KpnI ||| ||| MnlI ||| ||| | BsaXI ||| ||| | | BsrI ||| ||| | | | Csp6I ||| ||| | | | |RsaI ||| ||| | | | |DrdI ||| ||| | | | ||MaeII BsaXI ||| ||| | | | ||| SetI |TspDTI TsoI ||| ||| | | | ||| TaiI \\ \ \\\ \\\ \ \ \ \\\ \ AAGAAACCAACTACTCTGCCTCCGGGTACCATTGACCAGTACGTCAAGGAACTACCCGAC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTGGTTGATGAGACGGAGGCCCATGGTAACTGGTCATGCAGTTCCTTGATGGGCTG / / /////// / / // / TspDTI TsoI ||||||| | | || MaeII ||||||| | | |Csp6I ||||||| | | RsaI ||||||| | | TaiI ||||||| | | SetI ||||||| | DrdI ||||||| BsrI ||||||BsaXI |||||HgiCI* |||||Acc65I ||||Csp6I ||||MnlI |||NlaIV |||RsaI ||BssKI |KpnI CauII* HpaII ScrFI K K P T T L P P G T I D Q Y V K E L P D R N Q L L C L R V P L T S T S R N Y P T E T N Y S A S G Y H * P V R Q G T T R Q ----:----|----:----|----:----|----:----|----:----|----:----| L F G V V R G G P V M S W Y T L S S G S W S V L * E A E P Y W Q G T R * P V V R L F W S S Q R R T G N V L V D L F * G V MaeIII TaqI Tsp4CI* \ \ AAACTATTCGAGTGCTTATACCCTAACTGTAACAAAGTATTCAAGCGTAGATACAACATA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGATAAGCTCACGAATATGGGATTGACATTGTTTCATAAGTTCGCATCTATGTTGTAT / / / / TaqI | MaeIII SetI Tsp4CI* K L F E C L Y P N C N K V F K R R Y N I N Y S S A Y T L T V T K Y S S V D T T * T I R V L I P * L * Q S I Q A * I Q H K ----:----|----:----|----:----|----:----|----:----|----:----| L S N S H K Y G L Q L L T N L R L Y L M C V I R T S I G * S Y C L I * A Y I C C F * E L A * V R V T V F Y E L T S V V Y CviRI* | TspDTI BssKI | | Tsp4CI* | HpaII | | | FatI | ScrFI | | | |CviAII | CauII* SetI Hpy188I | | | || NlaIII | | CviRI* \ \ \ \ \ \\ \ \ \ \ AGGTCGCATATTCAGACACATTTGCAAGATAGACCGTATTCATGCGACTTTCCCGGTTGC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TCCAGCGTATAAGTCTGTGTAAACGTTCTATCTGGCATAAGTACGCTGAAAGGGCCAACG / / / / / // /// / Hpy188I | TspDTI | | |FatI ||| CviRI* CviRI* | | CviAII ||BssKI | NlaIII |HpaII Tsp4CI* CauII* ScrFI R S H I Q T H L Q D R P Y S C D F P G C G R I F R H I C K I D R I H A T F P V A V A Y S D T F A R * T V F M R L S R L H ----:----|----:----|----:----|----:----|----:----|----:----| L D C I * V C K C S L G Y E H S K G P Q L T A Y E S V N A L Y V T N M R S E R N P R M N L C M Q L I S R I * A V K G T A FatI BspHI |CviAII |Hpy178III* || NlaIII || |Hin4I || |Hin4I Hin4I || || TstI BsaXI StyI || || MseI Hin4I SecI* || || BsaXI | TstI \ \\ \\ \ \ \ ACCAAGGCGTTTGTTCGCAATCATGATTTAATAAGACACAAAATCTCCCATAATGCCAAG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTCCGCAAACAAGCGTTAGTACTAAATTATTCTGTGTTTTAGAGGGTATTACGGTTC / / /// / / / SecI* | ||| MseI | BsaXI StyI | ||BspHI | TstI | ||BsaXI Hin4I | ||FatI Hin4I | |Hpy178III* | |CviAII | TstI NlaIII Hin4I Hin4I T K A F V R N H D L I R H K I S H N A K P R R L F A I M I * * D T K S P I M P R Q G V C S Q S * F N K T Q N L P * C Q E ----:----|----:----|----:----|----:----|----:----|----:----| V L A N T R L * S K I L C L I E W L A L C W P T Q E C D H N L L V C F R G Y H W G L R K N A I M I * Y S V F D G M I G L FatI |CviAII MseI MmeI || AciI |MnlI BcgI FokI || NlaIII |SfaNI | BseGI | CviRI* \\ \ \\ \ \ \ \ AAATACATCTGCCCATGCGGAAAGAGATTTAATAGGGAGGATGCTCTAATGGTGCATAGA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TTTATGTAGACGGGTACGCCTTTCTCTAAATTATCCCTCCTACGAGATTACCACGTATCT / // / / / / / / / / | || AciI | | SfaNI | BseGI | FokI | |FatI | MseI BcgI CviRI* | CviAII MnlI MmeI NlaIII K Y I C P C G K R F N R E D A L M V H R N T S A H A E R D L I G R M L * W C I E I H L P M R K E I * * G G C S N G A * K ----:----|----:----|----:----|----:----|----:----|----:----| F Y M Q G H P F L N L L S S A R I T C L S I C R G M R F S I * Y P P H E L P A Y F V D A W A S L S K I P L I S * H H M S Hpy188I | BseGI | | CviRI* | | | SgrAI | | | Cfr10I | | | |BcgI TaqI | | | |HpaII |MboI | | | ||FokI || DpnI | | | ||| AciI TspEI || |BstKTI \ \ \ \\\ \ \ \\ \\ AGTCGGATGATTTGCACCGGCGGTAAGAAATTAGAACATTCGATCAACAAGAAACTTACA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TCAGCCTACTAAACGTGGCCGCCATTCTTTAATCTTGTAAGCTAGTTGTTCTTTGAATGT / / // // / / // / | | || || FokI TspEI || MboI | | || || AciI |DpnI | | || |Cfr10I BstKTI | | || |SgrAI TaqI | | || HpaII | | |BcgI | | CviRI* | BseGI Hpy188I S R M I C T G G K K L E H S I N K K L T V G * F A P A V R N * N I R S T R N L H S D D L H R R * E I R T F D Q Q E T Y I ----:----|----:----|----:----|----:----|----:----|----:----| L R I I Q V P P L F N S C E I L L F S V F D S S K C R R Y S I L V N S * C S V * T P H N A G A T L F * F M R D V L F K C BslFI CviJI | AciI | Cac8I | | FatI | | |CviAII | | || NlaIII CviJI | | || |FauI | Cac8I | | || || PshAI \ \ \ \ \\ \\ \ TCTCCCAAAAAAAGCCTGCTTGACAGCCCGCATGACACAAGTCCCGTAAAAGAAACTATC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGGGTTTTTTTCGGACGAACTGTCGGGCGTACTGTGTTCAGGGCATTTTCTTTGATAG / / / / / // // | Cac8I | | | || |PshAI CviJI | | | || FauI | | | |FatI | | | CviAII | | NlaIII | | BslFI | | AciI | Cac8I CviJI S P K K S L L D S P H D T S P V K E T I L P K K A C L T A R M T Q V P * K K L S S Q K K P A * Q P A * H K S R K R N Y R ----:----|----:----|----:----|----:----|----:----|----:----| D G L F L R S S L G C S V L G T F S V I M E W F F G A Q C G A H C L D R L L F * R G F F A Q K V A R M V C T G Y F F S D BssKI |AvaI |BssKI |SecI* |Cfr9I ||HpaII TspDTI ||ScrFI | TseI ||CauII* | AluI ||BmeT110I | CviJI |||SmaI | PvuII |||ScrFI | NspBII* |||CauII* | |BisI |||| BccI MnlI | ||BlsI |||| | HgaI | BbvI | ||SetI Hin6I \\\\ \ \ \ \ \ \\\ \ GCCCGGGATAAAGATGGGAGCGTCCTAATGAAAATGGAGGAACAGCTGCGAGATGATATG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CGGGCCCTATTTCTACCCTCGCAGGATTACTTTTACCTCCTTGTCGACGCTCTACTATAC ///// / / / / / //// / ||||BccI HgaI MnlI BbvI | | |||TseI HhaI |||BssKI | | ||BisI ||Cfr9I | | |BlsI ||BssKI | | NspBII* ||SecI* | | PvuII ||AvaI | | CviJI |BmeT110I | | AluI |CauII* | SetI |HpaII TspDTI |ScrFI CauII* ScrFI SmaI A R D K D G S V L M K M E E Q L R D D M P G I K M G A S * * K W R N S C E M I C P G * R W E R P N E N G G T A A R * Y A ----:----|----:----|----:----|----:----|----:----|----:----| A R S L S P L T R I F I S S C S R S S I R G P Y L H S R G L S F P P V A A L H Y G P I F I P A D * H F H L F L Q S I I H GlaI MstI* |HhaI || FatI || |CviAII || || NlaIII || || | BinI* || || | | FokI BccI || || | | | MboI |BplI || || | | | BamHI |BplI || || | | | XhoII |TseI || || | | | | DpnI ||BisI || || | | | | BsrI |||BlsI || || | | | | NlaIV ||||Hin6I || || | | | | |BstKTI |||||GlaI || || | | | | || BinI* ||||||HhaI || || | | | | || | BseGI |||||||BsiI* BbvI TaqI AciI \\ \\ \ \ \ \ \\ \ \ \\\\\\\\ \ \ \ CGCAAACATGGATTACTGGATCCACCCCCATCCACAGCAGCGCACGAGCAAAACTCGAAC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| GCGTTTGTACCTAATGACCTAGGTGGGGGTAGGTGTCGTCGCGTGCTCGTTTTGAGCTTG // / // / /// / // / ////// / / / || | || | ||| | || BplI |||||| BsiI* | TaqI || | || | ||| | || BplI |||||Hin6I BbvI || | || | ||| | |BinI* ||||GlaI || | || | ||| | BseGI |||TseI || | || | ||| XhoII |||HhaI || | || | ||| BamHI ||BisI || | || | ||| MboI |BlsI || | || | ||NlaIV BccI || | || | ||DpnI || | || | |BstKTI || | || | |FokI || | || | BsrI || | || BinI* || | |FatI || | CviAII || NlaIII |Hin6I MstI* GlaI R K H G L L D P P P S T A A H E Q N S N A N M D Y W I H P H P Q Q R T S K T R T Q T W I T G S T P I H S S A R A K L E P ----:----|----:----|----:----|----:----|----:----|----:----| R L C P N S S G G G D V A A C S C F E F A C V H I V P D V G M W L L A R A F S S A F M S * Q I W G W G C C R V L L V R