Restriction Map of SHM2/YLR058C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SHM2/YLR058C on chromosome XII from coordinates 259401 to 257992.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.21537

EMBOSS_001 MboI Hpy188I BclI | Hpy99I | DpnI | | Hin4I | |BstKTI MnlI | | |HgaI | || MmeI | Hpy166II | | || HphI | || | SetI | | Hin4I \ \ \\ \ \ \\ \ \ \ \ \ ATGCCTTACACTCTATCCGACGCTCATCATAAGTTGATCACCTCTCATTTGGTGGACACC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGAATGTGAGATAGGCTGCGAGTAGTATTCAACTAGTGGAGAGTAAACCACCTGTGG / / / / // / / / | Hin4I | | || MmeI | Hpy166II Hpy188I | | || BclI | Hin4I Hpy99I | | || MboI MnlI | | || SetI | | |DpnI | | BstKTI | HgaI HphI M P Y T L S D A H H K L I T S H L V D T C L T L Y P T L I I S * S P L I W W T P A L H S I R R S S * V D H L S F G G H R ----:----|----:----|----:----|----:----|----:----|----:----| X G * V R D S A * * L N I V E * K T S V X A K C E I R R E D Y T S * R E N P P C H R V S * G V S M M L Q D G R M Q H V G MlyI PleI Eco57I | BsiYI* Eco57MI FokI | | Hpy166II | TspEI | TspDTI TaqI | | |HinfI | |BseGI | | BcgI ClaI \ \ \\ \ \\ \ \ \ \ GACCCTGAAGTGGACTCCATTATCAAGGATGAAATTGAAAGACAAAAGCACTCCATCGAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGGACTTCACCTGAGGTAATAGTTCCTACTTTAACTTTCTGTTTTCGTGAGGTAGCTA /// / / / / / / / / ||| | HinfI | | TspEI | FokI ClaI ||| Hpy166II | BseGI | BcgI TaqI ||PleI Eco57MI TspDTI |MlyI Eco57I BsiYI* D P E V D S I I K D E I E R Q K H S I D T L K W T P L S R M K L K D K S T P S I P * S G L H Y Q G * N * K T K A L H R F ----:----|----:----|----:----|----:----|----:----|----:----| S G S T S E M I L S S I S L C F C E M S R G Q L P S W * * P H F Q F V F A S W R V R F H V G N D L I F N F S L L V G D I HphI Hpy188I | ApoI | TspEI | | BcgI SfaNI | | |TspGWI |SetI TaqI StyI BccI | | || SetI || MnlI |MnlI SecI* \ \ \ \\ \ \\ \ \\ \ TTGATTGCTTCTGAAAATTTCACCTCAACCTCCGTTTTCGATGCCCTTGGAACTCCATTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAACGAAGACTTTTAAAGTGGAGTTGGAGGCAAAAGCTACGGGAACCTTGAGGTAAC / / // / / / / / / / BccI | || SetI SetI | | | TaqI SecI* | |TspGWI | | MnlI StyI | |TspEI | SfaNI | |ApoI MnlI | BcgI Hpy188I HphI L I A S E N F T S T S V F D A L G T P L * L L L K I S P Q P P F S M P L E L H C D C F * K F H L N L R F R C P W N S I V ----:----|----:----|----:----|----:----|----:----|----:----| K I A E S F K V E V E T K S A R P V G N N S Q K Q F N * R L R R K R H G Q F E M Q N S R F I E G * G G N E I G K S S W Q Hin4II* | Hpy188I | | SetI | | | BssKI | | | EcoRII | | | | MmeI | | | | ScrFI | | | | BseBI | | | | | SetI | | | | | | SduI | | | | | | HgiAI* | | | | | | |MaeIII | | | | | | ||Eco57I | | | | | | ||Eco57MI Tsp4CI* \ \ \ \ \ \ \\\ \ TCCAACAAATACTCTGAAGGTTATCCAGGTGCTCGTTACTACGGTGGTAATGAACACATT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTGTTTATGAGACTTCCAATAGGTCCACGAGCAATGATGCCACCATTACTTGTGTAA / / / / // / / / / | | SetI | || | | | Tsp4CI* | Hpy188I | || | | MaeIII Hin4II* | || | Eco57MI | || | Eco57I | || EcoRII | || HgiAI* | || BssKI | || SduI | |BseBI | |ScrFI | SetI MmeI S N K Y S E G Y P G A R Y Y G G N E H I P T N T L K V I Q V L V T T V V