Restriction Map of DIP2/YLR129W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

DIP2/YLR129W on chromosome XII from coordinates 399657 to 402488.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.6793

Cac8I | TseI | |BisI | ||BlsI | |||TseI AlfI | |||AluI AlfI | |||CviJI | AclI | |||PvuII | MaeII | |||NspBII* | | BbvI | ||||BisI AlfI | | SetI | |||||BlsI AlfI | | TaiI | |||||SetI BbvI | CviJI MwoI \ \ \ \ \\\\\\ \ \ \ \ ATGGTCAAATCATACCAACGTTTTGAGCAAGCAGCTGCTTTTGGTGTAATAGCCTCCAAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAGTTTAGTATGGTTGCAAAACTCGTTCGTCGACGAAAACCACATTATCGGAGGTTA / / / / / ////// // / / | | | | | |||||TseI || | MwoI | | | | | ||||BisI || CviJI | | | | | |||BlsI |AlfI | | | | | ||NspBII* |AlfI | | | | | ||PvuII BbvI | | | | | ||CviJI | | | | | ||TseI | | | | | ||AluI | | | | | |BisI | | | | | BlsI | | | | | SetI | | | | Cac8I | | | BbvI | | MaeII | | AclI | TaiI | SetI AlfI AlfI M V K S Y Q R F E Q A A A F G V I A S N W S N H T N V L S K Q L L L V * * P P M G Q I I P T F * A S S C F W C N S L Q C ----:----|----:----|----:----|----:----|----:----|----:----| X T L D Y W R K S C A A A K P T I A E L X P * I M G V N Q A L L Q K Q H L L R W H D F * V L T K L L C S S K T Y Y G G I AsuI* AvaII Hpy166II MfeI SetI |BmgT120I MnlI | BseGI ||BssKI TspEI | | BspMI ||EcoRII | BaeI | | |BetI* ||| ScrFI | |BciVI | | |BspMII* ||| BseBI | || HgaI | | ||HpaII ||| | MfeI | || |FokI | | ||Hpy178III* BaeI ||| | TspEI \ \\ \\ \ \ \\\ \ \\\ \ \ GCCAATTGTGTTTGGATACCTGCGTCATCCGGAAATAGTAATGGTAGTGGACCAGGACAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTAACACAAACCTATGGACGCAGTAGGCCTTTATCATTACCATCACCTGGTCCTGTT / / // / // / / // / / MnlI TspEI |SetI BseGI || BaeI | || | EcoRII BaeI BciVI HgaI |BspMII* | || | BssKI MfeI FokI |BetI* | || BseBI Hpy178III* | || ScrFI BspMI | |AvaII HpaII | |AsuI* | BmgT120I Hpy166II A N C V W I P A S S G N S N G S G P G Q P I V F G Y L R H P E I V M V V D Q D N Q L C L D T C V I R K * * W * W T R T I ----:----|----:----|----:----|----:----|----:----|----:----| A L Q T Q I G A D D P F L L P L P G P C H W N H K S V Q T M R F Y Y H Y H V L V G I T N P Y R R * G S I T I T T S W S L MnlI | SduI | HgiAI* | |AvaI | |XhoI | |SmlI | |Hpy178III* | ||TaqI | ||BmeT110I BssKI | ||| MaeII |SecI* | ||| | MseI |HpaII | ||| | SetI ||ScrFI | ||| | TaiI MseI ||CauII* \ \\\ \ \ \ \\\ TTGATTACGAGTGCTCTCGAGGACGTTAATATATGGGATATTAAGACCGGGGATTTGGTC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAATGCTCACGAGAGCTCCTGCAATTATATACCCTATAATTCTGGCCCCTAAACCAG / / /// / / / / / / TspEI HgiAI* ||| | | MseI MseI | BssKI MfeI SduI ||| | MaeII | SecI* MnlI ||| TaiI CauII* ||| SetI HpaII ||SmlI ScrFI ||XhoI ||AvaI |BmeT110I |TaqI Hpy178III* L I T S A L E D V N I W D I K T G D L V * L R V L S R T L I Y G I L R P G I W S D Y E C S R G R * Y M G Y * D R G F G Q ----:----|----:----|----:----|----:----|----:----|----:----| N I V L A R S S T L I H S I L V P S K T I S * S H E R P R * Y I P Y * S R P N P Q N R T S E L V N I Y P I N L G P I Q D SetI BssKI KasI EcoRII MwoI | ScrFI HgiCI* | BseBI |AcyI | |SfaNI |NarI | || Hin6I |Hin6I | || |GlaI ||GlaI | || ||HhaI ||DinI | || |||MnlI ||NlaIV TspEI | || |||| Hpy188I |||HhaI | BccI | || |||| |MnlI ||||HaeII | |GsuI | || |||| |MwoI ||||| CviJI | |Eco57MI | || |||| |BstAPI ||||| |MwoI | || Hpy188I | || |||| || SfaNI ||||| ||Cac8I | || | CviJI | || |||| || |MaeI ||||| ||| CviJI \ \\ \ \ \ \\ \\\\ \\ \\ \\\\\ \\\ \ AGTAAATTATCCGATGGCTTACCTCCAGGCGCATCTGATGCTAGAGGCGCCAAGCCAGCC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTTAATAGGCTACCGAATGGAGGTCCGCGTAGACTACGATCTCCGCGGTTCGGTCGG / / / / / / /// /// // ///// / / / / | | | | SetI | ||| ||MnlI || ||||| | | | CviJI | | | CviJI | ||| |Hpy188I || ||||| | | Cac8I | | Hpy188I | ||| BstAPI || ||||| | CviJI | TspEI | ||| MwoI || ||||| MwoI | BccI | ||Hin6I || ||||HgiCI* Eco57MI | ||SfaNI || ||||KasI GsuI | ||MnlI || |||Hin6I | |GlaI || |||NarI | EcoRII || |||AcyI | BssKI || ||NlaIV | HhaI || ||DinI BseBI || ||GlaI ScrFI || |HhaI || HaeII |SfaNI MwoI MaeI S K L S D G L P P G A S D A R G A K P A V N Y P M A Y L Q A H L M L E A P S Q P * I I R W L T S R R I * C * R R Q A S R ----:----|----:----|----:----|----:----|----:----|----:----| L L N D S P K G G P A D S A L P A L G A * Y I I R H S V E L R M Q H * L R W A L T F * G I A * R W A C R I S S A G L W G TatI AluI Bsp1407I CviJI |Csp6I | SetI |Hpy166II | |TspGWI ||RsaI CviJI | || MaeIII ||| MnlI | NmeAIII | || | BccI \\\ \ \ \ \ \\ \ \ GAGTGTACATATTTGGAGGCTCATAAAGATACGGATTTATTAGCTGTCGGTTACGCAGAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTCACATGTATAAACCTCCGAGTATTTCTATGCCTAAATAATCGACAGCCAATGCGTCTA //// / / / // // |||Bsp1407I | NmeAIII | |TspGWI |MaeIII |||TatI CviJI | CviJI BccI |||MnlI | AluI ||Csp6I SetI |RsaI Hpy166II E C T Y L E A H K D T D L L A V G Y A D S V H I W R L I K I R I Y * L S V T Q M V Y I F G G S * R Y G F I S C R L R R W ----:----|----:----|----:----|----:----|----:----|----:----| S H V Y K S A * L S V S K N A T P * A S R T Y M N P P E Y L Y P N I L Q R N R L L T C I Q L S M F I R I * * S D T V C I Tsp4CI* | Hin4I | Hin4I MseI | | ApoI MaeIII | Hin4I | | TspEI Tsp45I | Hin4I DdeI | | | MseI Tsp4CI* \ \ \ \ \ \ \ \ GGTGTCATTAAAGTTTGGGATTTGATGTCTAAGACTGTGCTTTTGAATTTTAACGGTCAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAGTAATTTCAAACCCTAAACTACAGATTCTGACACGAAAACTTAAAATTGCCAGTG / / / / / / / / / | MseI | | Hin4I | | | Tsp45I Hin4I | | Hin4I | | | MaeIII Hin4I | Tsp4CI* | | Tsp4CI* DdeI | MseI TspEI ApoI G V I K V W D L M S K T V L L N F N G H V S L K F G I * C L R L C F * I L T V T C H * S L G F D V * D C A F E F * R S Q ----:----|----:----|----:----|----:----|----:----|----:----| P T M L T Q S K I D L V T S K F K L P * H H * * L K P N S T * S Q A K S N * R D T D N F N P I Q H R L S H K Q I K V T V TseI |BisI NlaIV ||BlsI BslFI |MlyI |||AluI |MseI |PleI |||CviJI BccI |VspI ||StyI |||| SetI BbvI TspEI BsrI ||TspEI ||SecI* \\\\ \ \ \ \ \\\ \\\ AAAGCAGCTATAACATTATTACAATTTGATGGGACTGGCACAAGATTAATTTCTGGTTCC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCGTCGATATTGTAATAATGTTAAACTACCCTGACCGTGTTCTAATTAAAGACCAAGG /// / / / / // / /// ||CviJI | | TspEI BsrI || TspEI ||PleI ||TseI | BccI |BslFI |MlyI ||AluI BbvI VspI NlaIV |BisI MseI BlsI SetI K A A I T L L Q F D G T G T R L I S G S K Q L * H Y Y N L M G L A Q D * F L V P S S Y N I I T I * W D W H K I N F W F Q ----:----|----:----|----:----|----:----|----:----|----:----| L A A I V N N C N S P V P V L N I E P E C L L * L M I V I Q H S Q C L I L K Q N F C S Y C * * L K I P S A C S * N R T G MboI XhoII | DpnI | |BstKTI TstI | || FalI DdeI | || FalI | MboI HinfI MmeI | || | BinI* PsiI | | DpnI \ \ \ \\ \ \ \ \ \ \ AAGGACTCCAATATCATTGTATGGGATCTTGTTGGAGAAGTTGGTCTTTATAAACTTAGA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTGAGGTTATAGTAACATACCCTAGAACAACCTCTTCAACCAGAAATATTTGAATCT / / / /// / / / / /// | | MmeI ||| | BinI* PsiI | ||DpnI | HinfI ||| XhoII TstI | |BstKTI SecI* ||| MboI | DdeI StyI ||DpnI FalI |BstKTI FalI FalI FalI K D S N I I V W D L V G E V G L Y K L R R T P I S L Y G I L L E K L V F I N L D G L Q Y H C M G S C W R S W S L * T * I ----:----|----:----|----:----|----:----|----:----|----:----| L S E L I M T H S R T P S T P R * L S L W P S W Y * Q I P D Q Q L L Q D K Y V * L V G I D N Y P I K N S F N T K I F K S CviJI | MboI | BclI FalI CviJI | | DpnI FalI TfiI |BsrI | | MboII BstKTI HinfI || TstI | | |BstKTI \ \ \\ \ \ \ \\ TCACACAAGGATTCCATTACTGGCTTTTGGTGTCAAGGAGAAGATTGGCTGATCAGCACC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGTGTTCCTAAGGTAATGACCGAAAACCACAGTTCCTCTTCTAACCGACTAGTCGTGG / / // / // / / MboI HinfI |CviJI | || | SetI TfiI TstI | || BclI BsrI | || MboI | |DpnI | BstKTI | MboII CviJI S H K D S I T G F W C Q G E D W L I S T H T R I P L L A F G V K E K I G * S A P T Q G F H Y W L L V S R R R L A D Q H L ----:----|----:----|----:----|----:----|----:----|----:----| D C L S E M V P K Q H * P S S Q S I L V I V C P N W * Q S K T D L L L N A S * C * V L I G N S A K P T L S F I P Q D A G MboI BclI | DpnI | |BstKTI | || AluI | || CviJI | || | SetI | || | | AsuI* | || | | AvaII | || | | DraII | || | | PpuMI | || | | |NlaIV BslFI BccI | || | | |BmgT120I | MslI SetI MnlI | || | | || SetI | | BsmAI \ \ \ \\ \ \ \\ \ \ \ \ TCCAAAGATGGAATGATCAAGCTATGGGACCTAAAAACACATCAATGTATAGAGACACAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTTCTACCTTACTAGTTCGATACCCTGGATTTTTGTGTAGTTACATATCTCTGTGTA / / // // / /// / / / BccI MnlI || || CviJI ||PpuMI | BslFI BsmAI || || AluI ||DraII MslI || |SetI ||AvaII || BclI ||AsuI* || MboI |BmgT120I |DpnI NlaIV BstKTI SetI S K D G M I K L W D L K T H Q C I E T H P K M E * S S Y G T * K H I N V * R H I Q R W N D Q A M G P K N T S M Y R D T Y ----:----|----:----|----:----|----:----|----:----|----:----| E L S P I I L S H S R F V C * H I S V C R W L H F S * A I P G L F V D I Y L S V G F I S H D L * P V * F C M L T Y L C M AsuI* DraII |NlaIV |BmgT120I ||CviJI ||HaeIII ||| Hin4II* BseGI ||| |CviRI* | MboI Hin6I ||| ||GsuI | BclI |GlaI ||| ||Eco57MI | | DpnI |MstI* ||| ||| BtsI | | FokI ||HhaI BsrI ||| ||| TspRI | | |BstKTI \\\ \ \\\ \\\ \ \ \ \\ ATTGCGCATACTGGAGAGTGTTGGGGCCTTGCAGTGAAGGATGATTTACTGATCACAACT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGCGTATGACCTCTCACAACCCCGGAACGTCACTTCCTACTAAATGACTAGTGTTGA /// / /// /// / / // / / ||Hin6I BsrI ||| ||| BtsI BseGI || | FokI |MstI* ||| ||CviRI* || BclI |GlaI ||| |Eco57MI || MboI HhaI ||| |GsuI |DpnI ||| Hin4II* BstKTI ||| TspRI ||DraII ||AsuI* |BmgT120I |HaeIII |CviJI NlaIV I A H T G E C W G L A V K D D L L I T T L R I L E S V G A L Q * R M I Y * S Q L C A Y W R V L G P C S E G * F T D H N W ----:----|----:----|----:----|----:----|----:----|----:----| I A C V P S H Q P R A T F S S K S I V V Y Q A Y Q L T N P G Q L S P H N V S * L N R M S S L T P A K C H L I I * Q D C S Csp6I |RsaI ApoI |BsrI TspEI BsrI \\ \ \ GGTACTGATAGTCAAGTAAAAATTTGGAAACTGGATATAGAAAATGACAAAATGGGGGGG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGACTATCAGTTCATTTTTAAACCTTTGACCTATATCTTTTACTGTTTTACCCCCCC / // / / | |Csp6I TspEI BsrI | RsaI ApoI BsrI G T D S Q V K I W K L D I E N D K M G G V L I V K * K F G N W I * K M T K W G G Y * * S S K N L E T G Y R K * Q N G G E ----:----|----:----|----:----|----:----|----:----|----:----| P V S L * T F I Q F S S I S F S L I P P Q Y Q Y D L L F K S V P Y L F H C F P P T S I T L Y F N P F Q I Y F I V F H P P MaeII | SetI | TaiI TaqI | | MseI BccI AsuII MwoI | | | TspDTI \ \ \ \ \ \ \ AAACTAACAGAGATGGGTATTTTCGAAAAGCAAAGTAAGCAACGTGGGTTAAAGATTGAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGATTGTCTCTACCCATAAAAGCTTTTCGTTTCATTCGTTGCACCCAATTTCTAACTC / / / / / / / BccI AsuII MwoI | | | MseI TaqI | | TspDTI | MaeII TaiI SetI K L T E M G I F E K Q S K Q R G L K I E N * Q R W V F S K S K V S N V G * R L S T N R D G Y F R K A K * A T W V K D * V ----:----|----:----|----:----|----:----|----:----|----:----| F S V S I P I K S F C L L C R P N F I S S V L L S P Y K R F A F Y A V H T L S Q F * C L H T N E F L L T L L T P * L N L ApoI Hpy188I MnlI TspEI | FokI | BseGI |Hin4I | | SetI | | Hin4I BsmAI \\ \ \ \ \ \ \ \ TTCATAACAAATTCGTCTGACAAAACCTCTTTTTTTTACATCCAAAATGCTGATAAAACC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTATTGTTTAAGCAGACTGTTTTGGAGAAAAAAAATGTAGGTTTTACGACTATTTTGG / / / / / /// Hin4I | | SetI FokI ||Hin4I | Hpy188I |BseGI TspEI MnlI ApoI F I T N S S D K T S F F Y I Q N A D K T S * Q I R L T K P L F F T S K M L I K P H N K F V * Q N L F F L H P K C * * N H ----:----|----:----|----:----|----:----|----:----|----:----| N M V F E D S L V E K K * M W F A S L V T * L L N T Q C F R K K K C G F H Q Y F E Y C I R R V F G R K K V D L I S I F G MnlI | MboII TaqI | | MboII |Hpy178III* | | | SetI || Hpy188I | | | |MseI Ksp632I* || BccI |TspEI | | | ||AhaIII* |MnlI \\ \ \\ \ \ \ \\\ \\ ATCGAGACTTTCAGAATTAGAAAAGAAGAAGAAATAGCAAGAGGTTTAAAGAAAAGAGAG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTCTGAAAGTCTTAATCTTTTCTTCTTCTTTATCGTTCTCCAAATTTCTTTTCTCTC / // / / / / / / / // / / | || | | TspEI | | | SetI |MseI | Ksp632I* | || | Hpy188I | | MboII AhaIII* MnlI | || BccI | MboII | |Hpy178III* MnlI | TaqI BsmAI I E T F R I R K E E E I A R G L K K R E S R L S E L E K K K K * Q E V * R K E R R D F Q N * K R R R N S K R F K E K R E ----:----|----:----|----:----|----:----|----:----|----:----| M S V K L I L F S S S I A L P K F F L S W R S K * F * F L L L F L L L N L S F L D L S E S N S F F F F Y C S T * L F S L TspEI MseI | MboII | BseRI HindII | CviRI* | |TfiI CviJI MboII Hpy166II | | MboII | |HinfI \ \ \ \ \ \ \ \\ AAGAGGCTAAAAGAAAAGGGGTTGACAGAAGAAGAAATTGCAAAATCTATTAAAGAATCC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTCCGATTTTCTTTTCCCCAACTGTCTTCTTCTTTAACGTTTTAGATAATTTCTTAGG / / / // / / / | MboII Hpy166II || MboII BseRI HinfI CviJI HindII |CviRI* MseI TfiI MboII TspEI K R L K E K G L T E E E I A K S I K E S R G * K K R G * Q K K K L Q N L L K N P E A K R K G V D R R R N C K I Y * R I L ----:----|----:----|----:----|----:----|----:----|----:----| F L S F S F P N V S S S I A F D I L S D S S A L L F P T S L L L F Q L I * * L I L P * F F L P Q C F F F N C F R N F F G MnlI MboI | BseGI | DpnI FokI | CviRI* SfaNI | |BstKTI \ \ \ \ \ \\ TACTCCTCCTTTATATTGCATCCTTTTCAAACCATAAGATCATTGTATAAAATAAAATCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAGGAGGAAATATAACGTAGGAAAAGTTTGGTATTCTAGTAACATATTTTATTTTAGA / / / / / // / FokI | | CviRI* SfaNI || MboI | BseGI |DpnI MnlI BstKTI Y S S F I L H P F Q T I R S L Y K I K S T P P L Y C I L F K P * D H C I K * N L L L L Y I A S F S N H K I I V * N K I C ----:----|----:----|----:----|----:----|----:----|----:----| * E E K I N C G K * V M L D N Y L I F D R S R R * I A D K E F W L I M T Y F L I V G G K Y Q M R K L G Y S * Q I F Y F R CviRI* | Bce83I* | |FatI | ||CviAII | ||| NlaIII | ||| | SfaNI | ||| | | PshAI | ||| | | | Tsp4CI* | ||| | | | | SmlI | ||| | | | | | BsmAI SmlI TaqI | ||| | | | | | Eco31I | XcmI MseI Bce83I* \ \\\ \ \ \ \ \ \ \ \ \ \ GCATCATGGACAACGGTCTCAAGTTCCAAACTTGAGTTGGTATTAACTACATCGAGTAAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAGTACCTGTTGCCAGAGTTCAAGGTTTGAACTCAACCATAATTGATGTAGCTCATTA / / // // / / / / / / / | | |FatI |Tsp4CI* | Eco31I | SmlI MseI | TaqI | | | |SfaNI | BsmAI XcmI Bce83I* | | | PshAI SmlI | | CviAII | NlaIII Bce83I* CviRI* A S W T T V S S S K L E L V L T T S S N H H G Q R S Q V P N L S W Y * L H R V I I M D N G L K F Q T * V G I N Y I E * Y ----:----|----:----|----:----|----:----|----:----|----:----| A D H V V T E L E L S S N T N V V D L L Q M M S L P R L N W V Q T P I L * M S Y C * P C R D * T G F K L Q Y * S C R T I TspDTI | Bce83I* BsmAI | |BseRI SmlI NdeI Eco31I | || CviJI | Hpy178III* \ \ \ \\ \ \ \ ACCATAGAGTATTATTCCATTCCATATGAAAAAAGAGACCCAACAAGCCCTGCTCCTCTC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTATCTCATAATAAGGTAAGGTATACTTTTTTCTCTGGGTTGTTCGGGACGAGGAGAG / / / // / NdeI | | || CviJI | | |BseRI | | Bce83I* | TspDTI Eco31I BsmAI T I E Y Y S I P Y