V BcgI |EcoP15I || BplI || BplI || | SfaNI Hpy188I \\ \ \ \ CGCACCCTTTCAAACGAAACTGATGCTCTCTGA 2290 2300 2310 ----:----|----:----|----:----|--- GCGTGGGAAAGTTTGCTTTGACTACGAGAGACT / / / / / | | EcoP15I SfaNI Hpy188I | BplI | BplI AciI BcgI R T L S N E T D A L * A P F Q T K L M L S X H P F K R N * C S L X ----:----|----:----|----:----|--- R V R E F S V S A R Q G C G K L R F Q H E R A G K * V F S I S E S # Enzymes that cut Frequency Isoschizomers AarI 1 Acc65I 1 Asp718I AciI 8 BspACI,SsiI AclI 1 Psp1406I AflIII 1 AhaIII* 1 DraI AjuI 2 AloI 1 AluI 5 AluBI AlwNI 1 CaiI ApoI 2 AcsI,XapI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 2 Ama87I,BsiHKCI,BsoBI,Eco88I AvrII 1 AspA2I,BlnI,XmaJI BamHI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BccI 7 Bce83I* 2 BpuEI BceAI 1 BcgI 2 BetI* 1 BsaWI BglII 1 BinI* 5 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 2 BplI 2 BsaXI 4 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 8 BstF5I,BtsCI BseMII 1 BseRI 3 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 4 Alw26I,BstMAI BspCNI 1 BspHI 2 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrI 6 BseNI,Bse1I,BsrSI BssKI 9 BstSCI,StyD4I BstKTI 9 BtgZI 1 Cac8I 3 BstC8I CauII* 6 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I Cfr9I 2 TspMI,XmaCI,XmaI CfrI 1 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 6 CviQI,RsaNI CviAII 11 CviJI 16 CviKI-1 CviRI* 10 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 9 MalI DrdI 1 AasI,DseDI DsaI* 3 BtgI,BstDSI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57MI 1 EcoP15I 3 EcoRI 1 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 2 Eco32I Esp3I 1 BsmBI FalI 2 FatI 11 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 8 GlaI 3 GsuI 1 BpmI HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 3 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 2 HpyAV Hin6I 3 HinP1I,HspAI HindII 1 HincII HinfI 3 HpaII 6 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 7 Hpy99I 2 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 6 MboI 9 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MlyI 1 SchI MmeI 2 MnlI 16 MseI 10 Tru1I,Tru9I MslI 2 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 1 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 11 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NmeAIII 1 NruI 1 BtuMI,Bsp68I NspBII* 1 MspA1I NspI 2 BstNSI,XceI PfoI 1 PleI 1 PpsI PshAI 1 BstPAI,BoxI PsiI 2 AanI PstI 1 PvuII 1 RsaI 6 AfaI SapI 1 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 9 BmrFI,MspR9I,Bme1390I SecI* 11 BseDI,BssECI,BsaJI SetI 24 SfaNI 2 LweI SfeI* 2 BstSFI,SfcI,BfmI SgrAI 1 SmaI 2 SmlI 2 SmoI SspI 1 StyI 5 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 8 TaqII 1 TatI 2 TfiI 2 PfeI TseI 3 ApeKI TsoI 2 Tsp45I 4 NmuCI Tsp4CI* 9 HpyCH4III,TaaI,Bst4CI TspDTI 9 TspEI 13 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 4 TscAI TstI 2 XhoII 5 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI AccI AcyI AflII AgeI AlfI ApaI ApaLI AscI AsuI* AvaII BaeI BalI BarI BbvCI BbvII* BciVI BclI BdaI BfiI BglI BmgT120I BmtI Bpu10I BsaAI BsaBI BsePI BseSI BseYI BsgI BsmI Bsp120I Bsp1407I BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtrI BtsI CspCI DinI DraII DraIII Eam1105I Ecl136II Eco47III Eco57I EcoICRI EcoNI EcoT22I EgeI EheI EspI* FseI FspAI GsaI HaeII HgiAI* HgiJII* HindIII HpaI KasI MauBI McrI* MfeI MluI Mph1103I MroNI NaeI NarI NdeI NgoMIV NheI NotI NsiI OliI PacI PasI PflMI PmaCI PmeI PpiI PpuMI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SduI SexAI SfiI SfoI SgfI SgrDI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TauI Tth111I VspI XbaI XcmI XhoI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769