M N T L Q Q I L * R L S R C S L L R W * * T H * ----:----|----:----|----:----|----:----|----:----|----:----| D L L Y E S P * G P A R * * P P L S C M T W C I S Q L N D L H E N S R H Y H V C G V F V R F T I W T S T V V T T I F V N AluI CviJI | SetI | | MwoI | | |GsuI | | |Eco57MI | | |HindIII | | || AluI | | || XmnI | | || CviJI | | || | SetI | | || | | FatI | | || | | |CviAII TspDTI | | || | | || MaeIII | ApoI HindII | | || | | || |NlaIII | TspEI Hpy166II | | || | | || || Hpy178III* \ \ \ \ \ \\ \ \ \\ \\ \ GACAGAATGGAAATTCTATGTCAACAAAGAGCTTTGAAAGCTTTCCATGTTACTCCAGAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTCTTACCTTTAAGATACAGTTGTTTCTCGAAACTTTCGAAAGGTACAATGAGGTCTG / / / / / / / / / / / // / // TspDTI TspEI | | | | | | | | | || | |BstXI ApoI | | | | | | | | | || | Hpy178III* | | | | | | | | | || MaeIII | | | | | | | | | |FatI | | | | | | | | | CviAII | | | | | | | | NlaIII | | | | | | | HindIII | | | | | | CviJI | | | | | | XmnI | | | | | | AluI | | | | | SetI | | | | Eco57MI | | | | GsuI | | | MwoI | | CviJI | | AluI | SetI Hpy166II HindII D R M E I L C Q Q R A L K A F H V T P D T E W K F Y V N K E L * K L S M L L Q T Q N G N S M S T K S F E S F P C Y S R Q ----:----|----:----|----:----|----:----|----:----|----:----| S L I S I R H * C L A K F A K W T V G S Q C F P F E I D V F L K S L K G H * E L V S H F N * T L L S S Q F S E M N S W V MseI |HpaI |HindII |Hpy166II || MaeII || | SetI CviRI* BstXI || | TaiI XcmI BspMI | SetI \ \\ \ \ \ \ \ \ AAATGGGGTGTTAACGTCCAAACTTTATCTGGTTCTCCTGCTAACTTGCAGGTTTATCAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTTACCCCACAATTGCAGGTTTGAAATAGACCAAGAGGACGATTGAACGTCCAAATAGTT // / / / // / || MaeII XcmI | |SetI SetI |MseI | CviRI* |TaiI BspMI |SetI Hpy166II HindII HpaI K W G V N V Q T L S G S P A N L Q V Y Q N G V L T S K L Y L V L L L T C R F I K M G C * R P N F I W F S C * L A G L S S ----:----|----:----|----:----|----:----|----:----|----:----| L H P T L T W V K D P E G A L K C T * * C I P H * R G F K I Q N E Q * S A P K D F P T N V D L S * R T R R S V Q L N I L CviJI | FatI | BspHI | |CviAII | |Hpy178III* | || NlaIII AluI | || | BccI CviJI | || | |TspDTI BccI PflMI | SetI | || | ||MnlI TspDTI |SetI BsiYI* \ \ \ \\ \ \\\ \ \\ \ GCTATTATGAAGCCTCATGAAAGATTGATGGGTCTATACCTACCAGATGGTGGTCATTTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGATAATACTTCGGAGTACTTTCTAACTACCCAGATATGGATGGTCTACCACCAGTAAAC / / / /// / / / / / CviJI | | ||| MnlI TspDTI | BccI BsiYI* AluI | | ||| BccI SetI PflMI | | ||TspDTI | | |BspHI | | |FatI | | Hpy178III* | | CviAII | NlaIII CviJI A I M K P H E R L M G L Y L P D G G H L L L * S L M K D * W V Y T Y Q M V V I C Y Y E A S * K I D G S I P T R W W S F V ----:----|----:----|----:----|----:----|----:----|----:----| A I I F G * S L N I P R Y R G S P P * K L * * S A E H F I S P D I G V L H H D N S N H L R M F S Q H T * V * W I T T M Q BsmAI TaqI | MaeIII ApoI AsuII | EcoP15I TspEI | TfiI | Tsp4CI* |XmnI | HinfI \ \ \\ \ \ TCTCACGGTTACGCTACTGAAAACAGAAAAATTTCTGCTGTTTCCACATACTTCGAATCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGTGCCAATGCGATGACTTTTGTCTTTTTAAAGACGACAAAGGTGTATGAAGCTTAGA / / / / / / / | | MaeIII | TspEI | HinfI | EcoP15I | ApoI | TfiI | BsmAI XmnI AsuII Tsp4CI* TaqI S H G Y A T E N R K I S A V S T Y F E S L T V T L L K T E K F L L F P H T S N L S R L R Y * K Q K N F C C F H I L R I F ----:----|----:----|----:----|----:----|----:----|----:----| D * P * A V S F L F I E A T E V Y K S D T E R N R * Q F C F F K Q Q K W M S R I R V T V S S F V S F N R S N G C V E F R AgeI MseI BetI* |HpaI Cfr10I |HindII BsiYI* |Hpy166II |HpaII TaqI FokI \\ \\ \ \ TTCCCATACAGAGTTAACCCAGAAACCGGTATTATCGACTACGATACTTTAGAAAAGAAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGGTATGTCTCAATTGGGTCTTTGGCCATAATAGCTGATGCTATGAAATCTTTTCTTG // / // / / / |MseI | |Cfr10I TaqI FokI BseGI | | |BetI* | | |AgeI | | HpaII | BsiYI* Hpy166II HindII HpaI F P Y R V N P E T G I I D Y D T L E K N S H T E L T Q K P V L S T T I L * K R T P I Q S * P R N R Y Y R L R Y F R K E R ----:----|----:----|----:----|----:----|----:----|----:----| K G Y L T L G S V P I I S * S V K S F F K G M C L * G L F R Y * R S R Y K L F S E W V S N V W F G T N D V V I S * F L V SetI Tsp4CI* Eco57I Csp6I | MseI BseGI BccI Eco57MI |RsaI | |TspEI \ \ \ \\ \ \\ GCCATCCTATATAGACCAAAGGTTCTTGTTGCTGGTACTTCAGCATACTGTCGTTTAATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTAGGATATATCTGGTTTCCAAGAACAACGACCATGAAGTCGTATGACAGCAAATTAA / / / // / / / BccI | Eco57MI |Csp6I Tsp4CI* | TspEI | Eco57I RsaI MseI SetI A I L Y R P K V L V A G T S A Y C R L I P S Y I D Q R F L L L V L Q H T V V * L H P I * T K G S C C W Y F S I L S F N * ----:----|----:----|----:----|----:----|----:----|----:----| A M R Y L G F T R T A P V E A Y Q R K I R W G I Y V L P E Q Q Q Y K L M S D N L G D * I S W L N K N S T S * C V T T * N AccI |Hpy166II || FatI || |CviAII || || AsuI* BccI || || NlaIII \ \\ \\ \ GACTACAAGAGAATGAGAGAAATCGCCGACAAATGTGGTGCTTACTTGATGGTAGACATG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTGATGTTCTCTTACTCTCTTTAGCGGCTGTTTACACCACGAATGAACTACCATCTGTAC / /// // BccI ||| |FatI ||| CviAII ||NlaIII |AccI Hpy166II D Y K R M R E I A D K C G A Y L M V D M T T R E * E K S P T N V V L T * W * T W L Q E N E R N R R Q M W C L L D G R H G ----:----|----:----|----:----|----:----|----:----|----:----| S * L L I L S I A S L H P A * K I T S M Q S C S F S L F R R C I H H K S S P L C V V L S H S F D G V F T T S V Q H Y V H AarI BspMI |MboI || FokI || DpnI || |BstKTI || || AciI CviJI || || BisI BccI HaeIII || || |BlsI SetI | TaqI BmgT120I BstXI || || ||TauI | BseGI | AsuII EcoRV \ \ \\ \\ \\\ \ \ \ \ \ GCCCACATTTCTGGTTTGATCGCCGCAGGTGTCATCCCATCTCCTTTCGAATACGCTGAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGGGTGTAAAGACCAAACTAGCGGCGTCCACAGTAGGGTAGAGGAAAGCTTATGCGACTA /// / ///////// / / / / ||| BstXI ||||||||| BseGI | AsuII EcoRV ||AsuI* ||||||||SetI | TaqI |BmgT120I |||||||AciI BccI HaeIII ||||||BisI CviJI |||||BlsI |||||FokI ||||TauI |||MboI ||BspMI ||AarI |DpnI BstKTI A H I S G L I A A G V I P S P F E Y A D P T F L V * S P Q V S S H L L S N T L I P H F W F D R R R C H P I S F R I R * Y ----:----|----:----|----:----|----:----|----:----|----:----| A W M E P K I A A P T M G D G K S Y A S P G C K Q N S R R L H * G M E