Restriction Map of ALT1/YLR089C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

ALT1/YLR089C on chromosome XII from coordinates 320015 to 318237.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 Tsp4CI* MaeII AjuI | TspRI | SetI |Tsp4CI* | |TspEI | TaiI || TspRI | || AjuI | | MseI \\ \ \ \\ \ \ \ \ ATGTTATCACTGTCTGCCAAAAATCACTTCACAGTGAGTAATTCTATAACTCACGTTATT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAATAGTGACAGACGGTTTTTAGTGAAGTGTCACTCATTAAGATATTGAGTGCAATAA / / / / / / / / | Tsp4CI* | | AjuI TspEI | MaeII TspRI | Tsp4CI* TaiI AjuI TspRI SetI M L S L S A K N H F T V S N S I T H V I C Y H C L P K I T S Q * V I L * L T L L V I T V C Q K S L H S E * F Y N S R Y * ----:----|----:----|----:----|----:----|----:----|----:----| X N D S D A L F * K V T L L E I V * T I X T I V T Q W F D S * L S Y N * L E R * H * * Q R G F I V E C H T I R Y S V N N Hin6I MlyI |GlaI PleI HinfI ||HhaI \ \ \\\ AAGTCATATCATATAAGGACTCTCACTTCAAGCGCAGAAAAAATGCCACATATCACTACT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGTATAGTATATTCCTGAGAGTGAAGTTCGCGTCTTTTTTACGGTGTATAGTGATGA / // / /// MseI |PleI HinfI ||Hin6I MlyI |GlaI HhaI K S Y H I R T L T S S A E K M P H I T T S H I I * G L S L Q A Q K K C H I S L L V I S Y K D S H F K R R K N A T Y H Y S ----:----|----:----|----:----|----:----|----:----|----:----| L D Y * I L V R V E L A S F I G C I V V * T M D Y L S E * K L R L F F A V Y * * L * I M Y P S E S * A C F F H W M D S S DdeI BbvCI Bpu10I |SetI || CviJI || |BsrI || || MnlI || || |TatI || || ||Csp6I || || |||RsaI || || ||||BspCNI || || |||||BseMII || || |||||| MseI || || |||||| | HindIII || || |||||| | | AluI || || |||||| | | CviJI || || |||||| | | | SetI || || |||||| | | | | Hpy178III* BsmAI \\ \\ \\\\\\ \ \ \ \ \ \ CCTTTTTCTACCTCAGCCAGTAGTACAAAGTTAAAAGCTTTCAGGAAAGTTAGACCCGTC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAAAAGATGGAGTCGGTCATCATGTTTCAATTTTCGAAAGTCCTTTCAATCTGGGCAG / // / //// / / / / / SetI || | |||TatI | | | | Hpy178III* || | ||Csp6I | | | HindIII || | |BseMII | | CviJI || | |RsaI | | AluI || | BspCNI | SetI || MnlI MseI |CviJI Bpu10I BbvCI DdeI BsrI P F S T S A S S T K L K A F R K V R P V L F L P Q P V V Q S * K L S G K L D P S F F Y L S Q * Y K V K S F Q E S * T R P ----:----|----:----|----:----|----:----|----:----|----:----| G K E V E A L L V F N F A K L F T L G T E K K * R L W Y Y L T L L K * S L * V R R K R G * G T T C L * F S E P F N S G D AluI CviJI |Hin4I ||SetI ||| PfoI ||| BssKI ||| EcoRII ||| | SapI MaeII ||| | ScrFI | Hin4I ||| | BseBI | |SetI SfeI* MboII ||| | Ksp632I* TspDTI | |TaiI MboII \ \ \\\ \ \ \ \ \\ \ CTACAGAGACATAGCTCTTCCTGGATTGTTGCTCAAAATCATAGACGTTCATTATCTGGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GATGTCTCTGTATCGAGAAGGACCTAACAACGAGTTTTAGTATCTGCAAGTAATAGACCA // / / / / / / / / / / / || | | | CviJI | Ksp632I* | | | MaeII MboII || | | | AluI | EcoRII | | TaiI || | | SetI | BssKI | | SetI || | Hin4I | SapI | Hin4I || MboII | PfoI TspDTI |SfeI* BseBI BsmAI ScrFI L Q R H S S S W I V A Q N H R R S L S G Y R D I A L P G L L L K I I D V H Y L V T E T * L F L D C C S K S * T F I I W S ----:----|----:----|----:----|----:----|----:----|----:----| R C L C L E E Q I T A * F * L R E N D P G V S V Y S K R S Q Q E F D Y V N M I Q * L S M A R G P N N S L I M S T * * R T AflIII BspMI | MaeII SetI | TfiI | | SetI HgaI PshAI | HinfI | | TaiI \ \ \ \ \ \ \ CAATCTTCGCTAAACGACCTGCGTCATTTGAATCGCTTTCCACACCACACGTTGAAAACT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAGAAGCGATTTGCTGGACGCAGTAAACTTAGCGAAAGGTGTGGTGTGCAACTTTTGA // / / / / / || PshAI | HinfI | AflIII |SetI | TfiI | MaeII HgaI BspMI TaiI SetI Q S S L N D L R H L N R F P H H T L K T N L R * T T C V I * I A F H T T R * K L I F A K R P A S F E S L S T P H V E N F ----:----|----:----|----:----|----:----|----:----|----:----| * D E S F S R R * K F R K G C W V N F V D I K A L R G A D N S D S E V G C T S F L R R * V V Q T M Q I A K W V V R Q F S MaeII | SetI | TaiI | BbvII* | | MboII FauI | | | BarI TaqI |MfeI | | | | Hin4II* AsuII AciI |TspEI | | | | | Hpy178III* \ \ \\ \ \ \ \ \ \ TCGAATAACGAGTTTTATCCCGCCGAACAATTGACTTTGGAAGACGTAAATGAAAATGTC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTTATTGCTCAAAATAGGGCGGCTTGTTAACTGAAACCTTCTGCATTTACTTTTACAG / / / / / / // / AsuII AciI | TspEI | | || Hin4II* TaqI | MfeI | | |BbvII* FauI | | |MboII | | BarI | MaeII TaiI SetI S N N E F Y P A E Q L T L E D V N E N V R I T S F I P P N N * L W K T * M K M S E * R V L S R R T I D F G R R K * K C L ----:----|----:----|----:----|----:----|----:----|----:----| E F L S N * G A S C N V K S S T F S F T K S Y R T K D R R V I S K P L R L H F H R I V L K I G G F L Q S Q F V Y I F I D BceAI | TspDTI | | CviJI | | |DdeI HgiCI* | | || Csp6I | SetI | | || |RsaI | BarI AluI | | || |MwoI | NlaIV CviJI AluI | | || ||Hin4I | | BseGI | SetI CviJI | | || ||| FokI | | | MslI | |Hin4I MboII | | || ||| MnlI | | | | BccI | || TspEI | SetI \ \ \\ \\\ \ \ \ \ \ \ \ \\ \ \ \ TTGAAGGCTAAGTACGCCGTTAGAGGTGCCATCCCAATGAGAGCTGAAGAATTGAAAGCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTCCGATTCATGCGGCAATCTCCACGGTAGGGTTACTCTCGACTTCTTAACTTTCGA // / /// /// / // / / / / / / / //// || | ||| ||MnlI | || | | | | | CviJI | |||Hin4I || | ||| |Csp6I | || | | | | | AluI | |||Hin4I || | ||| RsaI | || | | | | Hin4I | ||CviJI || | ||DdeI | || | | | | SetI | ||AluI || | |MwoI | || | | | BccI | |MboII || | Hin4I | || | | MslI | SetI || CviJI | || | HgiCI* TspEI |TspDTI | || NlaIV |BceAI | || BseGI Hpy178III* | |SetI | BarI FokI L K A K Y A V R G A I P M R A E E L K A * R L S T P L E V P S Q * E L K N * K L E G * V R R * R C H P N E S * R I E S S ----:----|----:----|----:----|----:----|----:----|----:----| K F A L Y A T L P A M G I L A S S N F A R S P * T R R * L H W G L S L Q L I S L Q L S L V G N S T G D W H S S F F Q F S Hin4II* |Hin4I |Hin4I ||Eco57I ||Eco57MI ||| BinI* ||| |BsrI ||| || MboI ||| || BamHI ||| || XhoII ||| || | DpnI ||| || | NlaIV ||| || | |BstKTI ||| || | || BinI* ||| || | || | GsuI ||| || | || | Eco57MI Hin4I ||| || | || | |MnlI Hin4I SspI \\\ \\ \ \\ \ \\ \ \ CAACTGGAGAAGGATCCTCAATCTCTGCCATTTGACAGGATTATCAACGCCAATATTGGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGACCTCTTCCTAGGAGTTAGAGACGGTAAACTGTCCTAATAGTTGCGGTTATAACCA // / / // / / / / / / || | | || | | | MnlI Hin4I SspI || | | || | | Eco57MI Hin4I || | | || | | GsuI || | | || | BinI* || | | || XhoII || | | || BamHI || | | || MboI || | | |NlaIV || | | |DpnI || | | BstKTI || | BinI* || BsrI |Eco57MI |Eco57I Hin4II* Q L E K D P Q S L P F D R I I N A N I G N W R R I L N L C H L T G L S T P I L V T G E G S S I S A I * Q D Y Q R Q Y W * ----:----|----:----|----:----|----:----|----:----|----:----| * S S F S G * D R G N S L I I L A L I P E V P S P D E I E A M Q C S * * R W Y Q L Q L L I R L R Q W K V P N D V G I N T SetI DdeI MnlI | Hpy188I BbvCI | BspCNI | | MnlI Bpu10I | |BseMII | | |SfeI* SetI BsmAI \ \ \\ \ \ \\ \ \ AATCCTCAGCAACTACAACAGAAACCTCTGACTTACTACAGACAGGTCTTGTCTCTCTTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGGAGTCGTTGATGTTGTCTTTGGAGACTGAATGATGTCTGTCCAGAACAGAGAGAAT / / // / / / / / / | | || SetI | MnlI | SetI BsmAI | | |BseMII Hpy188I SfeI* | | BspCNI | MnlI Bpu10I BbvCI DdeI N P Q Q L Q Q K P L T Y Y R Q V L S L L I L S N Y N R N L * L T T D R S C L S Y S S A T T T E T S D L L Q T G L V S L T ----:----|----:----|----:----|----:----|----:----|----:----| L G * C S C C F G R V * * L C T K D R K Y D E A V V V S V E S K S C V P R T E R I R L L * L L F R Q S V V S L D Q R E * TfiI HinfI | BbvI TseI | |TaqI |BisI | |AsuII ||BlsI | || TspEI |||AluI | || | SfaNI |||CviJI | || | | MseI ||||MaeI | || | | |PmeI MseI |||||SetI | || | | |AhaIII* \ \\\\\\ \ \\ \ \ \\ CAATACCCAGAACTATTAAACCAAAACGAACAGCAGCTAGTTGATTCGAAATTGTTTAAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTTATGGGTCTTGATAATTTGGTTTTGCTTGTCGTCGATCAACTAAGCTTTAACAAATTT / /// / / // / // MseI ||| MaeI | || | |SfaNI ||CviJI | || | |MseI ||TseI | || | AhaIII* ||AluI | || | PmeI |BisI | || TspEI BlsI | |BbvI SetI | AsuII | TaqI HinfI TfiI Q Y P E L L N Q N E Q Q L V D S K L F K N T Q N Y * T K T N S S * L I R N C L N I P R T I K P K R T A A S * F E I V * T ----:----|----:----|----:----|----:----|----:----|----:----| C Y G S S N F W F S C C S T S E F N N L V I G L V I L G F R V A A L Q N S I T * L V W F * * V L V F L L * N I R F Q K F MseI | MaeII | | SetI MboII MaeI | | TaiI Bce83I* EcoP15I | | |CviRI* MseI EcoRV MboII | MboII \ \ \ \\ \ \ \ \ \ CTAGATGCCATTAAACGTGCAAAGAGTTTAATGGAAGATATCGGTGGTTCTGTTGGTGCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GATCTACGGTAATTTGCACGTTTCTCAAATTACCTTCTATAGCCACCAAGACAACCACGA / // / / / / / // / EcoP15I || | CviRI* MseI EcoRV MboII || MboII MaeI || MaeII |MboII |TaiI Bce83I* |SetI MseI L D A I K R A K S L M E D I G G S V G A * M P L N V Q R V * W K I S V V L L V L R C H * T C K E F N G R Y R W F C W C L ----:----|----:----|----:----|----:----|----:----|----:----| S S A M L R A F L K I S S I P P E T P A V L H W * V H L S N L P L Y R H N Q Q H * I G N F T C L T * H F I D T T R N T S Ksp632I* PsiI | Hin4II* ApoI Ksp632I* | SmlI | SetI SetI TspEI |MnlI \ \ \ \ \ \ \\ TACTCTTCTTCTCAAGGTGTAGAAGGTATAAGGAAAAGTGTCGCTGAATTTATAACGAAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAGAAGAAGAGTTCCACATCTTCCATATTCCTTTTCACAGCGACTTAAATATTGCTTC / // / / / / / | |Hin4II* SetI | | | Hin4II* | |SmlI | | Ksp632I* | SetI | PsiI Ksp632I* | MnlI TspEI ApoI Y S S S Q G V E G I R K S V A E F I T K T L L L K V * K V * G K V S L N L * R R L F F S R C R R Y K E K C R * I Y N E E ----:----|----:----|----:----|----:----|----:----|----:----| * E E E * P T S P I L F L T A S N I V F K S K K E L H L L Y L S F H R Q I * L S V R R R L T Y F T Y P F T D S F K Y R L BseGI CviRI* | AciI BslFI | | TseI EcoP15I | | MwoI |EcoRV | | |BisI Hin4II* MboII || MnlI FokI | | ||BlsI \ \ \\ \ \ \ \ \\\ AGGGACGAAGGCGAGATATCATACCCAGAGGATATTTTCCTAACTGCTGGTGCATCCGCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCTGCTTCCGCTCTATAGTATGGGTCTCCTATAAAAGGATTGACGACCACGTAGGCGT / // / / / / / /// MboII || BslFI FokI | | | ||BisI || MnlI | | | |BlsI |EcoP15I | | | |SetI EcoRV | | | AciI | | MwoI | CviRI* BseGI R D E G E I S Y P E D I F L T A G A S A G T K A R Y H T Q R I F S * L L V H P Q G R