Restriction Map of YLR120W-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YLR120W-A on chromosome XII from coordinates 388672 to 388773.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.26724

Hpy178III* | MnlI | | Hin6I | | FnuDII* | | |GlaI | | |Hin4II* | | ||HhaI \ \ \\\ ATGCTTTTCCTCTTGAAATCGCGCAAAGAAGGAAAGGAAAAAGTGTCTATATATAGTGTC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGAAAAGGAGAACTTTAGCGCGTTTCTTCCTTTCCTTTTTCACAGATATATATCACAG / / /// | | ||Hin6I | | |GlaI | | FnuDII* | | Hin4II* | | HhaI | MnlI Hpy178III* M L F L L K S R K E G K E K V S I Y S V C F S S * N R A K K E R K K C L Y I V S A F P L E I A Q R R K G K S V Y I * C L ----:----|----:----|----:----|----:----|----:----|----:----| X S K R K F D R L S P F S F T D I Y L T X A K G R S I A C L L F P F L T * I Y H H K E E Q F R A F F S L F F H R Y I T D BseGI | TspGWI \ \ TATTGTTTTTTTTTACGAAAAGAAAACGGAAAGGATGAGTAA 70 80 90 100 ----:----|----:----|----:----|----:----|-- ATAACAAAAAAAAATGCTTTTCTTTTGCCTTTCCTACTCATT / / | TspGWI BseGI Y C F F L R K E N G K D E * I V F F Y E K K T E R M S X L F F F T K R K R K G * V X ----:----|----:----|----:----|----:----|-- * Q K K K R F S F P F S S Y R N N K K V F L F R F P H T I T K K * S F F V S L I L L # Enzymes that cut Frequency Isoschizomers BseGI 1 BstF5I,BtsCI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII GlaI 1 HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI Hpy178III* 1 Hpy188III MnlI 1 TspGWI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AluI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BisI BlsI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviAII CviJI CviQI CviRI* DdeI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FatI FauI Fnu4HI FokI FseI FspAI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* Hin4I HindII HindIII HinfI HpaI HpaII HphI Hpy166II Hpy188I Hpy8I Hpy99I KasI KpnI Ksp632I* MaeI MaeII MaeIII MauBI MboI MboII McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MseI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SecI* SetI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaiI TaqI TaqII TatI TauI TfiI TseI TsoI Tsp45I Tsp4CI* TspDTI TspEI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769