E K R D P T S P A P L P * S I I P F H M K K E T Q Q A L L L S H R V L F H S I * K K R P N K P C S S Q ----:----|----:----|----:----|----:----|----:----|----:----| V M S Y * E M G Y S F L S G V L G A G R Y W L T N N W E M H F F L G L L G Q E E G Y L I I G N W I F F S V W C A R S R E TspEI FokI MnlI | CviRI* BseGI TspGWI \ \ \ \ \ AAGACACATACTATTGAATTGCAAGGGCAAAGAACGGATGTGCGTAGTATTGACATCAGT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTGTGTATGATAACTTAACGTTCCCGTTTCTTGCCTACACGCATCATAACTGTAGTCA / / // / / // | MnlI |CviRI* BseGI | |TspRI Hpy178III* TspEI | FokI SmlI TspGWI K T H T I E L Q G Q R T D V R S I D I S R H I L L N C K G K E R M C V V L T S V D T Y Y * I A R A K N G C A * Y * H Q * ----:----|----:----|----:----|----:----|----:----|----:----| L V C V I S N C P C L V S T R L I S M L * S V Y * Q I A L A F F P H A Y Y Q C * L C M S N F Q L P L S R I H T T N V D T TspEI BseGI TspRI | FokI |TspDTI SfaNI \ \ \ \\ \ GATGATAACAAATTACTTGCCACAGCATCCAATGGTTCATTGAAAATATGGAATATCAAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTATTGTTTAATGAACGGTGTCGTAGGTTACCAAGTAACTTTTATACCTTATAGTTT / / // / | FokI |TspDTI SfaNI TspEI BseGI D D N K L L A T A S N G S L K I W N I K M I T N Y L P Q H P M V H * K Y G I S K * * Q I T C H S I Q W F I E N M E Y Q N ----:----|----:----|----:----|----:----|----:----|----:----| S S L L N S A V A D L P E N F I H F I L H H Y C I V Q W L M W H N M S F I S Y * I I V F * K G C C G I T * Q F Y P I D F BssKI Hpy188I CviRI* EcoRII | TaqI | EcoT22I | ScrFI MslI | AsuII | |MseI | BseBI \ \ \ \ \\ \ \ ACACATAAATGTATCAGAACTTTCGAATGTGGGTATGCATTAACTTGTAAGTTTTTGCCA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGTATTTACATAGTCTTGAAAGCTTACACCCATACGTAATTGAACATTCAAAAACGGT / / / / / / // MslI Hpy188I AsuII | | MseI |BseBI TaqI | CviRI* |ScrFI EcoT22I |MwoI |BglI SetI T H K C I R T F E C G Y A L T C K F L P H I N V S E L S N V G M H * L V S F C Q T * M Y Q N F R M W V C I N L * V F A R ----:----|----:----|----:----|----:----|----:----|----:----| V C L H I L V K S H P Y A N V Q L N K G F V Y I Y * F K R I H T H M L K Y T K A C M F T D S S E F T P I C * S T L K Q W MaeIII | Hin4I | Hin4I | | AluI SetI | | CviJI BglI | | | SetI MwoI BsrI | | | | MboI | CviJI Csp6I | | | | | DpnI | | SpeI |RsaI | | | | | |BstKTI | | |MaeI || BfiI | | | | | ||MaeI \ \ \\ \\ \ \ \ \ \ \ \\\ GGTGGGCTACTAGTCATACTGGGTACAAGAAACGGGGAGTTACAGCTCTTTGATCTAGCA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCCGATGATCAGTATGACCCATGTTCTTTGCCCCTCAATGTCGAGAAACTAGATCGT / / // / // / / / / // / / | CviJI |SpeI | || BfiI | | CviJI || | MaeI EcoRII MaeI | |Csp6I | | AluI || MboI BssKI | RsaI | MaeIII |DpnI BsrI | SetI BstKTI Hin4I Hin4I G G L L V I L G T R N G E L Q L F D L A V G Y * S Y W V Q E T G S Y S S L I * H W A T S H T G Y K K R G V T A L * S S I ----:----|----:----|----:----|----:----|----:----|----:----| P P S S T M S P V L F P S N C S K S R A L H A V L * V P Y L F R P T V A R Q D L T P * * D Y Q T C S V P L * L E K I * C SfaNI | CviRI* | |BcgI | ||FatI | |||CviAII | |||| MwoI | |||| MboII | |||| NlaIII | |||| BstAPI | |||| | AciI MaeI | |||| | |BisI | MboI | |||| | ||BlsI | BglII Hin4I | |||| | |||TauI | XhoII SfaNI Hin4I | |||| | ||||TspEI | | DpnI | BciVI | SfaNI | |||| | ||||| Hin4I | | |BstKTI \ \ \ \ \ \\\\ \ \\\\\ \ \ \ \\ TCATCAAGTCTTTTGGATACCATTGAAGATGCACATGATGCGGCAATTTGGTCGCTAGAT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGTTCAGAAAACCTATGGTAACTTCTACGTGTACTACGCCGTTAAACCAGCGATCTA / // / // // // /// / / /// | |SfaNI SfaNI || || || ||| | TspEI ||DpnI | Hin4I || || || ||| Hin4I |BstKTI | Hin4I || || || ||BisI MaeI BciVI || || || ||AciI || || || |BlsI || || || TauI || || |FatI || || CviAII || || MboII || |BstAPI || |MwoI || NlaIII |CviRI* |SfaNI BcgI S S S L L D T I E D A H D A A I W S L D H Q V F W I P L K M H M M R Q F G R * I I K S F G Y H * R C T * C G N L V A R S ----:----|----:----|----:----|----:----|----:----|----:----| D D L R K S V M S S A C S A A I Q D S S M M L D K P Y W Q L H V H H P L K T A L * * T K Q I G N F I C M I R C N P R * I Hpy188I | BccI | | DdeI | | BcgI | | |SetI | | || Hpy188I | | || | MnlI | | || | |Hpy166II | | || | || BspCNI | | || | || |BseMII | | || | || ||Hin4I | | || | || ||| MaeIII | | || | || ||| Tsp45I | | || | || ||| | BetI* | | || | || ||| | |HpaII | | || | || ||| | || MboI | | || | || ||| | || XhoII | | || | || ||| | || | DpnI | | || | || ||| | || | |BstKTI | | || | || ||| | || | || BinI* Tsp4CI* \ \ \\ \ \\ \\\ \ \\ \ \\ \ \ CTGACCTCAGATGGTAAACGATTAGTGACCGGATCTGCCGATAAAACTGTCAAGTTTTGG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GACTGGAGTCTACCATTTGCTAATCACTGGCCTAGACGGCTATTTTGACAGTTCAAAACC / /// // / /// / /// / / / | ||| |DdeI | ||BseMII | ||| | BinI* Tsp4CI* | ||| | | |BspCNI | ||| XhoII | ||| | | Hpy166II | ||| MboI | ||| | | Hin4I | ||DpnI | ||| | MnlI | |BstKTI | ||| Hpy188I | |BetI* | ||BccI | HpaII | |BcgI Tsp45I | SetI MaeIII Hpy188I XhoII BglII MboI L T S D G K R L V T G S A D K T V K F W * P Q