R R D I I P R G Y F P N C W C I R S ----:----|----:----|----:----|----:----|----:----|----:----| L S S P S I D Y G S S I K R V A P A D A S P R L R S I M G L P Y K G L Q Q H M R P V F A L Y * V W L I N E * S S T C G C AluI CviJI PvuII SfaNI NspBII* AsuI* Hpy178III* | SetI TspEI |BmgT120I | TfiI | | TspEI | MnlI ||CviJI | HinfI | | | BbvI | | SfeI* ||HaeIII BsiYI* | | TspEI \ \ \ \ \ \ \ \\\ \ \ \ \ GCTGTCAATTACTTGTTATCAATTTTCTGTAGAGGGCCAGAAACGGGTGTCTTGATTCCA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CGACAGTTAATGAACAATAGTTAAAAGACATCTCCCGGTCTTTGCCCACAGAACTAAGGT / / / / / / // / / / | | | BbvI TspEI | || BsiYI* | HinfI | | TspEI MnlI | |AsuI* | TfiI | SfaNI | BmgT120I Hpy178III* NspBII* | HaeIII PvuII | CviJI CviJI SfeI* TseI AluI A V N Y L L S I F C R G P E T G V L I P L S I T C Y Q F S V E G Q K R V S * F Q C Q L L V I N F L * R A R N G C L D S N ----:----|----:----|----:----|----:----|----:----|----:----| A T L * K N D I K Q L P G S V P T K I G L Q * N S T I L K R Y L A L F P H R S E S D I V Q * * N E T S P W F R T D Q N W MaeI TspEI MwoI | SmlI |Bce83I* | | HindIII || AluI | | | AluI || CviJI | | | CviJI MnlI AciI || | SetI | | | | SetI \ \ \\ \ \ \ \ \ \ \ ATTCCTCAATATCCATTATATACCGCTACTCTAGCTTTGAACAATTCTCAAGCTTTACCA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGAGTTATAGGTAATATATGGCGATGAGATCGAAACTTGTTAAGAGTTCGAAATGGT / / / / / /// / /// / TspEI MnlI | | | ||CviJI | ||| HindIII | | | ||AluI | ||CviJI | | | |MaeI | ||AluI | | | SetI | |SmlI | | Bce83I* | SetI | MwoI TspEI AciI I P Q Y P L Y T A T L A L N N S Q A L P F L N I H Y I P L L * L * T I L K L Y H S S I S I I Y R Y S S F E Q F S S F T I ----:----|----:----|----:----|----:----|----:----|----:----| I G * Y G N Y V A V R A K F L E * A K G L E E I D M I Y R * E L K S C N E L K V N R L I W * I G S S * S Q V I R L S * W HindII ApoI Hpy166II MboII TspEI | Hpy178III* | Tsp4CI* EcoRI SetI | | TspEI | | MnlI \ \ \ \ \ \ \ \ TACTATTTAGATGAGAATTCAGGTTGGTCAACTAATCCAGAAGAAATTGAAACTGTCGTC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATGATAAATCTACTCTTAAGTCCAACCAGTTGATTAGGTCTTCTTTAACTTTGACAGCAG // / / / / / / |SetI Hpy166II | | | | MnlI EcoRI HindII | | | Tsp4CI* TspEI | | MboII ApoI | TspEI Hpy178III* Y Y L D E N S G W S T N P E E I E T V V T I * M R I Q V G Q L I Q K K L K L S S L F R * E F R L V N * S R R N * N C R Q ----:----|----:----|----:----|----:----|----:----|----:----| Y * K S S F E P Q D V L G S S I S V T T M S N L H S N L N T L * D L L F Q F Q R V I * I L I * T P * S I W F F N F S D D SfeI* BssKI |SetI EcoRII ||TsoI | ScrFI ||| Tsp4CI* | BseBI CviJI ||| | MaeI | | SetI \ \\\ \ \ \ \ \ AAAGAGGCTATACAGAACGAAATCAAACCTACAGTTCTAGTGGTTATCAATCCAGGTAAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTCCGATATGTCTTGCTTTAGTTTGGATGTCAAGATCACCAATAGTTAGGTCCATTA / / / // / // / CviJI | | |SfeI* MaeI || EcoRII | | Tsp4CI* || BssKI | TsoI |BseBI SetI |ScrFI SetI K E A I Q N E I K P T V L V V I N P G N K R L Y R T K S N L Q F * W L S I Q V I R G Y T E R N Q T Y S S S G Y Q S R * S ----:----|----:----|----:----|----:----|----:----|----:----| L S A I C F S I L G V T R T T I L G P L * L P * V S R F * V * L E L P * * D L Y F L S Y L V F D F R C N * H N D I W T I DdeI |SetI ||HinfI ||| SfeI* BspCNI AluI ||| | PleI |BseMII CviJI ||| | |AluI || TseI AlwNI ||| | |MlyI || |BisI |HphI ||| | |CviJI || ||BlsI ||SetI ||| | ||DdeI || |||CviJI ||| BseMII ||| | |||SetI || ||||BaeI SfeI* ||| |BspCNI ||| | |||| Hpy188I || ||||| Csp6I \ \\\ \\ \\\ \ \\\\ \ \\ \\\\\ \ CCTACAGGAGCTGTCCTATCACCTGAGTCTATAGCTCAGATTTTTGAAGTCGCAGCCAAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GGATGTCCTCGACAGGATAGTGGACTCAGATATCGAGTCTAAAAACTTCAGCGTCGGTTC /// / // / / / /// // // / /// ||| | |BspCNI SetI | | ||| |DdeI || | ||CviJI ||| | BseMII | | ||| Hpy188I || | ||TseI ||| CviJI | | ||CviJI || | |BisI ||| AluI | | ||PleI || | BlsI ||| HphI | | ||MlyI || BaeI ||SetI | | ||AluI |BseMII |AlwNI | | |SfeI* BspCNI SfeI* | | SetI | HinfI DdeI P T G A V L S P E S I A Q I F E V A A K L Q E L S Y H L S L * L R F L K S Q P S Y R S C P I T * V Y S S D F * S R S Q V ----:----|----:----|----:----|----:----|----:----|----:----| G V P A T R D G S D I A * I K S T A A L D * L L Q G I V Q T * L E S K Q L R L W R C S S D * * R L R Y S L N K F D C G L BssKI |AvaI |BssKI |SecI* |Cfr9I ||HpaII ||ScrFI ||CauII* ||BmeT110I |||SmaI RsaI |||ScrFI | BbvI |||CauII* | Tsp4CI* |||| HgiCI* | |Csp6I AluI |||| | NlaIV | ||RsaI CviJI Hpy178III* |||| | |SduI | ||| Tsp4CI* | SetI BaeI | MboII |||| | |BseSI \ \\\ \ \ \ \ \ \ \\\\ \ \\ TACGGTACAGTAGTGATAGCTGACGAAGTTTATCAAGAAAATATCTTCCCGGGCACCAAG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCCATGTCATCACTATCGACTGCTTCAAATAGTTCTTTTATAGAAGGGCCCGTGGTTC /// /// / / / // ///// / ||| ||Tsp4CI* | | BaeI |Hpy178III* ||||| HgiCI* ||| ||BbvI | CviJI MboII ||||NlaIV ||| |Csp6I | AluI |||BssKI ||| RsaI SetI ||Cfr9I ||Tsp4CI* ||BssKI |Csp6I ||SecI* RsaI ||AvaI |BmeT110I |CauII* |HpaII |ScrFI |BseSI |SduI CauII* ScrFI SmaI Y G T V V I A D E V Y Q E N I F P G T K T V Q * * * L T K F I K K I S S R A P S R Y S S D S * R S L S R K Y L P G H Q V ----:----|----:----|----:----|----:----|----:----|----:----| Y P V T T I A S S T * * S F I K G P V L T R Y L L S L Q R L K D L F Y R G P C W V T C Y H Y S V F N I L F I D E R A G L BseGI | BssKI | EcoRII | | ScrFI | | BseBI MboII | | | SetI |TspDTI | | | |ApoI ApoI || Hin4I | | | |TspEI TspEI || | FokI | | | || TaqI |BsmAI || | MnlI | | | || | Hin4I \\ \\ \ \ \ \ \ \\ \ \ TTCCATTCTATGAAGAAAATTTTGAGACATTTACAGAGGGAACATCCAGGTAAATTCGAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTAAGATACTTCTTTTAAAACTCTGTAAATGTCTCCCTTGTAGGTCCATTTAAGCTA /// / / / // / / / / ||| MnlI FokI BseGI || | | | TaqI ||TspDTI || | | TspEI ||MboII || | | ApoI |BsmAI || | Hin4I |Hin4I || EcoRII TspEI || BssKI ApoI |BseBI |ScrFI SetI F H S M K K I L R H L Q R E H P G K F D S I L * R K F * D I Y R G N I Q V N S I P F Y E E N F E T F T E G T S R * I R * ----:----|----:----|----:----|----:----|----:----|----:----| N W E I F F I K L C K C L S C G P L N S T G N * S S F K S V N V S P V D L Y I R E M R H L F N Q S M * L P F M W T F E I NheI AluI CviJI |MaeI ||SetI ||Cac8I ||| AluI ||| BmtI BsmI ||| CviJI CviRI* BdaI TsoI ||| | SetI | TaqI DdeI BdaI | HphI \\\ \ \ \ \ \ \ \ \ AATGTTCAGCTAGCTTCTTTGCATTCGACTTCTAAGGGTGTTTCTGGTGAATGTGGTCAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAAGTCGATCGAAGAAACGTAAGCTGAAGATTCCCACAAAGACCACTTACACCAGTT / / /// / / / / / / | | ||CviJI | | TaqI DdeI | HphI | | ||NheI | CviRI* BdaI TsoI | | ||AluI BsmI BdaI | | |MaeI | | Cac8I | | SetI | CviJI | AluI | BmtI SetI N V Q L A S L H S T S K G V S G E C G Q M F S * L L C I R L L R V F L V N V V K C S A S F F A F D F * G C F W * M W S K ----:----|----:----|----:----|----:----|----:----|----:----| L T * S A E K C E V E