K R I R Q G V N R T Q D G C T D D W R R E F V S I AsuI* AvaII |BmgT120I ||SetI |||Hpy166II |||| BdaI |||| BdaI |||| MaeII |||| |PmaCI |||| |BsaAI |||| || SetI |||| || TaiI |||| || Eco57I Ksp632I* |||| || Eco57MI |MnlI |||| || |DraIII || BdaI MaeIII MnlI |||| || || MboII || BdaI \ \ \\\\ \\ \\ \ \\ \ ATCGTTACCACCACCACTCACAAGTCTTTGAGAGGTCCACGTGGTGCTATGATTTTCTTC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCAATGGTGGTGGTGAGTGTTCAGAAACTCTCCAGGTGCACCACGATACTAAAAGAAG / / / /// // / // / MaeIII MnlI | ||| |MaeII MboII || Ksp632I* | ||| Eco57MI || Hpy188I | ||| DraIII |BdaI | ||| Eco57I |BdaI | ||| BsaAI MnlI | ||| PmaCI | ||TaiI | ||SetI | |Hpy166II | |AvaII | |AsuI* | |BdaI | |BdaI | BmgT120I SetI I V T T T T H K S L R G P R G A M I F F S L P P P L T S L * E V H V V L * F S S R Y H H H S Q V F E R S T W C Y D F L Q ----:----|----:----|----:----|----:----|----:----|----:----| I T V V V V * L D K L P G R P A I I K K Y R * W W W E C T K S L D V H H * S K R D N G G G S V L R Q S T W T T S H N E E SetI | MboI | BdaI AgeI | BdaI BetI* | BglII Cfr10I | XhoII BsiYI* | |MboII |HpaII | ||DpnI || BdaI Hpy188I | |||BstKTI DdeI || BdaI \ \ \\\\ \ \\ \ AGAAGAGGTGTGAGATCTATCAACCCTAAGACCGGTAAGGAAGTTCTATACGACTTGGAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTCTCCACACTCTAGATAGTTGGGATTCTGGCCATTCCTTCAAGATATGCTGAACCTT / / /// / // / // SetI | ||| XhoII || | |Cfr10I | ||| BglII || | |BetI* | ||| MboI || | |AgeI | ||DpnI || | HpaII | |BstKTI || BdaI | MboII || BdaI BdaI |DdeI BdaI BsiYI* R R G V R S I N P K T G K E V L Y D L E E E V * D L S T L R P V R K F Y T T W K K R C E I Y Q P * D R * G S S I R L G K ----:----|----:----|----:----|----:----|----:----|----:----| L L P T L D I L G L V P L S T R Y S K S * F L H S I * * G * S R Y P L E I R S P S S T H S R D V R L G T L F N * V V Q F HphI | BssKI | SecI* | EcoRII | | ScrFI | | BseBI | | | MaeIII | | | Tsp45I | | | BstEII | | | | SetI | | | | | StyI | | | | | SecI* | | | | | | OliI | | | | | | MslI | | | | | | | SetI | | | | | | | |AsuI* | | | | | | | |AvaII | | | | | | | ||BmgT120I TspEI | | | | | | | ||| Hpy166II | MseI | | | | | | | ||| | BbvI BsrDI \ \ \ \ \ \ \ \ \ \\\ \ \ \ AACCCAATTAACTTCTCTGTTTTCCCAGGTCACCAAGGTGGTCCACACAACCATACCATT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGGTTAATTGAAGAGACAAAAGGGTCCAGTGGTTCCACCAGGTGTGTTGGTATGGTAA // / //// / / / // / / |MseI HphI |||| | | | |Hpy166II | BsrDI TspEI |||| | | | |AvaII BbvI |||| | | | |AsuI* |||| | | | BmgT120I |||| | | SecI* |||| | | StyI |||| | MslI |||| | OliI |||| | SetI |||| BstEII |||| Tsp45I |||| MaeIII |||EcoRII |||BssKI ||SecI* |BseBI |ScrFI SetI N P I N F S V F P G H Q G G P H N H T I T Q L T S L F S Q V T K V V H T T I P L P N * L L C F P R S P R W S T Q P Y H C ----:----|----:----|----:----|----:----|----:----|----:----| F G I L K E T K G P * W P P G C L W V M F G L * S R Q K G L D G L H D V C G Y W V W N V E R N E W T V L T T W V V M G N TseI |BisI ||BlsI ||XcmI ||| MwoI ||| |CfrI ||| || BalI ||| || CviJI ||| || HaeIII ||| || |BtsI ||| || || BbvI ||| || || | TspRI ||| || || | | GsuI ||| || || | | Eco57MI ||| || || | | | Cac8I ||| || || | | | | TseI ||| || || | | | | AluI Hpy178III* ||| || || | | | | CviJI | ApoI ||| || || | | | | |BisI | TspEI ||| || || | | | | ||BlsI | EcoRI ||| || || | | | | ||SetI | | Bce83I* SmlI \\\ \\ \\ \ \ \ \ \\\ \ \ \ \ GCTGCTTTGGCCACTGCTTTGAAGCAAGCTGCCACTCCAGAATTCAAGGAATACCAAACT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGAAACCGGTGACGAAACTTCGTTCGACGGTGAGGTCTTAAGTTCCTTATGGTTTGA /// // / // / //// / / / ||MwoI || CfrI |BbvI | |||TseI | | EcoRI ||TseI |HaeIII Eco57MI | ||BisI | | TspEI |BisI |CviJI GsuI | |BlsI | | ApoI XcmI |BalI | CviJI | Bce83I* BlsI TspRI | AluI Hpy178III* BtsI Cac8I SetI A A L A T A L K Q A A T P E F K E Y Q T L L W P L L * S K L P L Q N S R N T K L C F G H C F E A S C H S R I Q G I P N S ----:----|----:----|----:----|----:----|----:----|----:----| A A K A V A K F C A A V G S N L S Y W V Q Q K P W Q K S A L Q W E L I * P I G F S S Q G S S Q L L S G S W F E L F V L S DdeI Bpu10I PsrI |BsmI ApoI || MboII TspEI CviJI Hpy178III* || |CviJI | MseI |SfeI* \ \\ \\ \ \ \\ CAAGTCTTGAAGAATGCTAAGGCTTTGGAAAGTGAATTTAAGAACTTGGGCTACAGATTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCAGAACTTCTTACGATTCCGAAACCTTTCACTTAAATTCTTGAACCCGATGTCTAAT / / / / / / / / / / SmlI | | | CviJI PsrI | MseI | SfeI* | | Bpu10I TspEI CviJI | | MboII ApoI | | DdeI | BsmI Hpy178III* Q V L K N A K A L E S E F K N L G Y R L K S * R M L R L W K V N L R T W A T D * S L E E C * G F G K * I * E L G L Q I S ----:----|----:----|----:----|----:----|----:----|----:----| * T K F F A L A K S L S N L F K P * L N E L R S S H * P K P F H I * S S P S C I L D Q L I S L S Q F T F K L V Q A V S * PsrI | Acc65I | HgiCI* | Tsp4CI* | |Csp6I | ||RsaI FatI | ||NlaIV |CviAII | ||| KpnI || NlaIII | ||| | TfiI || | MmeI | ||| | HinfI || | | MaeI SmlI BciVI BccI Bce83I* \ \\\ \ \ \\ \ \ \ \ \ \ \ GTTTCCAACGGTACCGATTCTCACATGGTTCTAGTATCCTTGAGAGAAAAGGGTGTTGAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGGTTGCCATGGCTAAGAGTGTACCAAGATCATAGGAACTCTCTTTTCCCACAACTA / // /// / / // / // / / PsrI || ||| | | |MmeI MaeI |BciVI BccI Bce83I* || ||| | | |FatI SmlI || ||| | | CviAII || ||| | NlaIII || ||| HinfI || ||| TfiI || ||HgiCI* || ||Acc65I || |Csp6I || NlaIV || RsaI |KpnI Tsp4CI* V S N G T D S H M V L V S L R E K G V D F P T V P I L T W F * Y P * E K R V L M F Q R Y R F S H G S S I L E R K G C * W ----:----|----:----|----:----|----:----|----:----|----:----| T E L P V S E * M T R T D K L S F P T S L K W R Y R N E C P E L I R S L F P H Q N G V T G I R V H N * Y G Q S F L T N I BsiI* MseI |SduI | BsrDI BssKI |HgiAI* | | PpiI EcoRII \\ \ \ \ \ GGTGCTCGTGTTGAATACATTTGTGAAAAGATTAACATTGCTTTGAACAAAAACTCTATT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGAGCACAACTTATGTAAACACTTTTCTAATTGTAACGAAACTTGTTTTTGAGATAA / / /// HgiAI* BsiI* ||MseI SduI |BsrDI PpiI G A R V E Y I C E K I N I A L N K N S I V L V L N T F V K R L T L L * T K T L F C S C * I H L * K D * H C F E Q K L Y S ----:----|----:----|----:----|----:----|----:----|----:----| P A R T S Y M Q S F I L M A K F L F E I H H E H Q I C K H F S * C Q K S C F S * T S T N F V N T F L N V N S Q V F V R N BsiYI* NlaIV | CviJI |BssKI | |NlaIV |EcoRII | ||SduI ScrFI ||TspGWI | ||HgiJII* BseBI |||ScrFI | ||| CviJI | MaeIII |||BseBI | ||| |FatI | Tsp45I |||| SetI | ||| ||CviAII | | SetI |||| | GsuI | ||| ||| NlaIII | | | PpiI HphI |||| | Eco57MI | ||| ||| |MnlI \ \ \ \ \ \\\\ \ \ \ \\\ \\\ \\ CCAGGTGACAAATCTGCTTTGGTTCCAGGTGGTGTCCGTATTGGGGCTCCAGCCATGACC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCCACTGTTTAGACGAAACCAAGGTCCACCACAGGCATAACCCCGAGGTCGGTACTGG //// / / / // // / / // // // / |||| | HphI | || |Eco57MI | | || || || TaqII |||| Tsp45I | || |GsuI | | || || |FatI |||| MaeIII | || EcoRII | | || || |MnlI |||EcoRII | || BssKI | | || || CviAII |||BssKI | |BseBI | | || |NlaIII ||PpiI | |ScrFI | | || CviJI |BseBI | SetI | | |NlaIV |ScrFI TspGWI | | CviJI SetI NlaIV | HgiJII* | SduI BsiYI* P G D K S A L V P G G V R I G A P A M T Q V T N L L W F Q V V S V L G L Q P * P R * Q I C F G S R W C P Y W G S S H D H ----:----|----:----|----:----|----:----|----:----|----:----| G P S L D A K T G P P T R I P A G A M V E L H C I Q K P E L H H G Y Q P E L W S W T V F R S Q N W T T D T N P S W G H G HphI TaqII | MboII |MaeI | | MboII CviJI || XcmI | | |TspEI MseI |SfeI* \\ \ \ \ \\ \ \\ ACTAGAGGAATGGGTGAAGAAGATTTCCACAGAATTGTTCAATACATTAACAAGGCTGTA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGATCTCCTTACCCACTTCTTCTAAAGGTGTCTTAACAAGTTATGTAATTGTTCCGACAT // / / / / / / / |XcmI | | MboII TspEI MseI | SfeI* MaeI | MboII CviJI HphI T R G M G E E D F H R I V Q Y I N K A V L E E W V K K I S T E L F N T L T R L * * R N G * R R F P Q N C S I H * Q G C R ----:----|----:----|----:----|----:----|----:----|----:----| V L P I P S S S K W L I T * Y M L L A T W * L F P H L L N G C F Q E I C * C P Q S S S H T F F I E V S N N L V N V L S Y HindIII | AluI | CviJI ApoI | |SfaNI TspEI | ||SetI MseI EcoRI | ||Cac8I BseGI FokI \ \ \\\ \ \ GAATTCGCTCAACAAGTTCAACAAAGCTTGCCAAAGGATGCTTGTAGATTAAAGGACTTC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAAGCGAGTTGTTCAAGTTGTTTCGAACGGTTTCCTACGAACATCTAATTTCCTGAAG / / / / / / / / / EcoRI | | | SfaNI BseGI | FokI Hin4I TspEI | | HindIII MseI ApoI | | Cac8I | CviJI | AluI SetI E F A Q Q V Q Q S L P K D A C R L K D F N S L N K F N K A C Q R M L V D * R T S I R S T S S T K L A K G C L * I K G L Q ----:----|----:----|----:----|----:----|----:----|----:----| S N A * C T * C L K G F S A Q L N F S K L I R E V L E V F S A L P H K Y I L P S F E S L L N L L A Q W L I S T S * L V E Hin4I CviJI |StyI |SecI* || SalI || Hin4II* || |TaqI || |AccI || |SetI Hin4I || ||HindII |BssKI || ||Hpy166II |EcoRII || ||| Hpy99I || ScrFI || ||| | CviJI || BseBI ApoI || ||| | | Hpy188I || |SetI TspEI \\ \\\ \ \ \ \\ \\ \ AAAGCCAAGGTCGACGAAGGCTCTGATGTTTTGAACACCTGGAAAAAGGAAATTTACGAC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCGGTTCCAGCTGCTTCCGAGACTACAAAACTTGTGGACCTTTTTCCTTTAAATGCTG / / / //// / / / / / / / | | | |||SalI | Hpy188I | | | EcoRII TspEI | | | ||AccI CviJI | | | BssKI ApoI | | | ||TaqI | | BseBI | | | |Hpy166II | | ScrFI | | | |HindII | SetI | | | Hpy99I Hin4I | | Hin4II* | | SecI* | | StyI | SetI CviJI K A K V D E G S D V L N T W K K E I Y D K P R S T K A L M F * T P G K R K F T T S Q G R R R L * C