M V N D * * P D L P I K L S S F G D L R W * T I S D R I C R * N C Q V L G ----:----|----:----|----:----|----:----|----:----|----:----| R V E S P L R N T V P D A S L V T L N Q D S R L H Y V I L S R I Q R Y F Q * T K Q G * I T F S * H G S R G I F S D L K P BssKI EcoRII |AjuI ||ScrFI ||BseBI ||| Acc65I ||| HgiCI* ||| |Csp6I ||| ||RsaI ||| ||SetI ApoI MseI CviJI ||| ||NlaIV XmnI |AhaIII* | MaeI ||| ||| KpnI TspEI BsgI ||AjuI \ \ \\\ \\\ \ \ \ \\\ GATTTCAAAGTTGAAAATAGCCTAGTGCCAGGTACCAAGAACAAATTCCTGCCTGTTTTA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAGTTTCAACTTTTATCGGATCACGGTCCATGGTTCTTGTTTAAGGACGGACAAAAT / // /////// / / / // | |MaeI ||||||HgiCI* | TspEI | |MseI | AjuI ||||||Acc65I | ApoI | AhaIII* CviJI |||||Csp6I | BsgI AjuI ||||NlaIV XmnI ||||RsaI |||EcoRII |||BssKI ||KpnI |BseBI |ScrFI SetI D F K V E N S L V P G T K N K F L P V L I S K L K I A * C Q V P R T N S C L F * F Q S * K * P S A R Y Q E Q I P A C F K ----:----|----:----|----:----|----:----|----:----|----:----| S K L T S F L R T G P V L F L N R G T K P N * L Q F Y G L A L Y W S C I G A Q K I E F N F I A * H W T G L V F E Q R N * CviRI* | FatI Csp6I | |CviAII TspEI Hpy166II | || NlaIII | MseI |RsaI \ \\ \ \ \ \\ AAACTGCACCATGATACAACTTTGGAATTAACTGACGACATTTTATGTGTACGGGTTTCT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGACGTGGTACTATGTTGAAACCTTAATTGACTGCTGTAAAATACACATGCCCAAAGA / / // // /// | | |FatI |MseI ||Csp6I | | CviAII TspEI |RsaI | NlaIII Hpy166II CviRI* K L H H D T T L E L T D D I L C V R V S N C T M I Q L W N * L T T F Y V Y G F L T A P * Y N F G I N * R H F M C T G F S ----:----|----:----|----:----|----:----|----:----|----:----| F S C W S V V K S N V S S M K H T R T E L V A G H Y L K P I L Q R C K I H V P K F Q V M I C S Q F * S V V N * T Y P N R Hpy178III* | BsaBI | | EcoRV TsoI | | | MaeI XcmI | FalI Tsp4CI* MlyI | | | | CviJI |BccI | FalI | MseI SetI PleI \ \ \ \ \ \\ \ \ \ \ \ \ CCTGACGATAGATATCTAGCCATCTCGTTGCTGGATAATACTGTTAAGGTATTCTTTTTG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTGCTATCTATAGATCGGTAGAGCAACGACCTATTATGACAATTCCATAAGAAAAAC / / / // / / // / / // | | | |CviJI | | |FalI | MseI |PleI | | | MaeI | | |FalI | SetI MlyI | | EcoRV | | TsoI Tsp4CI* | BsaBI | BccI Hpy178III* XcmI P D D R Y L A I S L L D N T V K V F F L L T I D I * P S R C W I I L L R Y S F W * R * I S S H L V A G * Y C * G I L F G ----:----|----:----|----:----|----:----|----:----|----:----| G S S L Y R A M E N S S L V T L T N K K E Q R Y I D L W R T A P Y Y Q * P I R K R V I S I * G D R Q Q I I S N L Y E K Q TatI DdeI SduI SetI TspDTI FalI |SetI BseSI |Csp6I | TaqI HinfI FalI || TspDTI | TspEI ||RsaI | ClaI \ \ \\ \ \ \ \\\ \ \ GACTCAATGAAGTTTTACCTAAGTTTATATGGGCACAAATTACCTGTACTATCTATCGAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAGTTACTTCAAAATGGATTCAAATATACCCGTGTTTAATGGACATGATAGATAGCTA / / / / / / /// / / HinfI | | DdeI BseSI TspEI ||| TspDTI ClaI FalI | TspDTI SduI SetI ||TatI TaqI FalI SetI |Csp6I RsaI D S M K F Y L S L Y G H K L P V L S I D T Q * S F T * V Y M G T N Y L Y Y L S I L N E V L P K F I W A Q I T C T I Y R Y ----:----|----:----|----:----|----:----|----:----|----:----| S E I F N * R L K Y P C L N G T S D I S P S L S T K G L N I H A C I V Q V I * R V * H L K V * T * I P V F * R Y * R D I MboII BbvII* | MaeII TfiI | | SetI HinfI | | TaiI | DdeI | | | AciI Hpy178III* \ \ \ \ \ \ \ ATTTCATTTGATTCTAAGATGATTATTACGTCTTCCGCAGACAAAAATATCAAGATTTGG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGTAAACTAAGATTCTACTAATAATGCAGAAGGCGTCTGTTTTTATAGTTCTAAACC / / / / / / / | DdeI | | MaeII AciI Hpy178III* HinfI | BbvII* TfiI | TaiI | SetI MboII I S F D S K M I I T S S A D K N I K I W F H L I L R * L L R L P Q T K I S R F G F I * F * D D Y Y V F R R Q K Y Q D L G ----:----|----:----|----:----|----:----|----:----|----:----| I E N S E L I I I V D E A S L F I L I Q Y K M Q N * S S * * T K R L C F Y * S K N * K I R L H N N R R G C V F I D L N P MaeIII Tsp45I Hpy178III* | MaeIII | TfiI | Tsp45I | HinfI | Tsp4CI* | |BccI AclI | | HphI | || TaqI MaeII \ \ \ \ \\ \ \ GGTTTAGATTTTGGTGACTGTCACAAGTCTTTATTTGCCCATCAGGATTCGATTATGAAC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAATCTAAAACCACTGACAGTGTTCAGAAATAAACGGGTAGTCCTAAGCTAATACTTG / / / // / / | Tsp45I | || TaqI TaiI | MaeIII | |HinfI SetI | HphI | |TfiI Tsp4CI* | BccI Tsp45I Hpy178III* MaeIII G L D F G D C H K S L F A H Q D S I M N V * I L V T V T S L Y L P I R I R L * T F R F W * L S Q V F I C P S G F D Y E R ----:----|----:----|----:----|----:----|----:----|----:----| P K S K P S Q * L D K N A W * S E I I F P N L N Q H S D C T K I Q G D P N S * S T * I K T V T V L R * K G M L I R N H V MseI SetI TaiI HgaI | ApoI Tsp4CI* |BtsI | TspEI TspDTI | BsmAI |TspRI \ \ \ \ \ \\ GTTAAATTCTTACCACAGTCTCACAACTTCTTTAGTTGTTCTAAAGACGCAGTGGTGAAA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CAATTTAAGAATGGTGTCAGAGTGTTGAAGAAATCAACAAGATTTCTGCGTCACCACTTT / / / / / / / / | | TspDTI Tsp4CI* BsmAI TspRI BtsI HgaI | | TspEI | | ApoI | MseI MaeII