L P T E P S H P * Y H E A L K K A N S K * P H K Q H I H D I N L * S R Q M R S R L T N R T F T T L TfiI HinfI |BsrI |TspRI || CviJI CviJI || |FatI | FatI || ||CviAII | BdaI || |||Hin4I | BdaI || |||Hin4I | |CviAII || ||||BsmAI | || NlaIII || |||||NlaIII Hpy178III* \ \\ \ \\ \\\\\\ \ AGGGGTGGCTACATGGAACTCACTGGATTCAGCCATGAGATGAGACAAGTTATCTTGAAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCCACCGATGTACCTTGAGTGACCTAAGTCGGTACTCTACTCTGTTCAATAGAACTTT // / // / / // // // / / / || | || TspRI | || || || BsmAI | TspDTI || | |FatI | || || |FatI Hpy178III* || | CviAII | || || CviAII || NlaIII | || |NlaIII |BdaI | || CviJI |BdaI | |Hin4I CviJI | |Hin4I | HinfI | TfiI BsrI R G G Y M E L T G F S H E M R Q V I L K G V A T W N S L D S A M R * D K L S * N G W L H G T H W I Q P * D E T S Y L E T ----:----|----:----|----:----|----:----|----:----|----:----| L P P * M S S V P N L W S I L C T I K F F P H S C P V * Q I * G H S S V L * R S P T A V H F E S S E A M L H S L N D Q F SetI MaeI | HindIII |TspDTI | | AluI || CviJI | | CviJI || |BslFI | | | SetI || || TaqI | | | | Hin4I || || Hin4I MaeIII | | | | Hin4I || || Hin4I MnlI Tsp45I | | | | | BccI \\ \\ \ \ \ \ \ \ \ \ \ CTAGCCTCGATTTCATTGTGTCCCGTTGTCACAGGTCAAGCTTTGGTTGATTTGATGGTT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GATCGGAGCTAAAGTAACACAGGGCAACAGTGTCCAGTTCGAAACCAACTAAACTACCAA /// / / / / / / / ||| | MnlI | | | | BccI ||| BslFI | | | HindIII ||| TaqI | | CviJI ||CviJI | | Hin4I |MaeI | | Hin4I Hin4I | | AluI Hin4I | SetI Tsp45I MaeIII SetI L A S I S L C P V V T G Q A L V D L M V * P R F H C V P L S Q V K L W L I * W F S L D F I V S R C H R S S F G * F D G S ----:----|----:----|----:----|----:----|----:----|----:----| S A E I E N H G T T V P * A K T S K I T V L R S K M T D R Q * L D L K P Q N S P * G R N * Q T G N D C T L S Q N I Q H N Hpy166II | BsrI | Hin4II* TaqI | | MnlI | HinfI | | |BsiYI* | | AsuI* | | ||MmeI | | AvaII | | ||TspRI | | Hpy188I | | ||| Hin4I | | |BmgT120I MaeII | | ||| Hin4I | | || PleI |MaeIII | | ||| | TfiI | | || |MlyI || SetI BseGI | | ||| | HinfI | | || || FokI || TaiI | FatI \ \ \\\ \ \ \ \ \\ \\ \ \\ \ \ \ CGTCCACCAGTGGAAGGGGAGGAATCATTCGAGTCGGACCAAGCAGAACGTAACTCCATC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGGTGGTCACCTTCCCCTCCTTAGTAAGCTCAGCCTGGTTCGTCTTGCATTGAGGTAG /// /// / / // /// / / / / ||| ||Hin4I HinfI | || ||PleI | | | NlaIII ||| ||Hin4I TfiI | || ||MlyI | | MaeIII ||| ||MmeI | || |AvaII | | BseGI ||| |MnlI | || |AsuI* | MaeII ||| BsiYI* | || BmgT120I TaiI ||Hin4II* | |Hpy188I SetI |TspRI | HinfI FokI |BsrI TaqI Hpy166II R P P V E G E E S F E S D Q A E R N S I V H Q W K G R N H S S R T K Q N V T P S S T S G R G G I I R V G P S R T * L H P ----:----|----:----|----:----|----:----|----:----|----:----| R G G T S P S S D N S D S W A S R L E M E D V L P L P P I M R T P G L L V Y S W T W W H F P L F * E L R V L C F T V G D CviAII | BccI BsrDI | NlaIII | BsmAI | | MseI | |Tsp4CI* | | |TspEI TspDTI | || TspRI MseI Hin4II* \ \ \\ \ \ \\ \ \ \ CATGAAAAGTTAATTACAAGAGCAATGACACTGTATGAGACATTTAACTCTTTAGAAGGC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GTACTTTTCAATTAATGTTCTCGTTACTGTGACATACTCTGTAAATTGAGAAATCTTCCG /// / / // / / / / / ||BccI | TspDTI || | BsmAI | Hin4II* Bce83I* |FatI | TspEI || Tsp4CI* MseI CviAII MseI |BsrDI TspRI H E K L I T R A M T L Y E T F N S L E G M K S * L Q E Q * H C M R H L T L * K A * K V N Y K S N D T V * D