F E H L E K G N L R L ----:----|----:----|----:----|----:----|----:----|----:----| L A L T S S P E S T K F V Q F F S I * S * L W P R R L S Q H K S C R S F P F K R F G L D V F A R I N Q V G P F L F N V V BsrI CviJI | Cac8I | | BfiI CviJI \ \ \ \ TGGGCTGGCGAATACCCATTGGCTGTGTAA 1390 1400 1410 ----:----|----:----|----:----| ACCCGACCGCTTATGGGTAACCGACACATT / / / / / | | | BfiI CviJI | | Cac8I | CviJI BsrI W A G E Y P L A V * G L A N T H W L C X G W R I P I G C V X ----:----|----:----|----:----| Q A P S Y G N A T Y S P Q R I G M P Q T P S A F V W Q S H L # Enzymes that cut Frequency Isoschizomers AarI 1 Acc65I 1 Asp718I AccI 2 FblI,XmiI AciI 1 BspACI,SsiI AgeI 2 AsiGI,BshTI,CspAI,PinAI AluI 5 AluBI ApoI 7 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 2 BseXI,BstV1I,Lsp1109I BccI 7 Bce83I* 2 BpuEI BcgI 1 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BdaI 4 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglII 1 BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 3 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BseBI 5 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspHI 1 CciI,PagI,RcaI BspMI 2 BfuAI,Acc36I,BveI BsrDI 2 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 3 BstXI 2 BtsI 1 Cac8I 3 BstC8I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CviAII 5 CviJI 17 CviKI-1 CviRI* 1 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 3 MalI DraIII 1 AdeI Eco57I 4 AcuI Eco57MI 7 EcoP15I 1 EcoRI 2 EcoRII 5 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FatI 5 FokI 4 GsuI 3 BpmI HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 2 Hin4II* 2 HpyAV HindII 4 HincII HindIII 2 HinfI 3 HpaI 2 KspAI HpaII 2 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 9 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 5 Hpy99I 2 KpnI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 6 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MlyI 1 SchI MmeI 3 MnlI 7 MseI 8 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PleI 1 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PpiI 1 PsrI 1 RsaI 2 AfaI SalI 1 ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 24 SfaNI 2 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 2 SmoI StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 6 TaqII 1 TauI 1 TfiI 2 PfeI TseI 2 ApeKI Tsp45I 2 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI XcmI 3 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI AclI AcyI AflII AflIII AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI AvaI AvrII BaeI BamHI BarI BbvCI BbvII* BceAI BglI BinI* BmeT110I BmtI BplI BsaBI BsaXI BseMII BsePI BseRI BseSI BseYI BsgI BslFI BsmFI Bsp120I Bsp1407I BspCNI BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstZ17I BtgZI BtrI CauII* Cfr9I CspCI DinI DraII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GlaI GsaI HaeII HhaI Hin6I HinP1I HspAI KasI MauBI McrI* MfeI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI PacI PasI PfoI PmeI PpuMI PshAI PsiI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TatI TsoI TspMI TstI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769