AclI V K F L P Q S H N F F S C S K D A V V K L N S Y H S L T T S L V V L K T Q W * N * I L T T V S Q L L * L F * R R S G E I ----:----|----:----|----:----|----:----|----:----|----:----| T L N K G C D * L K K L Q E L S A T T F R * I R V V T E C S R * N N * L R L P S N F E * W L R V V E K T T R F V C H H F HphI | BdaI | BdaI BsmI | | BseGI XmnI | | | ApoI CviRI* BccI | | | TspEI | BsmI BdaI SspI | | | | FokI | EcoT22I BdaI Hpy188I \ \ \ \ \ \ \ \ \ \ TATTGGGATGGCGAGAAATTTGAATGCATTCAAAAACTATACGCTCATCAGAGCGAAGTT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| ATAACCCTACCGCTCTTTAAACTTACGTAAGTTTTTGATATGCGAGTAGTCTCGCTTCAA // / / / / // / / / || | | BseGI | || CviRI* BdaI Hpy188I || | BdaI | || BsmI BdaI || | BdaI | || XmnI || HphI | |EcoT22I |BccI | |BsmI SspI | FokI TspEI ApoI Y W D G E K F E C I Q K L Y A H Q S E V I G M A R N L N A F K N Y T L I R A K F L G W R E I * M H S K T I R S S E R S L ----:----|----:----|----:----|----:----|----:----|----:----| Y Q S P S F N S H M * F S Y A * * L S T I N P H R S I Q I C E F V I R E D S R L I P I A L F K F A N L F * V S M L A F N BseGI AciI | FatI |BisI | |CviAII ||BlsI | || MboI |||TauI | || BclI |||CviJI | || |NlaIII ||||FokI | || ||DpnI ||||| MboII | || |||BstKTI CviJI AciI BccI ||||| TspDTI | || |||| Tsp4CI* \ \ \ \\\\\ \ \ \\ \\\\ \ TGGGCTTTGGCGGTTGCTACTGATGGCGGCTTTGTTGTTTCTTCATCCCATGATCACAGT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCGAAACCGCCAACGATGACTACCGCCGAAACAACAAAGAAGTAGGGTACTAGTGTCA / / / ////// / / / /// / / CviJI AciI BccI |||||| FokI BseGI | ||| | Tsp4CI* |||||MboII | ||| BclI ||||TspDTI | ||| MboI |||CviJI | ||DpnI ||BisI | |BstKTI ||AciI | |FatI |BlsI | CviAII TauI NlaIII W A L A V A T D G G F V V S S S H D H S G L W R L L L M A A L L F L H P M I T V G F G G C Y * W R L C C F F I P * S Q Y ----:----|----:----|----:----|----:----|----:----|----:----| Q A K A T A V S P P K T T E E D W S * L K P K P P Q * Q H R S Q Q K K M G H D C P S Q R N S S I A A K N N R * G M I V T SecI* | AsuI* | AvaII | |MboII | |BmgT120I | ||BssKI | ||SexAI | ||EcoRII | ||| ScrFI | ||| BseBI | ||| | SetI TfiI | ||| | | Ksp632I* HinfI MnlI | ||| | | |MnlI MboII \ \ \ \\\ \ \ \\ \ ATAAGAATCTGGGAAGAAACCGAGGACCAGGTATTTTTAGAAGAGGAAAAGGAGAAAGAA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TATTCTTAGACCCTTCTTTGGCTCCTGGTCCATAAAAATCTTCTCCTTTTCCTCTTTCTT / / / //// / / / / HinfI MnlI | |||| | | Ksp632I* MboII TfiI | |||| | MnlI | |||| EcoRII | |||| SexAI | |||| BssKI | |||BseBI | |||ScrFI | ||SetI | |AvaII | |AsuI* | BmgT120I MboII SecI* I R I W E E T E D Q V F L E E E K E K E * E S G K K P R T R Y F * K R K R R K N K N L G R N R G P G I F R R G K G E R T ----:----|----:----|----:----|----:----|----:----|----:----| I L I Q S S V S S W T N K S S S F S F S Y L F R P L F R P G P I K L L P F P S L Y S D P F F G L V L Y K * F L F L L F F MnlI | Tsp4CI* | |BciVI | |Csp6I SfaNI | ||RsaI | MboII | ||| MboII BsrDI Hin4II* | Tsp4CI* \ \\\ \ \ \ \ \ CTTGAAGAACAGTACGAGGATACATTGCTAACTTCTTTGGAAGAAGGAAACGGTGATGAT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTTCTTGTCATGCTCCTATGTAACGATTGAAGAAACCTTCTTCCTTTGCCACTACTA / // /// / / // / | || ||| BsrDI Hin4II* |SfaNI EcoT22I | || ||MboII Tsp4CI* | || |Csp6I MboII | || RsaI | |BciVI | Tsp4CI* MnlI L E E Q Y E D T L L T S L E E G N G D D L K N S T R I H C * L L W K K E T V M M * R T V R G Y I A N F F G R R K R * * C ----:----|----:----|----:----|----:----|----:----|----:----| S S S C Y S S V N S V E K S S P F P S S V Q L V T R P Y M A L K K P L L F R H H K F F L V L I C Q * S R Q F F S V T I I CviRI* | SfaNI | EcoT22I | |HphI | ||MseI | |||AhaIII* | ||||MwoI | ||||| AluI | ||||| CviJI | ||||| | SetI | ||||| | | CviRI* | ||||| | | | EcoT22I BseGI | ||||| | | | |Hin4II* TspDTI | ||||| | | | || SfaNI | BetI* | ||||| | | | || | Hin4I | MboII | ||||| | | | || | Hin4I | |HpaII | ||||| | | | || | | FokI | || SfaNI Hin4I | ||||| | | | || | | | HphI | || |TspDTI Hin4I \ \\\\\ \ \ \ \\ \ \ \ \ \ \\ \\ \ GCATTTAAAGCTGATGCATCGGGTGAAGGCGTTGAAGATGAAGCATCCGGTGTTCATAAA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAAATTTCGACTACGTAGCCCACTTCCGCAACTTCTACTTCGTAGGCCACAAGTATTT / // /// / / / / / / // / / /// // | || ||| | | | | Hin4I | |FokI | | ||| |SfaNI | || ||| | | | | Hin4I | HphI | | ||| Hin4I | || ||| | | | Hin4II* SfaNI | | ||| Hin4I | || ||| | | CviRI* | | ||TspDTI | || ||| | EcoT22I | | |BetI* | || ||| CviJI | | HpaII | || ||| AluI | MboII | || ||SetI TspDTI | || |SfaNI BseGI | || |MseI | || AhaIII* | |MwoI | HphI CviRI* A F K A D A S G E G V E D E A S G V H K H L K L M H R V K A L K M K H P V F I N I * S * C I G * R R * R * S I R C S * T ----:----|----:----|----:----|----:----|----:----|----:----| A N L A S A D P S P T S S S A D P T * L H M * L Q H M P H L R Q L H L M R H E Y C K F S I C R T F A N F I F C G T N M F Hin6I |GlaI ||HhaI BseMII TfiI MnlI |||MaeI |BspCNI HinfI MseI CviJI | HphI |||HaeII || TspEI \ \ \ \ \ \\\\ \\ \ CAGACTTTAGAATCGTTAAAGGCTGGTGAAAGACTTATGGAGGCGCTAGATTTAGGAATT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTGAAATCTTAGCAATTTCCGACCACTTTCTGAATACCTCCGCGATCTAAATCCTTAA / / / / / //// / // / | | CviJI | HphI |||| | |BspCNI TspEI | MseI MnlI |||| | BseMII HinfI |||| MaeI TfiI |||Hin6I ||GlaI |HhaI HaeII Q T L E S L K A G E R L M E A L D L G I R L * N R * R L V K D L W R R * I * E L D F R I V K G W * K T Y G G A R F R N C ----:----|----:----|----:----|----:----|----:----|----:----| C V K S D N F A P S L S I S A S S K P I V S K L I T L P Q H F V * P P A L N L F L S * F R * L S T F S K H L R * I * S N AluI DdeI MnlI CviJI TaqII | Hin4II* | SetI | SetI TspDTI \ \ \ \ \ \ \ GCTGAGATTGAAGGTTTAGAGGCATATAACAGAGATATGAAGCTATGGCAAAGAAAGAAG 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTCTAACTTCCAAATCTCCGTATATTGTCTCTATACTTCGATACCGTTTCTTTCTTC / / / / / / | DdeI SetI | CviJI TspDTI Hin4II* MnlI | AluI TaqII SetI A E I E G L E A Y N R D M K L W Q R K K L R L K V * R H I T E I * S Y G K E R S * D * R F R G I * Q R Y E A M A K K E V ----:----|----:----|----:----|----:----|----:----|----:----| A S I S P K S A Y L L S I F S H C L F F Q Q S Q L N L P M Y C L Y S A I A F F S S L N F T * L C I V S I H L * P L S L L Hin6I |GlaI ||HhaI |||HaeII BseMII |||| HphI MaeIII TspEI |BspCNI \\\\ \ \ \ \\ TTGGGTGAAGCGCCAATAAAACCACAGGGTAACGCTGTTCTAATTGCTGTGAATAAAACT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCACTTCGCGGTTATTTTGGTGTCCCATTGCGACAAGATTAACGACACTTATTTTGA //// / / / // |||| HphI MaeIII TspEI |BspCNI |||Hin6I BseMII ||GlaI |HhaI HaeII L G E A P I K P Q G N A V L I A V N K T W V K R Q * N H R V T L F * L L * I K L G * S A N K T T G * R C S N C C E * N S ----:----|----:----|----:----|----:----|----:----|----:----| N P S A G I F G C P L A T R I A T F L V T P H L A L L V V P Y R Q E L Q Q S Y F Q T F R W Y F W L T V S N * N S H I F S TsoI | BccI Hpy178III* DdeI | BspCNI |DdeI |SfaNI | |CviRI* |Bpu10I BciVI MseI || BsmAI | |BseMII \\ \ \ \\ \ \ \\ CCTGAGCAATATATTATGGATACCCTGTTAAGAATAAGAATGTCTCAGTTAGAAGATGCA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTCGTTATATAATACCTATGGGACAATTCTTATTCTTACAGAGTCAATCTTCTACGT / / / / / / / / // / | | BciVI MseI | | | | || CviRI* | Bpu10I | | | | || BccI | DdeI | | | | |BseMII Hpy178III* | | | | |TspRI | | | | BspCNI | | | TsoI | | BsmAI | SfaNI DdeI P E Q Y I M D T L L R I R M S Q L E D A L S N I L W I P C * E * E C L S * K M H * A I Y Y G Y P V K N K N V S V R R C T ----:----|----:----|----:----|----:----|----:----|----:----| G S C Y I I S V R N L I L I D * N S S A E Q A I Y * P Y G T L F L F T E T L L H R L L I N H I G Q * S Y S H R L * F I C MseI MnlI |AhaIII* MboII ApoI || ApoI Tsp4CI* |TspRI NdeI TspEI || TspEI | CviRI* \\ \ \ \\ \ \ \ CTGATGGTTATGCCATTCTCATATGTCCTCAAATTTTTAAAATTTATTGATACCGTTATG 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| GACTACCAATACGGTAAGAGTATACAGGAGTTTAAAAATTTTAAATAACTATGGCAATAC / / // // / / // MboII NdeI || |MseI TspEI | |CviRI* || | ApoI | BsgI || AhaIII* Tsp4CI* |MnlI TspEI ApoI L M V M P F S Y V L K F L K F I D T V M * W L C H S H M S S N F * N L L I P L C D G Y A I L I C P Q I F K I Y * Y R Y A ----:----|----:----|----:----|----:----|----:----|----:----| S I T I G N E Y T R L N K F N I S V T I V S P * A M R M H G * I K L I * Q Y R * Q H N H W E * I D E F K * F K N I G N H TseI CviRI* |BisI MseI | ApoI BsgI ||BlsI VspI | TspEI |BbvI |||CviRI* |TspEI | TspDTI \\ \\\\ \\ \ \ CAAAACAAAACTTTGCTGCACTCTCACTTACCATTAATTTGCAAGAATTTATTTTTCATT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTGTTTTGAAACGACGTGAGAGTGAATGGTAATTAAACGTTCTTAAATAAAAAGTAA / /// / / / / / BbvI ||CviRI* | | | | TspEI ||TseI | | | | ApoI |BisI | | | TspDTI BlsI | | CviRI* | TspEI VspI MseI Q N K T L L H S H L P L I C K N L F F I K T K L C C T L T Y H * F A R I Y F S L K Q N F A A L S L T I N L Q E F I F H Y ----:----|----:----|----:----|----:----|----:----|----:----| C F L V K S C E * K G N I Q L F K N K M A F C F K A A S E S V M L K C S N I K * L V F S Q Q V R V * W * N A L I * K E N BspCNI |TspEI |BseMII || TspEI ApoI || | MboII TspEI DdeI || | |TspDTI | MseI TspEI | Hpy188I || | ||CviRI* \ \ \ \ \ \\ \ \\\ ATCAAATTTAATCATAAAGAATTGGTTTCTCAGAAAAATGAAGAATTGAAATTGCAAATA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTTAAATTAGTATTTCTTAACCAAAGAGTCTTTTTACTTCTTAACTTTAACGTTTAT / / / // // / / // | MseI TspEI |DdeI || | | |CviRI* TspEI Hpy188I || | | TspEI ApoI || | TspDTI || | MboII || TspEI |BseMII BspCNI I K F N H K E L V S Q K N E E L K L Q I S N L I I K N W F L R K M K N * N C K * Q I * S * R I G F S E K * R I E I A N K ----:----|----:----|----:----|----:----|----:----|----:----| I L N L * L S N T E * F F S S N F N C I * * I * D Y L I P K E S F H L I S I A F D F K I M F F Q N R L F I F F Q F Q L Y MboI | DpnI | |BseGI | |BstKTI | ||MaeI | ||| CviJI TspEI CviRI* | ||| | FokI | MseI | MseI MnlI SecI* | ||| | |MseI \ \ \ \ \ \ \ \\\ \ \\ AATAGAGTAAAGACTGAATTAAGAAGTGCATTAAAATCTACCGAGGATGATCTAGGCTTT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCTCATTTCTGACTTAATTCTTCACGTAATTTTAGATGGCTCCTACTAGATCCGAAA // / / / / // / / / |MseI | | MnlI | || | | CviJI TspEI | MseI | || | MaeI CviRI* | || MboI | |DpnI | BstKTI | BseGI SecI* N R V K T E L R S A L K S T E D D L G F I E * R L N * E V H * N L P R M I * A L * S K D * I K K C I K I Y R G * S R L * ----:----|----:----|----:----|----:----|----:----|----:----| F L T F V S N L L A N F D V S S S R P K L Y L L S Q I L F H M L I * R P H D L S I S Y L S F * S T C * F R G L I I * A K TfiI HinfI |BdaI ApoI BdaI ApoI |BdaI TspEI BdaI TspEI || DdeI EcoRI \ \ \\ \ \ AATGTTCAAGGGTTGAAATTCGTCAAGCAACAATGGAATCTAAGGCATAACTACGAATTC 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAAGTTCCCAACTTTAAGCAGTTCGTTGTTACCTTAGATTCCGTATTGATGCTTAAG // / / / / / |FokI TspEI | | DdeI EcoRI MseI ApoI | HinfI TspEI BdaI | TfiI ApoI BdaI BdaI BdaI N V Q G L K F V K Q Q W N L R H N Y E F M F K G * N S S S N N G I * G I T T N S C S R V E I R Q A T M E S K A * L R I R ----:----|----:----|----:----|----:----|----:----|----:----| L T * P N F N T L C C H F R L C L * S N * H E L T S I R * A V I S D L A Y S R I I N L P Q F E D L L L P I * P M V V F E MboII Hpy178III* | AsuI* | AvaII HindII CviRI* | |NlaIV Hpy166II Ksp632I* | |BmgT120I \ \ \ \\ GTTGACGAATATGACCAACAGGAGAAAGAGAGTAATAGTGCAAGGAAGAGAGTTTTCGGG 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTGCTTATACTGGTTGTCCTCTTTCTCTCATTATCACGTTCCTTCTCTCAAAAGCCC / / / / // Hpy166II | Ksp632I* | |NlaIV HindII CviRI* | Hpy178III* MboII V D E Y D Q Q E K E S N S A R K R V F G L T N M T N R R K R V I V Q G R E F S G * R I * P T G E R E * * C K E E S F R D ----:----|----:----|----:----|----:----|----:----|----:----| T S S Y S W C S F S L L L A L F L T K P R Q R I H G V P S L S Y Y H L S S L K R N V F I V L L L F L T I T C P L S N E P Tsp4CI* \ ACCGTTATATAA 2830 ----:----|-- TGGCAATATATT // |Tsp4CI* |AvaII |AsuI* BmgT120I T V I * P L Y X R Y I X ----:----|-- V T I Y S R * I G N Y L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AciI 4 BspACI,SsiI AclI 2 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 4 DraI AjuI 1 AlfI 2 AluI 7 AluBI ApoI 12 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 4 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 12 Bce83I* 3 BpuEI BcgI 1 BciVI 4 BfuI BclI 4 FbaI,Ksp22I BdaI 4 BetI* 3 BsaWI BfiI 1 BmrI,BmuI BglI 1 BglII 1 BinI* 2 AlwI,BspPI,AclWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmeT110I 1 BmgT120I 5 Bpu10I 1 BsaBI 1 Bse8I,BseJI BseBI 5 Bst2UI,BstNI,BstOI,MvaI BseGI 10 BstF5I,BtsCI BseMII 5 BseRI 2 BseSI 1 BaeGI,BstSLI BsgI 2 BslFI 2 BsmFI,FaqI BsmAI 6 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 5 BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 1 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BstAPI 2 BstKTI 11 BtsI 2 Cac8I 2 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 7 CviQI,RsaNI CviAII 4 CviJI 24 CviKI-1 CviRI* 18 HpyCH4V DdeI 10 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 11 MalI DraII 2 EcoO109I Eco31I 2 Bso31I,BspTNI,BsaI Eco57MI 2 EcoRI 1 EcoRII 5 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 4 Mph1103I,NsiI,Zsp2I FalI 4 FatI 4 FokI 10 GlaI 5 GsuI 2 BpmI HaeII 3 BstH2I HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HhaI 5 BstHHI,CfoI,AspLEI Hin4I 8 Hin4II* 4 HpyAV Hin6I 5 HinP1I,HspAI HindII 2 HincII HinfI 9 HpaII 4 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 9 KasI 1 KpnI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 8 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 7 MboI 11 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 17 MfeI 2 MunI MlyI 2 SchI MmeI 1 MnlI 19 MseI 23 Tru1I,Tru9I MslI 2 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 8 HpyF10VI,BstMWI NarI 1 Mly113I NdeI 2 FauNDI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 1 MspA1I PleI 2 PpsI PpuMI 1 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PsiI 1 AanI PvuII 1 RsaI 7 AfaI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 26 SexAI 1 MabI SfaNI 13 LweI SmlI 4 SmoI SpeI 1 BcuI,AhlI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 7 TaqII 1 TatI 2 TauI 2 TfiI 7 PfeI TseI 4 ApeKI TsoI 2 Tsp45I 4 NmuCI Tsp4CI* 12 HpyCH4III,TaaI,Bst4CI TspDTI 12 TspEI 31 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 4 TscAI TstI 1 VspI 2 PshBI,AseI XcmI 2 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AccI AflII AflIII AgeI AloI AlwNI ApaI ApaLI AscI AvrII BalI BamHI BarI BbvCI BceAI BmtI BplI BsaAI BsaXI BsePI BseYI BsiI* BsiYI* Bsp120I BspHI BspLU11I* BspOI BsrBI BssNAI Bst1107I BstEII BstXI BstZ17I BtgZI BtrI Cfr10I Cfr9I CfrI CspCI DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III Eco57I EcoICRI EcoNI EcoP15I Esp3I EspI* FauI FnuDII* FseI FspAI GsaI HgiJII* HindIII HpaI Hpy99I MauBI McrI* MluI MroNI NaeI NcoI NgoMIV NheI NotI NruI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SfeI* SfiI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI Tth111I XbaI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769