I * L F R R H ----:----|----:----|----:----|----:----|----:----|----:----| W S F N I V L A I V S Y S V N L E K S P G H F T L * L L L S V T H S M * S K L L M F L * N C S C H C Q I L C K V R * F A HgiCI* | SetI | NlaIV | | FatI | | MnlI | | |CviAII | | || NlaIII CviJI | | || | FalI Bce83I* | SmlI | | || | FalI DdeI SetI \ \ \ \ \ \\ \ \ \ \ ATTGAATGTCAAAAGCCTCAAGGTGCCATGTATTTATTCCCTAAGATAGACTTACCTTTC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTTACAGTTTTCGGAGTTCCACGGTACATAAATAAGGGATTCTATCTGAATGGAAAG / // /// // / / | || ||| |FatI DdeI SetI | || ||| CviAII | || ||| FalI | || ||| FalI | || ||HgiCI* | || ||NlaIII | || |MnlI | || NlaIV | |SmlI | SetI CviJI I E C Q K P Q G A M Y L F P K I D L P F L N V K S L K V P C I Y S L R * T Y L S * M S K A S R C H V F I P * D R L T F Q ----:----|----:----|----:----|----:----|----:----|----:----| M S H * F G * P A M Y K N G L I S K G K C Q I D F A E L H W T N I G * S L S V K N F T L L R L T G H I * E R L Y V * R E MseI |HpaI |HindII |Hpy166II FalI || BetI* FalI || BspMII* | Hpy178III* || |HpaII | | AluI || |Hpy178III* | | CviJI || || ApoI | | | SetI || || TspEI FokI | | | Cac8I DdeI || || | BseGI | TspDTI \ \ \ \ \ \\ \\ \ \ \ \ AAGGCAGTTCAAGAAGCTCGCCACTTAGAGTTAACTCCGGATGAATTTTATTGTAAGAAG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGTCAAGTTCTTCGAGCGGTGAATCTCAATTGAGGCCTACTTAAAATAACATTCTTC / / / / / / // // / / / / FalI | | | Cac8I DdeI |MseI || | TspEI | FokI FalI | | CviJI | || | ApoI TspDTI | | AluI | || BseGI | SetI | |BspMII* Hpy178III* | |BetI* | Hpy178III* | HpaII Hpy166II HindII HpaI K A V Q E A R H L E L T P D E F Y C K K R Q F K K L A T * S * L R M N F I V R S G S S R S S P L R V N S G * I L L * E V ----:----|----:----|----:----|----:----|----:----|----:----| L A T * S A R W K S N V G S S N * Q L F * P L E L L E G S L T L E P H I K N Y S L C N L F S A V * L * S R I F K I T L L CviRI* Hpy178III* | Tsp4CI* | BssKI | | BssKI | SexAI | | TspRI | EcoRII | | | HpaII | | ScrFI | | | ScrFI | | BseBI | | | CauII* | | |SetI TfiI | | | | BsiYI* | | || Csp6I HinfI BsrI | | | | |BsiYI* | | || |RsaI \ \ \ \ \ \ \\ \ \ \\ \\ TTGTTAGAATCTACTGGCATTTGCACTGTTCCCGGTTCTGGGTTTGGTCAAGAACCTGGT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AACAATCTTAGATGACCGTAAACGTGACAAGGGCCAAGACCCAAACCAGTTCTTGGACCA / / / / / /// / / / // HinfI BsrI | | | ||BsiYI* | | | |RsaI TfiI | | | ||BssKI | | | EcoRII | | | |BsiYI* | | | SexAI | | | |HpaII | | | BssKI | | | CauII* | | BseBI | | | ScrFI | | ScrFI | | Tsp4CI* | SetI | CviRI* Hpy178III* TspRI L L E S T G I C T V P G S G F G Q E P G C * N L L A F A L F P V L G L V K N L V V R I Y W H L H C S R F W V W S R T W Y ----:----|----:----|----:----|----:----|----:----|----:----| N N S D V P M Q V T G P E P N P * S G P T T L I * Q C K C Q E R N Q T Q D L V Q Q * F R S A N A S N G T R P K T L F R T HgiCI* | NlaIV | |BssKI | |SexAI | |EcoRII | || ScrFI | || BseBI | || |SetI | || || Hpy178III* MseI | || || | MseI \ \ \\ \\ \ \ ACTTACCATTTAAGAACAACATTTTTGGCACCTGGTCTGGAATGGATTAAGAAATGGGAA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TGAATGGTAAATTCTTGTTGTAAAAACCGTGGACCAGACCTTACCTAATTCTTTACCCTT / / / / / / / / Csp6I MseI | | | | | MseI | | | | Hpy178III* | | | EcoRII | | | SexAI | | | BssKI | | BseBI | | ScrFI | HgiCI* NlaIV SetI T Y H L R T T F L A P G L E W I K K W E L T I * E Q H F W H L V W N G L R N G K L P F K N N I F G T W S G M D * E M G K ----:----|----:----|----:----|----:----|----:----|----:----| V * W K L V V N K A G P R S H I L F H S Y K G N L F L M K P V Q D P I S * S I P S V M * S C C K Q C R T Q F P N L F P F MaeIII ApoI Tsp45I TspEI Tsp4CI* \ \ AGTTTCCATAAAGAATTTTTTGACCAATACCGTGACTGA 1750 1760 1770 ----:----|----:----|----:----|----:---- TCAAAGGTATTTCTTAAAAAACTGGTTATGGCACTGACT / / / TspEI | Tsp45I ApoI | MaeIII Tsp4CI* S F H K E F F D Q Y R D * V S I K N F L T N T V T X F P * R I F * P I P * L X ----:----|----:----|----:----|----:---- L K W L S N K S W Y R S Q F N G Y L I K Q G I G H S T E M F F K K V L V T V S # Enzymes that cut Frequency Isoschizomers AciI 3 BspACI,SsiI AflIII 1 AhaIII* 1 DraI AjuI 1 AluI 15 AluBI AlwNI 1 CaiI ApoI 6 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BamHI 1 BarI 1 BbvCI 2 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 3 BpuEI BceAI 1 BdaI 2 BetI* 1 BsaWI BinI* 2 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 1 BmgT120I 2 BmtI 1 BspOI Bpu10I 2 BseBI 5 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 4 BseSI 1 BaeGI,BstSLI BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 5 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 4 BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 1 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BssKI 8 BstSCI,StyD4I BstKTI 1 Cac8I 2 BstC8I CauII* 3 BcnI,BpuMI,NciI,AsuC2I Cfr9I 1 TspMI,XmaCI,XmaI Csp6I 5 CviQI,RsaNI CviAII 4 CviJI 24 CviKI-1 CviRI* 4 HpyCH4V DdeI 8 BstDEI,HpyF3I DpnI 1 MalI Eco57I 1 AcuI Eco57MI 2 EcoP15I 2 EcoRI 1 EcoRII 5 AjnI,Psp6I,PspGI EcoRV 2 Eco32I FalI 2 FatI 4 FauI 1 SmuI FokI 5 GlaI 1 GsuI 1 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 4 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 9 Hin4II* 6 HpyAV Hin6I 1 HinP1I,HspAI HindII 2 HincII HindIII 3 HinfI 9 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 10 Hpy188III Hpy188I 3 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 6 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 3 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 11 MfeI 1 MunI MlyI 3 SchI MmeI 1 MnlI 14 MseI 11 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NheI 1 AsuNHI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PfoI 1 PleI 3 PpsI PmeI 1 MssI PshAI 1 BstPAI,BoxI PsiI 1 AanI PvuII 1 RsaI 5 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 8 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 38 SexAI 2 MabI SfaNI 2 LweI SfeI* 6 BstSFI,SfcI,BfmI SmaI 1 SmlI 3 SmoI SspI 1 TaiI 6 TaqI 6 TatI 1 TfiI 6 PfeI TseI 3 ApeKI TsoI 2 Tsp45I 2 NmuCI Tsp4CI* 9 HpyCH4III,TaaI,Bst4CI TspDTI 6 TspEI 16 TasI,Tsp509I,Sse9I TspRI 6 TscAI XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AgeI AlfI AloI ApaI ApaLI AscI Asp718I AvrII BalI BcgI BciVI BclI BfiI BglI BglII BplI BsaAI BsaBI BsaXI BsePI BseRI BseYI BsgI BsiI* Bsp120I Bsp1407I BspHI BspLU11I* BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI BtsI Cfr10I CfrI ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoT22I EgeI EheI Esp3I EspI* FnuDII* FseI FspAI GsaI HaeII HgiAI* HgiJII* Hpy99I KasI KpnI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PmaCI PpiI PpuMI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SauI* ScaI SfiI SfoI SgfI SgrAI SgrDI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TauI TspGWI TstI Tth111I VspI XbaI XcmI XhoI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769